Myeloid cell-derived interleukin-6 induces vascular dysfunction and vascular and systemic inflammation

Abstract

Aims

The cytokine interleukin-6 (IL-6) plays a central role in the inflammation cascade as well as cardiovascular disease progression. Since myeloid cells are a primary source of IL-6 formation, we aimed to generate a mouse model to study the role of myeloid cell-derived IL-6 in vascular disease.

Methods and results

Interleukin-6-overexpressing (IL-6^OE) mice were generated and crossed with LysM-Cre mice, to generate mice (LysM-IL-6^OE mice) overexpressing the cytokine in myeloid cells. Eight- to 12-week-old LysM-IL-6^OE mice spontaneously developed inflammatory colitis and significantly impaired endothelium-dependent aortic relaxation, increased aortic reactive oxygen species (ROS) formation, and vascular dysfunction in resistance vessels. The latter phenotype was associated with decreased survival. Vascular dysfunction was accompanied by a significant accumulation of neutrophils, monocytes, and macrophages in the aorta, increased myeloid cell reactivity (elevated ROS production), and vascular fibrosis associated with phenotypic changes in vascular smooth muscle cells. In addition to elevated Mcp1 and Cxcl1 mRNA levels, aortae from LysM-IL-6^OE mice expressed higher levels of inducible NO synthase and endothelin-1, thus partially accounting for vascular dysfunction, whereas systemic blood pressure alterations were not observed. Bone marrow (BM) transplantation experiments revealed that vascular dysfunction and ROS formation were driven by BM cell-derived IL-6 in a dose-dependent manner.

Conclusion

Mice with conditional overexpression of IL-6 in myeloid cells show systemic and vascular inflammation as well as endothelial dysfunction. A decrease in circulating IL-6 levels by replacing IL-6-producing myeloid cells in the BM improved vascular dysfunction in this model, underpinning the relevant role of IL-6 in vascular disease.

Graphical Abstract

Graphical Abstract.

Myeloid cell-derived interleukin-6 (IL-6) overexpression was associated with systemic inflammation. Chronic myeloid cell-derived IL-6 evoked a significantly impaired endothelium-dependent aortic relaxation, increased aortic reactive oxygen species (ROS), and vascular dysfunction in resistance vessels. Vascular dysfunction was accompanied by a significant accumulation of myeloid cells in the aortic wall, an increased reactivity of myeloid cells, vascular fibrosis, and an altered vascular smooth muscle cell phenotype. This went in line with significantly elevated Mcp1, Cxcl1, and Rorc levels and an increased inducible NO synthase and endothelin-1 expression in LysM-IL-6^OE aortas. Bone marrow (BM) transplantation studies revealed that vascular dysfunction and ROS formation were driven by BM cell-derived IL-6 in a dose-dependent manner.

Introduction

Cardiovascular disease (CVD) remains the leading cause of death worldwide. Vascular inflammation plays a crucial role in the development of CVD. Among the different mediators of the immune system, the cytokine interleukin-6 (IL-6) is of central relevance and has been repeatedly implicated in the pathogenesis of CVD. Interleukin-6 is a predictor of long-term cardiovascular mortality in patients with acute coronary syndrome,^1,2 involved in heart failure,³ and has been suggested to predict the onset of coronary artery disease (CAD).⁴ It was described to be independently associated with the risk of major adverse cardiovascular events, cardiovascular and all-cause mortality, myocardial infarction, and heart failure in patients with stable coronary heart disease.⁵ Within the inflammation cascade, IL-6 has pivotal functions at the crossroads of the innate and adaptive immune responses. It is mainly produced by myeloid cells, stimulates the differentiation of pathogenic Th17 cells, and leads to activation and recruitment of neutrophil granulocytes, causing an amplification of the inflammatory response.^6–11 Moreover, IL-6 plays a driving role in various autoimmune diseases such as psoriasis,¹² rheumatoid arthritis,¹³ systemic lupus erythematosus,¹⁴ and autoimmune colitis,¹⁵ all of which have been shown to be associated with an increased cardiovascular risk.^16–19 Thus, IL-6 represents a potential mediator driving increased cardiovascular comorbidities in patients with these chronic inflammatory disease states.²⁰ Interleukin-6 deficiency was described to attenuate angiotensin II (AngII)-induced vascular dysfunction in mice.²¹ Nevertheless, the mechanisms and interactions of IL-6 in CVD are incompletely understood.²² As myeloid cells are one of the relevant physiological sources of IL-6,²³ we generated mice with chronic myeloid IL-6 overexpression and analysed their vascular phenotype in order to determine the role of myeloid cell-derived IL-6 for systemic and vascular inflammation.

