CD44v5 domain regulates crosstalk between TNBC cells and tumor‐associated macrophages by enhancing the IL‐4R/STAT3 axis

Abstract

Triple‐negative breast cancer (TNBC) has greater infiltration of M2‐like macrophages (TAMs), which enhances cancer cell invasion and leads to a poor prognosis. TNBC progression is mediated by both tumor cells and the tumor microenvironment (TME). Here we elucidate the mechanism of the interaction between TNBC cells and TAMs. In this study, we confirmed that CD44v5 is highly expressed in TNBC, which drives TNBC cell metastasis and promotes TAM polarization by co‐localizing with IL4Rα and inhibiting its internalization and degradation, thereby promoting activation of the STAT3/IL6 signaling axis. At the same time, TAMs also facilitate TNBC cell metastasis by secreting IL‐4, IL‐6, and other cytokines, in which the IL‐4/IL‐4R/STAT3/IL‐6 signaling axis plays the same role for TNBC cells responding to TAMs. Moreover, we found that the above progress could be suppressed when the CD44v5 domain was blocked. We demonstrated that the CD44v5/IL‐4R/STAT3/IL‐6 signaling pathway plays a key role in TNBC cell metastasis, and in TNBC cells inducing TAM polarization and responding to TAMs, promoting metastasis. Collectively, we suggest that the CD44v5 domain may be a promising target for regulating the TME of TNBC as well as treating TNBC.

Triple‐negative breast cancer (TNBC) has been shown to cause greater infiltration and polarization of M2‐like macrophages (TAMs), which enhances cancer cell invasion and leads to a poor prognosis. TNBC progression is mediated by both tumor cells and the tumor microenvironment (TME). Here we elucidate the mechanism of the interaction between TNBC cells and TAMs.

1. INTRODUCTION

Breast cancer is the most common malignant tumor among women worldwide. ¹ Breast cancer is a highly heterogeneous disease, with wide variations in clinical treatment and prognosis among patients. Its molecular subtypes can be categorized into luminal A, luminal B, HER2 overexpression, basal‐like (BLBC), and other special subtypes. ² Triple‐negative breast cancer (TNBC) is a subtype of breast cancer defined by the absence of estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor‐2 (HER2) receptor; it is highly invasive, metastatic, prone to recurrence, and a poor prognosis. ³ The overlap rate between TNBC and BLBC can be as high as 60%–90%. ⁴ , ⁵ TNBC has a short survival time, with an approximately 40% mortality rate within 5 years after diagnosis. ⁶ , ⁷ Therefore, there is an urgent need to develop new therapeutic regimens for TNBC patients.

The tumor microenvironment (TME) is the microenvironment that exists around tumor cells and contains a variety of nonmalignant cells and noncellular components, including immune system components, blood cells, endothelial cells, adipocytes, and stromal components, which alter tumor behavior in a variety of ways. ⁸ The largest proportion of the tumor immune microenvironment is composed of macrophages, which play an important role in innate and acquired immunity and have significant phenotypic heterogeneity and functional diversity. The infiltration of M2‐like tumor‐associated macrophages (TAMs) in breast cancer enhances cancer cell invasion, stimulates tumor angiogenesis, inhibits the anti‐tumor function of cytotoxic T cells, and mediates chemoresistance, leading to a poor prognosis for patients. ⁹ Studies have shown that TNBC has a greater infiltration of TAMs. ¹⁰ , ¹¹

In addition to immune cells, cytokines also play an important role in the TME, such as IL‐4, IL‐6, and CCL2. Breast cancer cell‐derived IL‐4 can promote breast cancer development and metastasis by promoting TAM polarization and tumor immune escape. ¹² The upregulation of IL‐4/IL‐4R signaling induces an increased Th2 response and TAM polarization, which promotes immunosuppression and angiogenesis in cancers and results in a poor prognosis, ^.3 TNBC has higher levels of IL‐4 in the tumor milieu, compared with non‐TNBC. ¹⁴ , ¹⁵

Studies have shown elevated CD44 expression in a variety of tumors ¹⁶ , ¹⁷ and is strongly associated with aggressiveness and a poor prognosis. The CD44 gene is often selectively spliced, giving rise to standard (CD44s) and variant (CD44v) isoforms. ¹⁸ Researchers have revealed that CD44s promotes breast cancer development and a cancer stemness gene signature, and they have also shown that the major isoform expressed by breast tumor stem cells is CD44s, and its elimination impairs the tumor stem cell signature. ¹⁹ Some researchers have also demonstrated that, in TNBC, CD44v8‐10 is important for maintaining cancer cell stemness. ²⁰ Current studies based on the role of CD44 in tumors have focused on tumor epithelial–mesenchymal transition (EMT), but the mechanism of formation of TME with the CD44 and how tumor TME regulates breast cancer development and metastasis remain unclear.