Methods

Mice

Interleukin-6-overexpressing mice were generated by gene targeting of embryonic stem (ES) cells. In brief, we have constructed a targeting vector by inserting the cDNA coding for IL-6 followed by an internal ribosome entry site and the cDNA coding for enhanced green fluorescent protein (eGFP) (as shown in Figure 1A). The conditional ‘knock-in’ approach targeted the endogenous gt(ROSA)26Sor locus, introducing a lox-P-flanked transcriptional STOP cassette (Figure 1A). Following homologous recombination into C57BL/6-V6.5 ES cells, we generated the IL-6^OE mice by injection of ES cells into blastocysts. This new mouse strain established on the C57BL/6J background allows cell-specific overexpression of IL-6 combined with eGFP expression (IL-6^OE mouse strain) upon Cre-mediated control. By crossing homozygous IL-6^OE/OE female mice with LysMCre⁺ male mice,²⁴ we obtained LysM-IL-6^OE mice with heterozygous expression of LysMCre and heterozygous overexpression of IL-6 in LysM⁺ cells. Control mice were LysMCre negative and heterozygous for the IL-6^OE allele (IL-6^OE mice). At the age of 8–12 weeks, mice were used for experiments. Both female and male mice were examined, and the results were pooled as no sex-specific effect was observed.

Figure 1.

Mice overexpressing interleukin-6 in myeloid cells have an increase in the splenic myeloid cell compartment and a reduced life expectancy. (A) Generation of the IL-6^OE allele involved homologous recombination in embryonic stem cells (V6.5). The conditional ‘knock-in’ approach targeted the endogenous gt(ROSA)26Sor locus, introducing a lox-P-flanked transcriptional STOP cassette. Upon Cre-mediated recombination, the cassette was excised, enabling dual expression of interleukin-6 and enhanced green fluorescent protein under the control of the chicken β-actin (CAG) promotor. (B) Flow cytometric analysis of splenocytes from LysM-IL-6^OE and control mice. Cells were stained for CD11b, B220, and CD90.2 with gating based on green fluorescent protein signal. Representative plots of n = 4 mice are shown. (C) Interleukin-6 levels in splenocytes and plasma. Left panel: interleukin-6 level in sorted and cultured CD11b⁺ splenocytes of LysM-IL-6^OE mice and control mice. Splenocytes were cultured for 24 h. n = 3–4, Mann–Whitney test. Right panel: interleukin-6 plasma levels in 10-week-old LysM-IL-6^OE compared with control mice (n.d. = not detectable). n = 19–28, Mann–Whitney test. P < 0.0001. (D) Statistical analysis of the total living cells per spleen of LysM-IL-6^OE and control mice is shown (result of flow cytometric analysis), n = 13–23, Mann–Whitney test. P < 0.0001. (E) Flow cytometric analysis of LysM-IL-6^OE and control mice splenocyte subpopulations: after gating out B220⁺ and CD90.2⁺ cells, analysis focused on CD11b, F4/80, Ly6C, and Ly6G. Representative plots of n = 8–15 mice are shown. (F) Statistical analysis of the splenic CD11b⁺ myeloid cells, the Ly6G ⁺ Ly6C⁺ neutrophils, and the Ly6G⁻Ly6C⁺ monocytes/macrophages of LysM-IL-6^OE and control mice of the flow cytometric experiment above, n = 8–15 mice. Top row: total cells. Bottom row: percentage values of the total living cells, unpaired Student’s t-test. P < 0.0001. (G) Kaplan–Meier survival curve of LysM-IL-6^OE vs. control mice, n = 8–16 mice, log-rank (Mantel–Cox) test. (H) Representative image of colon endoscopy (left). Statistical analysis of endoscopy score (right), n = 4, Mann–Whitney test. Bottom part: representative haematoxylin and eosin stainings of the colon of LysM-IL-6^OE and control mice. Data are presented as mean ± SEM, and P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Mice were euthanized by exsanguination under deep isoflurane anaesthesia (5% inhalant in room air) combined with tamasic (buprenorphine) as a single subcutaneous injection (0.075 mg/kg body weight) 30 min before the procedure to avoid any pain. Then, blood was collected by right ventricular puncture. Afterwards, organs, namely aorta, spleen, bone marrow (BM), heart, brain, colon, lungs, and kidneys, were harvested.

Housing, treatment, and euthanasia of animals were performed in accordance with the relevant laws and institutional guidelines of the Central Animal Facility of the UMC Mainz, Germany, and state authorities (G15-1-051, G15-1-101, G21-1-025, and G21-1-030). Experimental procedures including anaesthetic and analgesic treatments followed the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. Experiments were conducted according to the ARRIVE guidelines.

Vascular relaxation studies

Murine aortas were isolated and cut into 4 mm long segments, and the thoracic part of the aortas was utilized for aortic constriction and dilatation assays. They were mounted in organ chambers to measure endothelium or smooth muscle-dependent relaxation or contraction in response to acetylcholine (ACh), glyceryl trinitrate, potassium chloride (KCl), and prostaglandin F2α (PGF2α) as described previously.²⁵

The ROS scavengers catalase (2000U/mL), superoxide dismutase (SOD) (2000U/mL), or the endothelin-1 (ET-1) antagonist bosentan (10 µM) were suspended in full medium (MV2 kit, PromoCell), and the isolated aorta segments were incubated in it for 90 min at 37°C and 5% CO₂. Afterwards, relaxation studies were performed.

Besides the aortic analysis, the first and second branches of mesenteric arteries were isolated, cut into 2 mm long segments, and mounted in a myograph to measure relaxation in response to ACh or sodium nitroprusside or contraction in response to phenylephrine or KCl as described previously.^26,27

Echocardiography

Mouse echocardiography was performed using a VEVO-3100 ultrasound machine (FUJIFILM VisualSonics Inc., Toronto, Canada) equipped with a 38 MHz (MX400) linear array transducer. Standardized images in parasternal long axis (PLAX) and parasternal short axis as well as apical four-chamber view were recorded under isoflurane sedation with 1.5–2 vol%. In parallel, electrocardiogram and respiration rate were monitored and body temperature was kept stable using a heating system within the handling platform. Post-acquisition analysis was performed with the Vevo LAB software (VisualSonics, FujiFilm, Toronto, Canada) for left ventricular (LV) ejection fraction (PLAX B-mode), LV mass, stroke volume, and cardiac output (PLAX M-mode) and right heart function with right ventricular end-diastolic (mid-ventricular diameter) (4C and SAX) and pulmonary artery velocity time integral (SAX).