In our previous study, we found that the CD44v5 domain in Th2 cells contacts and acts as a cell membrane anchor to the IL‐4Rα extra membranous region, which in turn promotes the polarization of Th2 cells. ²¹ The CD44v5 domain is also highly expressed in TNBC along with IL‐4Rα, we hypothesized that a similar role exists in breast cancer cells.

Our study reveals the unique TME formation mechanism of TNBC, the CD44v5 domain promotes the IL‐4/IL‐4R/STAT3/IL‐6 signaling axis signaling through co‐localization with IL‐4Rα, which enhances self‐migration on the one hand, and promotes the polarization of M0 macrophages to TAMs on the other hand, thus regulating the TME and, at the same time, the CD44v5 domain also plays a role in enhancing the response of tumor cells to the TME. More importantly, blocking or knocking down the CD44v5 domain can inhibit the above phenomena, which suggests that the CD44v5 domain may be a promising target for regulating the TME of TNBCs, as well as treating TNBCs.

2. MATERIALS AND METHODS

2.1. Cell culture

Triple‐negative breast cancer cell lines MDA‐MB‐231, MDA‐MB‐468. Non‐TNBC cell line: MCF‐7. MCF‐7 and 293 T, MDA‐MB‐231 and MDA‐MB‐468 (obtained from Pricella) were cultured in Dulbecco's modified Eagle's medium (Gibco) with 10% fetal bovine serum (FBS), and 1% penicillin–streptomycin antibiotics. THP‐1 human monocyte cells were cultured in RPMI‐1640 medium (Gibco) with 10% FBS, 1% penicillin–streptomycin antibiotics. All cell lines were maintained at 37°C and 5% CO₂ and tested regularly for Mycoplasma infection. The identity of cell lines was verified by short tandem repeat profiling. From thawing, cells were recovered for two passages and were passaged a maximum of 10 times when experiments were performed.

2.2. Western blot

For immunoblotting analyses, cells were lysed in RIPA buffer (50 mmol/L Tris–HCl, pH 7.4, 150 mmol/L NaCl, 1% Triton X‐100, 1% sodium deoxycholate, 0.1% SDS and EDTA) containing protease inhibitor cocktail (Biosharp) and phosphatase inhibitor cocktail (Beyotime Biotechnology). Proteins were quantified using the bicinchoninic acid assay (Boster), resolved by SDS–PAGE, and transferred onto a PVDF membrane (Millipore). Then, the membrane was sealed with 5% skimmed milk powder for 1 h and incubated overnight at 4°C with the primary antibody at the recommended concentration. On the second day, the PVDF membrane was washed with TBST for 15 min × three times, then incubated with the second antibody at room temperature for 1 h on a shaker. Later, the membrane was washed with TBST for 15 min three times. Finally, membranes were exposed using the Super‐sensitive ECL chemiluminescent substrate (Biosharp). The resulting complexes were subjected to immunoblotting analysis. Primary antibodies included anti‐CD444v5 (Invitrogen), anti‐IL4Rα (Proteintech), anti‐phosphorylated STAT3 (Cell Signaling Technology), anti‐CD163 (Affinity), actin (Proteintech); second antibodies included goat anti‐mouse IgG (H + L) HRP (Affinity), and goat anti‐rabbit IgG (H + L) HRP (Affinity).

2.3. Wound healing assay

Breast cancer cells, MCF‐7, MDA‐MB‐231 and MDA‐MB‐468 cells, were seeded into a six‐well plate, THP‐1 cells induced with IL‐4 were seeded into the upper chamber of a Transwell plate. When breast cancer cells reached 90% confluency, a 10‐μL pipette tip was used to create a vertical scratch and the images were first captured at the 0 time point. The medium containing floating cells was decanted, and all wells were washed with PBS and then co‐cultured for 24 h. Then images depicting different treatments were captured for a second time. An inverted microscopy was used to observe cell migration within the scratch, photographs were taken, and image analysis software was used to measure the scratch width.

2.4. Cell invasion assays

For invasion assays, cells were seeded at 2 × 10⁵ in the 8.0‐μm pore polyester membrane (Corning) with Matrigel (ABW Matrigengel). Growth medium containing 10% FBS or TAMs (induced by IL‐4 of 20 ng/mL, Proteintech) was used as the chemoattractant in the lower chamber. After 24 h, invading cells were fixed in 4% paraformaldehyde and stained with 1% crystal violet. Cells were counted under a light microscope with three individual fields per insert.

2.5. Co‐culture experiment

Human monocyte THP‐1 cells 4 × 10⁵ were seeded and differentiated to M0 macrophages in phorbol 12‐myristate 13‐acetate (PMA; 100 ng/mL, MCE) in the bottom layer of six‐well plate. The following day, breast cancer cells (MCF‐7, MDA‐MB‐231, and MDA‐MB‐468) 5 × 10⁵ were seeded onto a 0.4‐μm porous insert layer (Corning). Then, both differentiated M0 macrophages in the bottom layer and breast cancer cells in the insert layer were combined for co‐culture for 3–4 days. The expression of CD163 on polarized macrophages was detected by western blotting.

2.6. Plasmid transfection and lentiviral infection

To generate stable cell lines expressing shRNA, 293T cells were placed in a T25 cell culture flask 1 day before transfection. When reached 50–70% confluency, 293T cells were transfected with each lentivirus expression vector 3 μg and packaging plasmid 3 μg mix using transfection reagents Lipofectamine 3000 (Invitrogen). The supernatant containing viruses was collected 48 h after transfection, filtered, and used for infecting target cells (MCF‐7, MDA‐MB‐231, and MDA‐MB‐468) in the presence of 10 μg/mL of polybrene prior to drug selection with 5 μg/mL of puromycin (Beyotime Biotechnology) for 1 week. Successfully knockdown in the established cell lines was confirmed by immunoblotting.

2.7. Quantitative real‐time polymerase chain reaction

Total RNA was extracted from cells by subjecting them to TRIzol reagent (Invitrogen), according to the manufacturer's instructions. The RNA concentration was measured. Then, 2 μg mRNA was reverse transcribed to complementary DNA using our proprietary reverse transcription system. Quantitative polymerase chain reaction (qPCR) assays were performed with EvaGreen mix (Biotium) according to the manufacturer‘s protocol. cd44v5 was amplified using the forward primer 5′‐CTGAAGACATCTACCCCAGCAAC and the reverse primer 5′‐ATAAGCAGTGGTGCCATTTCTG. GAPDH was amplified using the forward primer 5′‐TGCACCACCAACTGCTTAGC and the reverse primer 5′‐GGCATGGACTGTGGTCATGAG. The expression of each target transcript was calculated using the Delta Delta (ΔΔ) cycle threshold (C_t) method normalized to the expression of the GAPDH housekeeping gene, where ΔΔC_t = ΔC_t (treated) − ΔC_t (control), and the relative gene expression was calculated using 2^−ΔΔCt.

2.8. Immunohistochemistry (IHC) and confocal experiment

For human subjects, all tissues were obtained with informed consent compliance with the Ethical Committee of the 4th Hospital of Harbin Medical University. All patients provided written informed consent prior to study entry.

Human tumor slices were cut to a 5‐μm thickness. After being deparaffinized in xylene and rehydrated, the tissue sections were washed 5 min three times with PBS. Then, an immunohistochemistry pen was used to draw circles around the tissue sections to prevent fluid spills during subsequent experiments. Antigen repair was carried out with antigen repair solution so that the epitope of the antigen was exposed to combine with antibody fully. Then, endogenous peroxidase blocking and blocking were performed using the rabbit‐specific HRP/DAB (ABC) Detection IHC Kit (ab64261) and mouse‐specific HRP/DAB (ABC) Detection IHC Kit (ab64259). For the IHC experiment, primary antibodies were applied overnight at 4°C in a wet chamber. On the second day, after washing 5 min three times with PBS, the tumor sections were incubated with secondary antibodies for 10 min at room temperature. Then, after washing 5 min three times with PBS, the sections were incubated with streptavidin peroxidase for 10 min at room temperature. The tumor sections were subsequently washed three times with the above wash buffer. Diaminobenzidine (DAB) reagent was added to these tumor sections, which were then counterstained with hematoxylin to visualize the nuclei. Finally, the tissue sections were dehydrated and sealed for preservation.

For the confocal experiment, the two primary antibodies were incubated simultaneously overnight at 4°C in a wet chamber. On the second day, they were incubated with the appropriate secondary antibody including goat anti‐mouse IgG (H + L) Fluor 594‐conjugated (Affinity), goat anti‐rabbit IgG (H + L) FITC‐conjugated (Affinity). DNA staining was performed using a Fluor shield mounting medium with DAPI (Beyotime Biotechnology). Microscope analyses were performed using a confocal laser scanning microscope (Cellsens Microsystems).