Blood pressure measurement

Systolic blood pressure was measured using a tail–cuff non-invasive blood pressure system as previously described.^28,29

Analysis of reactive oxygen and nitrogen species in the blood and aortic tissue

Reactive oxygen species (ROS)/reactive nitrogen species (RNS) were measured in whole blood by L012-enhanced chemiluminescence after incubation with phorbol 12,13-dibutyrate (PDBu) (10 μmol/L) for 20 min:^30–32 200 IU of heparine was injected into the beating heart of the mouse and venous blood drawn from the right ventricle subsequently. Chemiluminescence was measured directly in the heparinized blood which was kept at room temperature (RT). L012-enhanced chemiluminescence signals were counted in 10 μL of samples with 100 μmol/L of L012 in the presence of PDBu using a Lumat LB 9507 from Berthold Technologies (Bad Wildbad, Germany). Chemiluminescence was expressed as counts per minute after incubation for 10 min.

Visualization of ROS in aortic cryosections was performed by staining with the superoxide-sensitive dye dihydroethidium (DHE, 1 µM) as previously described.³² Mouse aortas were rinsed, cleaned, and then cut into 4 mm sections which were then incubated in Krebs–Henseleit solution (containing 0.1 mg/mL of aprotinin, 0.2 mg/mL of pepstatin, and 0.5 mg/mL of leupeptin) for 10 min at 37°C. Then, the aortic sections were embedded in Tissue-Tek and frozen in liquid nitrogen. 8 µm aortic cryosections were cut and stained with DHE (incubation over 30 min at 37°C). Green autofluorescence from aortic lamina and red ethidium fluorescence inside the ROS-producing cells were detected by fluorescence light microscopy using a Zeiss Axiovert 40 CFL microscope, Zeiss lenses and Axiocam MRm camera (Zeiss, Oberkochen, Germany) and analysed with the AxioVision data acquisition software (Zeiss).

In vivo high-resolution endoscopic analysis of the colon

A high-resolution video endoscopic system (Karl Storz SE & Co AG, Tuttlingen, Germany) was used for the analysis of the colitis-like phenotype. Colitis scores were determined on mice anaesthetized with a mixture of ketamine (Ketavest 100 mg/mL; Pfizer, New York, NY) and xylazine (Rompun 2%; Bayer Healthcare, Leverkusen, Germany) intraperitoneally. Endoscopic scoring of five parameters, namely translucency, granularity, fibrin, vascularity, and stool, was performed as previously described.³³

Bone marrow transfer

Recipient C57BL/6 Ly5.1 mice were irradiated with 9.5 Gy from Cs137 (OB58-BA; Buchler, Braunschweig, Germany). Mice were treated orally with Borgal antibiotic 2 weeks prior and 1 week after irradiation. Bone marrow cells were isolated from femurs and tibias of LysM-IL-6^OE or control mice, and 5*10⁶ BM cells were transplanted into recipient mice by injection into the tail vein. Different relative amounts of LysM-IL-6^OE BM (100% of control BM, 100% of LysM-IL-6^OE BM, 50% LysM-IL-6^OE BM, or 10% LysM-IL-6^OE BM) were transferred. Mice were analysed 10 weeks after BM transplantation.

Flow cytometric analysis

First, aortic and splenic single-cell solutions were incubated with anti-CD16/anti-CD32 antibodies to prevent unspecific antibody bindings. Then, cells were stained with fluorophore-coupled monoclonal antibodies for CD11b, F4/80, Ly6G, Ly6C, B220, or CD90.2, together with a viability dye. Cells were acquired using either the FACSCanto™ II cytometer (BD, USA) or Attune™ NxT (Thermo Fisher).

Flow cytometric reactive oxygen species analysis

For flow cytometric ROS analysis, whole blood was drawn by cardiac puncture and anticoagulated with ethylenediaminetetraacetic acid. Cells were treated with and without PDBu for 15 min at RT followed by incubation with CellROX® reagent (a fluorogenic indicator for the detection of ROS in cells, which is non-fluorescent but shows a strong fluorescence when oxidized; 5 μM, Thermo Fisher Scientific) for 30 min at 37°C, as previously described.³⁴ Cells incubated in the absence of CellROX® reagent were used as a negative control. Afterwards, cells were stained [CD45—brilliant violet 510 (Clone: 30-F11), CD90.2—phycoerythrin (PE) (Clone: 53-2.1), CD11b—phycoerythrin–cyanine 7 (PE-Cy7) (Clone: M1/70), Ly6G—Super Bright 600 (Clone: 1A8), Ly6C—peridinin chlorophyll protein–Cy5.5 (Clone: KH1.4), and viability dye eFlour 708] and incubated for 20 min at RT. After dilution (final concentration 1:2000), cells were analysed using the Invitrogen™ Attune™ NxT flow cytometer (Thermo Fisher Scientific, Waltham, MA, USA) and the Invitrogen™ Attune™ No-Wash No-Lyse Filter Kit (Thermo Fisher Scientific, Waltham, MA, USA).

Cytokine and chemokine quantification

Plasma IL-6 levels were measured with BD OptEIA™ mouse ELISA kit. Absorption was measured using the infinite M200 PRO NanoQuant plate reader (Tecan, Austria) or with the Bioplex Multiplex Immunoassay System ( BioRad, Germany), according to the manufacturer’s protocol.

Cell culture

Human pulmonary artery endothelial cells (HPAECs, ATCC) were cultivated, as previously published.³⁵ Cells were stimulated with 50 or 500 pg/mL of IL-6 (PeproTech, UK) with soluble IL-6 receptor (sIL-6R, PeproTech, UK).

Isolation and cultivation of vascular smooth muscle cells

Vascular smooth muscle cells were isolated from the aortas of LysM-IL-6^OE mice and cultured as previously described³⁶ In brief, aortas were carefully dissected and perfused with 1 × Phosphate buffered Saline (Gibco) to remove any blood. The aorta was kept in Dulbecco’s modified Eagle medium (DMEM; GlutaMAX-I; Gibco) with 10% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco). After removing the perivascular fat under the microscope, aortas were cut into small pieces and digested in medium containing collagenase II (10 mg/mL) for 3 h in a thermo-shaker. Then, the medium was removed by centrifugation (400 g for 10 min), and cells were resuspended in DMEM containing 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin on 0.1% gelatin-coated six-well plates. Cells were analysed at passage 0.

Histology

At the time of sacrifice, aorta, spleen, BM, heart, brain, colon, lungs, and kidneys were isolated from the experimental mice, fixed in 4% paraformaldehyde, paraffin-embedded, cut, and stained with haematoxylin and eosin according to standard protocols.³⁷ Aortic sections were stained for collagen fibres using Sirius Red and analysed by polarized light microscopy.

Immunohistochemistry

Aortic segments were fixed in 4% paraformaldehyde, paraffin-embedded, and stained with the primary antibody (anti-ET-1, 1:500, Meridian Life Science, USA) followed by incubation with the biotinylated secondary antibody after dilution. For immunochemical detection, ABC reagent (Vector) and then DAB reagent (peroxidase substrate Kit, Vector) as substrates were applied.³⁸

Immunocytochemistry

Vascular smooth muscle cells were fixed in 4% paraformaldehyde for 15 min at RT and stained with antibodies against smooth muscle alpha-actin (SMA; dilution 1:100; Sigma, A2547) and Ki67 (dilution 1:100, Abcam, ab15580). Phalloidin–rhodamine (dilution 1:300; Life Technology, R415) was used to visualize the cytoskeleton and 4′,6-Diamidin-2-phenylindol (DAPI) to visualize cell nuclei.