2.9. ELISA

Cells were seeded in six‐well plates for 24 h. The conditioned medium (CM) was centrifuged for 25 min at 2500 rpm, and then the supernatant was collected to perform the assay. IL‐4 and CCL2 cytokines in the culture medium were assayed using an ELISA kit (Jing Mei Biotechnology) according to the manufacturer's protocol, and IL‐6 was measured using the clinical instrument Ranos IMS1200 by magnetic particle chemiluminescence immunoassay.

2.10. Statistical analysis

Statistical significance was analyzed by t‐test and one‐way ANOVA followed by Tukey's post‐test (GraphPad Prism version 9.0 and IBM SPSS Statistics 23). Data are presented as the mean ± SD. A p‐value < 0.05 was considered significant, p > 0.05 was considered not significant. *p < 0.05; **p < 0.01; ***p < 0.0001.

3. RESULTS

3.1. CD44v5 domain was highly expressed in TNBC and positively correlated with the CD163 positive cell infiltration

We performed statistical analysis using TCGA database, which showed that the mRNA levels of cd44 and CD44v5 isoform splicing factor sam68 were highly expressed in TNBC samples compared with non‐TNBC samples (Figure 1A). Then we inferred that the CD44v5 domain should be highly expressed in TNBC; our PCR and western blot results from these three breast cancer cell lines (MCF‐7, MDA‐MBA‐231, and MDA‐MBA‐468) confirmed our findings (Figure 1B,C). The immunohistochemistry results of patients' pathological tissues also proved that the CD44v5 domain was highly expressed in TNBC (Figure 1D). High expression of the M2 macrophage marker CD163 in the pathological tissues of TNBC patients compared with non‐TNBC demonstrated that the CD163⁺ cell infiltration was also significantly higher in TNBC tissues (Figure 1D).

FIGURE 1.

The CD44V5 domain was highly expressed in TNBC and positively correlated with the CD163‐positive cell infiltration. (A) Analysis of TCGA database revealed differential expression of cd44 and sam68 in different subtypes of breast cancer. (B) qPCR analysis showed differential expression of CD44v5 in TNBC and non‐TNBC. (C) Protein expression analysis revealed differential expression levels of CD44v5 in TNBC and non‐TNBC. (D) Differential expression of CD44v5, IL‐4Rα, IL‐4, and CD163 was observed in tissues from TNBC and non‐TNBC patients. Scale bars: 100 μm. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

3.2. TNBC cell lines had stronger abilities to induce TAM polarization, and their metastasis abilities were also enhanced by TAMs

In order to investigate the mechanism of the formation of the immune microenvironment in breast cancer, we investigated whether there were differences in the ability of breast cancer cell lines to induce TAM polarization. When a non‐TNBC cell line and TNBC cell lines were co‐cultured with M0 macrophages, TNBC induced a higher expression of CD163 (Figure 2A). TAMs are known to promote their metastasis ability in tumors. ²² We further verified whether TAMs could also promote the metastasis ability of breast cancer cells; this was demonstrated to be significantly promoted by TAMs in wound healing and invasion experiments (Figure 2B,C). The TAMs had a promoting effect on the metastatic ability of all breast cancer cell lines, but this effect was more enhanced in TNBC cell lines (Figure 2B,C).

FIGURE 2.

TNBC cell lines had stronger abilities to induce TAM polarization, and their metastasis abilities were also enhanced by TAMs. (A) Co‐culture of breast cancer cells and M0 macrophages showed increased expression of CD163 in TAMs. (B) Wound healing assay demonstrated that TAMs significantly enhance the migration ability of TNBC compared with non‐TNBC. (C) Transwell assay confirmed that TAMs significantly promote the invasive ability of TNBC compared with non‐TNBC. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

The above experiments revealed that TNBC could significantly promote TAM polarization, resulting in a pro‐tumor TME, we also found that TAMs significantly promoted the metastasis ability of TNBC. The above findings suggested there was positive feedback between TNBCs and TME, which together promote the development of TNBC.