RNA isolation and quantitative real-time PCR

Aortas and cells were lysed and homogenized in TRIzol® (Thermo Fisher) and processed following the manufacturer’s instructions. RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher). The TaqMan® Gene Expression Assay (Applied Biosystems™) was used with 0.5 μg of total RNA for quantitative real-time PCR for Tatabox-binding protein (Tbp) (Mm01277042_m1), Mcp1 (Mm00441242_m1), Vcam1 (Mm00449197_m1), Cxcl1 (Mm04207460_m1), Cxcl2 (Mm00436450_m1), Tnf Mm00443260_g1), Il6 (Mm99999064_m1), Rorc (Mm01261022_m1), ET-1 (Mm00438656_m1), Il1beta (Mm00434228_m1), Stat3 (Mm01219775_m1), Vegf-a (Mm01281449_m1), Nox2 (Mm00432775_m1), Col1α1 (Mm00801666_g1), Col1α2 (Mm00483888_m1), MMP2 (Mm00439498_m1), and MMP9 (Mm00442991_m1). For human material the following Primers were used: Tbp (Hs00427620_m1), Il6 (Hs00174131_m1), Et-1 (Hs00174961_m1). Besides, the following primers were used: glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (forward: TAC CCC CAA TGT GTC CTG CTG G; reverse: CCT TCA GTG GGC CCT CAG ATG C); Col3α1 (forward: GAG GGC CAT AGC TGA ACT GA; reverse: TGA CTG TCC CAC GTA AGC AC), Vimentin (forward: CGG AAA GTG GAA TCC TTG CA; reverse: CAC ATC GAT CTG GAC ATG CTG T), and αSma (forward: GGACGTACAACTGGTATTGTGC; reverse: CGGCAGTAGTCACGAAGGAAT).

Quantification of mRNA expression as relative expression levels of the respective samples to Tbp or Gapdh as endogenous control (housekeeping genes) was calculated with the delta–delta threshold cycle method.³⁹

Western blot analysis

Isolated aortic tissue was homogenized, and protein was isolated using Radio-Immunoprecipitation assay buffer (Sigma-Aldrich) containing a protease/phosphatase inhibitor cocktail (Thermo Scientific). Aortic lysates were electrophorized on a 7–12% gradient gel. Proteins were transferred on a polyvinylidene difluoride membrane (pore size 0.45 μm). Immunoblotting was performed with the following primary antibodies: inducible NO synthase (iNOS) (BD Bioscience), ET-1 (Abcam), and alpha-/beta-actinin (Cell Signaling Technologies). For detection with automated imaging equipment (FUSION CCD Imager), either anti-mouse or anti-rabbit (Cell Signaling Technologies) secondary antibodies coupled to horseradish peroxidase in combination with ECL Western Blotting Substrate (Thermo Scientific) were used. Final quantification was performed by densitometric analysis (GelPro-analyzer).

Statistical analysis

Data are displayed as mean ± SEM. Statistical calculation was done with GraphPad Prism software (version 9; GraphPad Software Inc.). Kolmogorov–Smirnov test was used for analysis of normal distribution. In the case of normal distribution, we performed the unpaired Student’s t-test to compare two experimental groups and the one-way analysis of variance (ANOVA) test with Tukey’s post hoc test for comparison of more than two groups. If non-normal distribution was given, Mann–Whitney test was applied for comparison of two groups and Kruskal–Wallis with Dunn’s multiple comparison test to compare more than two groups as indicated in the figure legends. Comparison of aortic relaxation curves and survival curves was made using a two-way ANOVA with Bonferroni’s post hoc test and log-rank (Mantel–Cox) test, respectively. P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Results

Myeloid cell-derived interleukin-6 evokes a chronic systemic inflammatory state with an expansion of the myeloid cell compartment paralleled by vascular dysfunction in mice

To understand the function of IL-6 in vascular disease, we generated mice with conditional IL-6 overexpression (IL-6^OE/OE mouse strain). Crossing the IL-6^OE/OE mouse strain with LysM-Cre⁺ mice²⁴ resulted in mice in which myeloid cells overexpress IL-6 and eGFP (LysM-IL-6^OE mice, Figure 1A). We confirmed this by flow cytometry of splenocytes (Figure 1B) and IL-6 ELISA of the supernatants of isolated and in vitro cultured CD11b⁺ cells (Figure 1C, left). Myeloid IL-6 overexpression resulted in significantly elevated circulating IL-6 plasma levels compared with non-detectable concentrations in littermate controls (Figure 1C, right). Of note, the IL-6 levels in these mice were considerably lower than those reported during acute sepsis.⁴⁰