3.3. CD44v5 domain is involved in TNBCs inducing TAM polarization and responding to TAMs

We have demonstrated that the CD44v5 domain is highly expressed in TNBCs compared with non‐TNBCs and that TNBCs have a stronger ability to induce TAM polarization. To investigate whether the differences between TNBC and non‐TNBC were caused by differential expression of the CD44v5 domain, we used a CD44v5 monoclonal antibody for CD44v5 domain blockade, as well as CD44v5 knockdown cell lines (Figure 3A) to co‐culture with M0 macrophages. We found that TAM polarization was inhibited when the CD44v5 domain was either blocked or knocked down (Figure 3B,C). The above results indicated that the higher expression of the CD44v5 domain in TNBC could promote the formation of a type II immune microenvironment. The different expression of the CD44v5 domain led to the differences in TME between TNBC and non‐TNBC. We also conducted research on the changes in tumor cell metastasis ability after blocking the CD44v5 domain. We found that the CD44v5 domain blocking inhibited the metastasis ability of breast cancer cells, and the inhibitory effect was especially stronger on TNBC cells (Figure 3D,E).

FIGURE 3.

The CD44v5 domain is involved in TNBCs inducing TAM polarization and responding to TAMs. (A) Establishment of stable cell lines with low expression of the CD44v5 domain. (B) Blocking the CD44v5 domain can disrupt the polarization of TAMs. (C) Co‐culture of breast cancer cells after knockdown the CD44v5 domain; M0 macrophages can inhibit the polarization of M0 macrophages. (D, E) CD44v5 antibody can significantly inhibit the metastatic ability of TNBC. (F, G) Changes in the metastatic ability of breast cancer cells after knocking down the CD44v5 domain when co‐cultured with TAMs. (H, I) Changes in the metastatic ability of breast cancer cells after blocking the domain when co‐cultured with TAMs. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

Tumor cells not only play roles in forming their own TME, but could also be affected by TME. CD44v5 domain blockage or knocking down could inhibit TAMs inducing metastasis in breast cancer cells. When comparing the inhibition rates among three cell lines, we found that the inhibition rates were higher in TNBC cells compared with that of non‐TNBC cells (Figure 3F–I). The CD44v5 domain is involved in TNBC‐induced TAM polarization and responding to TAMs.

3.4. Blocking the CD44v5 domain inhibited the IL‐4/IL4R signaling pathway and enhanced TNBC metastasis

In our previous research, we found that the CD44v5 domain regulates Th cell differentiation and promoted a type II immune response through the IL‐4/IL‐4R signaling pathway. IL‐4/IL‐4R signaling also promotes immunosuppression and angiogenesis in cancers and results in a poor prognosis. ¹³ Whether the CD44v5 domain also promotes metastasis in TNBC by regulating the IL‐4/IL‐4R signaling pathway needs further experimental proof. Our histochemical results also confirmed the high expression of IL‐4Rα along with IL‐4 in TNBC (Figure 1D). When we added exogenous IL‐4 to breast cancer cell lines, we found that the metastasis ability of TNBC was significantly enhanced (Figure 4A,B). The expression of CD44v5 and IL‐4Rα (Figure 4C) was simultaneously enhanced, which suggested that activation of the IL‐4/IL4R signaling pathway enhanced the metastasis ability of breast cancer cell lines, especially for TNBC. Moreover, the CD44v5 antibody counteracted the pro‐migratory effect of IL‐4 on breast cancer cell lines (Figure 4A,B). Similarly, IL‐4 had no metastasis effect on the CD44v5 domain knockdown breast cancer cell lines (Figure 4D). The IL‐4Rα inhibitor (Dupilumab) inhibited the metastasis ability of breast cancer cells (Figure 4E), as well as the CD44v5 antibody, which indicated that the pro‐metastatic effect of CD44v5 domain was exerted through the IL‐4/IL‐4R signaling pathway, and that blocking it could inhibit the effect. Dupilumab could also eliminate TAM‐mediated enhancement of TNBC metastasis ability (Figure 4F), which was consistent with the effect of blocking the CD44v5 domain.

FIGURE 4.

Blocking the CD44v5 domain inhibited the IL‐4/IL4R signaling pathway and enhanced TNBC metastasis. (A, B) Blocking the CD44v5 domain can inhibit the promotion of TNBC migration by IL‐4. (C) IL‐4 can promote the protein expression of CD44v5, IL‐4Rα, and phosphorylated STAT3 in TNBC. (D) The effect of IL‐4 on breast cancer migration after knocking down the CD44v5 domain. (E) The effect of IL‐4Rα inhibitor (Dupilumab) on TNBC migration. (F) The effect of IL‐4Rα inhibitor on TNBC migration when co‐cultured with TAMs. (G) Inhibition of protein expression of IL‐4Rα and phosphorylated STAT3 in breast cancer cells after blocking the CD44v5 domain. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

In addition, we also analyzed the effect of the CD44v5 domain on the metastasis ability of breast cancer cells. Our experiments demonstrated that when the CD44v5 domain was blocked or knocked down, the metastasis ability of breast cancer cells was inhibited, and the level of IL‐4Rα was also reduced (Figure 4G). We demonstrated that the CD44v5 domain affected the metastasis ability of breast cancer cells by participating in the IL‐4/IL4R signaling pathway. In conclusion, the CD44v5 domain regulates the metastasis ability of TNBC and its responsive to the TAMs through the IL‐4/IL‐4R signaling pathway.

3.5. CD44v5 domain promotes TNBC metastasis capacity by enhancing the IL‐4/IL‐4R/STAT3/IL‐6 signaling axis

Previous studies as well as our results have shown higher levels of IL‐4 expression in TNBC. The classical IL‐4/type I IL‐4R signaling pathway activates STAT6, however we found that the IL‐4R in breast cancer was predominantly type II IL‐4R. Our results showed that, compared with non‐TNBC, TNBC had higher levels of phosphorylated STAT3 (Figure 5A). STAT3 is an early tumor diagnostic marker that promotes the malignant progression of breast cancer and activates STAT3 phosphorylation, which then promotes breast cancer proliferation, drug resistance, and progression. ²³ This may also explain why TNBC has a greater metastatic ability.

FIGURE 5.

The CD44v5 domain promotes TNBC metastasis capacity by enhancing the IL‐4/IL‐4R/STAT3/IL‐6 signaling axis. (A) Protein expression levels of phosphorylated STAT3 in TNBC and non‐TNBC cells. (B) The effect of IL‐4 on IL‐6 cytokine secretion in breast cancer cells. (C) Inhibition of phosphorylated STAT3 protein expression in breast cancer cells by IL‐4Rα inhibitor. (D) IL‐4Rα inhibitor can attenuate the expression of phosphorylated STAT3 protein in breast cancer cells promoted by TAMs. (E) Blocking the CD44v5 domain can inhibit the secretion of IL‐6 cytokine. (F) After knocking down the CD44v5 domain, IL‐6 cytokine can partially reverse the migration ability of TNBC. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

We further found that, when exogenous IL‐4 was added to breast cancer cell lines, the expression of phosphorylated STAT3 (Figure 4C) and IL‐6 (Figure 5B) was simultaneously increased. IL‐6 has been found to promote breast cancer cell invasion, angiogenesis, and metastasis, thereby facilitating breast cancer progression. ²⁴ When we used Dupilumab to inhibit IL‐4Rα, the levels of phosphorylated STAT3 (Figure 5C) were suppressed. Dupilumab inhibiting TAMs induced metastasis caused by suppressing STAT3 phosphorylation (Figure 5D). The above results suggested that the IL‐4/IL‐4R enhancement of TNBC metastasis ability was achieved by regulating the STAT3/IL‐6 signaling axis. STAT3 phosphorylation was suppressed when we blocked the CD44v5 domain (Figure 4G), and the level of IL‐6 secretion was correspondingly reduced (Figure 5E). We revealed that the CD44v5 domain regulated its metastasis ability by modulating the IL‐4/IL‐4R/STAT3/IL‐6 signaling axis in TNBC.

We also performed IL‐6 recovery experiments. Tumor cell metastasis ability could be partially restored when exogenous IL‐6 was added to the CD44v5 domain knockdown cell lines (Figure 5F), but the recovery effect of TNBC cells was more significant. Therefore, we believe that the metastatic ability of breast cancer cells may not be completely regulated by IL‐6 and we suggest that the CD44v5 domain might have two potential pathways to promote the metastatic ability of breast cancer cells: first, the CD44v5 domain itself possesses adhesive protein ability; and second, the CD44v5 domain enhanced the metastatic capacity of breast cancer cells by inducing the secretion of IL‐6 cytokines.

3.6. Mechanisms of the CD44v5 domain involved in TME generation and the effect in TNBC

It was observed that TNBC cells have the ability to polarize TAMs, resulting in a pro‐tumor TME. Our previous results showed that the CD44v5 domain affects its own migratory capacity through the IL4/IL4R signaling pathway, and it has been shown that IL‐6 and CCL2 can promote M2 macrophage polarization. ²⁵ TNBC resulted from synergistic promotion of TAM polarization by secreting high levels of IL‐6 and CCL2 (Figure S1A), in addition to IL‐4, which exacerbated the poorer TME. This is the pathway through which TAMs in the TME in turn affect TNBC. The detection of cytokines in the supernatants of M0 macrophages and TAMs revealed that TAMs secreted higher levels of IL‐4, IL‐6 (Figure 6A), and CCL2 (Figure S1B). This indicated that TAMs secreted IL‐4, IL‐6, and CCL2 to promote breast cancer metastasis.

FIGURE 6.

Mechanisms of CD44v5 domain involving in TME generation and effect in TNBC. (A) Secretion levels of IL‐4 and IL‐6 in M0 macrophages and TAMs. (B, C) Expression levels of CD44v5, IL‐4Rα, phosphorylated STAT3, and IL‐6 in breast cancer cells co‐cultured with TAMs. (D) Co‐localization of the CD44v5 domain; IL‐4Rα expression in tissue samples from TNBC and non‐TNBC patients, scale bars represent 50 μm. (E) Mechanism diagram of the interaction between TNBC and TAMs. Data are representative of two independent experiments. Statistical significance was determined by comparisons with controls, *p < 0.05, **p < 0.01, ***p < 0.0001.

CD44v5, IL‐4Rα, phosphorylated STAT3and the level of IL‐6 cytokine were increased in breast cancer cells when co‐cultured with TAMs cells (Figure 6B,C); this showed that there was a positive feedback loop between breast cancer cells and TAMs. We also revealed that the CD44v5 domain co‐localized with IL‐4Rα (Figure 6D), This promoted the activation of the IL‐4/IL4R signaling pathway including STAT3 phosphorylation and enhanced the secretion of cytokines, such as IL‐4 as well as IL‐6, in breast cancer. This played a key role in the polarization of TAMs and, consequently, played an important role in the formation of TME. Collectively, the CD44v5 domain is involved in breast cancer‐induced TAM polarization and responsiveness to TAMs by enhancing the IL‐4/IL4R/STAT3/IL‐6 signaling pathway (Figure 6E).

4. DISCUSSION

Our research discovered the high expression of the CD44v5 domain in TNBC and identified its novel functions in pathological responses. We found that the elevated expression of the CD44v5 domain promoted the metastasis ability of TNBC cells and enhanced the polarization of TAMs. We found a significant increase in the expression of CD163⁺ cells in the pathological tissues of TNBC patients compared with those of non‐TNBC patients. Studies have shown that TAMs can reshape the microenvironment of tumor metastatic sites, making these more favorable for the occurrence and development of tumor cells. ²⁶ , ²⁷ Additionally, TNBC cell lines were found to secrete higher levels of CCL2 (Figure S1A), which further supported the role of tumor cells in the formation of their own immune microenvironment. This process is closely related to the cytokines released by the tumor. Cytokines accelerate tumor progression through intercellular signaling communication. ²⁸ They also serve as typical signaling pathways connecting tumor cells and immune cells, in which tumor‐derived cytokines can act on themselves through autocrine effects. ²⁹ The tumor microenvironment contains abundant cytokines that recruit circulating monocytes and promote their polarization toward TAMs, forming an immune‐suppressive microenvironment. In addition, IL‐4 promotes TAM polarization through a paracrine effect, and this process is also accompanied by the involvement of IL‐6 and CCL2. The higher expression of the CD44v5 domain in TNBC leads to stronger activation of the IL‐4/IL‐4R pathway and endows TNBC with a stronger TAM polarization ability.

In our experiments, we also observed that the basal activation of the tumor cell IL‐4/IL‐4R signaling pathway affects the tumor metastasis ability. Activation of the IL‐4/IL‐4R signaling pathway enhances the secretion of a series of cytokines, such as IL‐4, IL‐6, and CCL2. These cytokines released by tumor cells can promote tumor progression through autocrine effects and could also influence the immune microenvironment. When we added IL‐4R inhibitors or CD44v5 antibodies to inhibit the pathway, this both led to a decrease in metastasis ability, and the metastasis ability of TNBC decreased significantly. This phenomenon was further confirmed by the CD44v5 domain knocked down cell lines. The CD44v5 domain exerts its effects by influencing the IL‐4/IL‐4R signaling axis, which is a key regulator of the tumor cell‐mediated immune microenvironment. Our results indicated that tumor cells play a major role in the formation of their own immune microenvironment through the CD44v5/IL‐4R signaling pathway.

Phosphorylation of STAT3 promotes tumor metastasis; there have been reports on targeting STAT3 as a therapeutic approach for inhibiting TNBC. ³⁰ , ³¹ We found that the levels of phosphorylated STAT3 in TNBC were higher compared with non‐TNBC at the basal level. The classical downstream‐activated protein of the IL‐4/type I IL‐4R signaling pathway is STAT6 but we found that, in breast cancer, the downstream‐activated protein of this pathway was mainly STAT3. This indicated that, unlike the IL‐4R classical signaling pathway, IL‐4R mainly exerted its effects through the STAT3 signaling axis in TNBC. This was related to the expression of type II IL‐4R in tumors. We believe that the IL‐4/IL‐4R/STAT3 pathway is an important regulatory pathway for the production of inflammatory factors and the infiltration of inflammatory cells. Additionally, we observed higher levels of phosphorylated STAT3 in TNBC cell lines compared with non‐TNBC. This is also a major factor contributing to the difference in metastasis ability between TNBC and non‐TNBC.

In addition to studying how tumor cells themselves affected their metastasis ability and the immune microenvironment through autocrine signaling, we also investigated the role and mechanism of TAMs in the immune microenvironment. When co‐cultured with TAMs, we observed activation of the IL‐4/IL‐4R signaling pathway and an increase in STAT3 phosphorylation levels. However, the addition of IL‐4Rα inhibitors and CD44v5 antibody during co‐culture could inhibit STAT3 phosphorylation. Our previous research showed that the CD44v5 domain and IL‐4Rα co‐localize extracellularly, and we also observed this phenomenon in breast cancer. The CD44v5 domain plays an inhibitory role in receptor internalization by co‐localizing with IL‐4Rα, thereby enhancing the strength of this signaling pathway and exerting a promoting effect.

IL‐6 level is associated with poor survival rates in various cancers, ³² and IL‐6 promotes breast cancer metastasis, angiogenesis, and tumor escape from immune surveillance. ³³ , ³⁴ In our experiments, we also found a high expression of IL‐6 in TNBC, and the secretion of IL‐6 was significantly reduced when CD44v5 antibodies were used. Based on these results, we propose that the CD44v5 domain exerts its effects by enhancing the IL‐4/IL‐4R/STAT3/IL‐6 axis in TNBC. The activation of IL‐4/IL‐4R led to an increase in IL‐6. When we added IL‐6 to the CD44v5 domain knockdown cell lines, we found that the inhibitory effect could be reversed, especially in TNBC. The CD44v5 domain enhanced the IL‐4R pathway, leading to an increase in IL‐6 levels.

Although we obtained similar inhibitory effects on tumor metastasis when using IL‐4Rα inhibitors, the expression of the CD44v5 domain was more specific; studies have shown that it is not expressed in normal tissues but highly expressed in tumor cells. ³⁵ The CD44v5 domain may also play a role in promoting intracellular signaling transduction, which requires further investigation.

Our research aimed to find new treatment strategies for TNBC patients. We primarily sought to inhibit tumor metastasis and also modulate TME. In this study, we investigated the TAMs of TNBCs and identified the intrinsic connection between the CD44v5 domain and TNBC. We found that TNBCs promoted their metastasis ability and the formation of a type II immune microenvironment through the CD44v5/IL‐4R/STAT3/IL‐6 signaling axis. TNBC has a lower survival rate, worse prognosis, and higher recurrence rate compared with non‐TNBC, and we could regulate these effects by targeting the CD44v5 domain. Our research showed a better understanding of the mechanisms and regulatory targets involved in the formation of the immune microenvironment in TNBC. This will provide new strategies for improving the treatment of TNBC.

AUTHOR CONTRIBUTIONS

Yanhua Dai: Data curation; formal analysis; methodology; writing – original draft. Zhongjian Ji: Formal analysis; methodology. Hongyan Liang: Data curation; formal analysis. Meng Jiang: Data curation; formal analysis; methodology. Lan Wang: Data curation; formal analysis. Xinyi Bao: Data curation; formal analysis. Jiaren Liu: Supervision; writing – review and editing. Ming Liu: Supervision; writing – review and editing. Chun Yang: Supervision; writing – original draft; writing – review and editing.

CONFLICT OF INTEREST STATEMENT

The authors declare no competing interests.

ETHICS STATEMENTS

Approval of the research protocol by an Institutional Reviewer Board: This study was approved by the Scientific and Ethical Committee of the 4th Hospital of Harbin Medical University.

Informed Consent: All tissues were obtained with informed consent compliance with the Ethical Committee of the 4th Hospital of Harbin Medical University. All patients provided written informed consent prior to study entry.

Registry and the Registration No. of the study/trial: N/A.

Animal Studies: N/A.

Supporting information

Figure S1.

Dai Y, Ji Z, Liang H, et al. CD44v5 domain regulates crosstalk between TNBC cells and tumor‐associated macrophages by enhancing the IL‐4R/STAT3 axis. Cancer Sci. 2024;115:2235‐2253. doi: 10.1111/cas.16200