The increase in systemic IL-6 was accompanied by an increase in splenic total cell numbers shown by flow cytometric analysis in the LysM-IL-6^OE mice (Figure 1D). We found an expansion of splenic CD11b⁺ myeloid cells, CD11b ⁺ Ly6G ⁺ Ly6C⁺ neutrophil granulocytes, and CD11b ⁺ Ly6G⁻Ly6C⁺ monocytes/macrophages (shown as total cell counts and the percentage of viable splenic cells, Figure 1E and F; gating strategy is shown in Supplementary material online, Figure S1A).

The CD11b⁺ myeloid cells and the CD11b ⁺ Ly6G ⁺ Ly6C⁺ neutrophil granulocytes were also increased in the blood, whereas the number of systemic CD11b ⁺ Ly6G⁻Ly6C⁺ monocytes/macrophages was not altered (see Supplementary material online, Figure S1B and C). There was no change in blood CD90.2⁺ T cells detectable in the LysM-IL-6^OE mice compared with controls (see Supplementary material online, Figure S1D). The total number of splenic T cells was not altered either, but a reduction in the percentage of splenic T cells of total living cells was apparent (see Supplementary material online, Figure S1E).

Chronic elevations of circulating IL-6 levels were associated with an increased mortality in mice. Starting premature death at 9 weeks, only 12.5% of LysM-IL-6^OE mice reached 15 weeks of age (Figure 1G). To better understand the reduced lifespan in the LysM-IL-6^OE mice, we cautiously monitored the mice and performed detailed (histological) analysis of 11–12-week-old LysM-IL-6^OE mice compared with control mice (Figure 1H and Supplementary material online, Figure S2). It was apparent that the LysM-IL-6^OE mice were prone to the development of intestinal prolapses. This was accompanied by a colitis-like phenotype shown by histological analysis and endoscopy (Figure 1H). Additionally, LysM-IL-6^OE mice revealed inflammatory changes in the lungs, liver, spleen, and kidney (see Supplementary material online, Figure S2A–D), all of which—in particular the pulmonary inflammation—could contribute to premature death. The brain was apparently histologically not affected (see Supplementary material online, Figure S2E). There were no macro- or microscopic signs of thrombosis or bleeding in all analysed organs (see Supplementary material online, Figure S2). In summary, LysM-IL-6^OE mice developed signs of systemic inflammation with an IL-6-driven colitis-like phenotype.

We then focused on the analysis of the vascular system. Maximal constriction of aortic rings from LysM-IL-6^OE mice to PGF2α was greater than that of control mice, whereas responses to KCl did not differ between genotypes (Figure 2A). Vessels from LysM-IL-6^OE mice also demonstrated endothelial dysfunction evidenced by an impaired ACh-induced relaxation (Figure 2A). On the other hand, endothelium-independent vascular relaxation was comparable in segments from wild-type (WT) and LysM-IL-6^OE mice, as was blood pressure (see Supplementary material online, Figure S3A and B). In mesenteric arteries, contractile responses to KCl were also unaffected by the overexpression of IL-6 in myeloid cells (Figure 2B). Additionally, ACh-induced relaxation was abrogated in mesenteric arteries from LysM-IL-6^OE mice (Figure 2B). This indicated a clear link between a myeloid cell-derived cytokine and severe endothelial dysfunction that was independent of any change in VSMC reactivity or blood pressure (see Supplementary material online, Figure S3C). Endothelial dysfunction is linked to increased ROS production,⁴¹ and ROS/RNS levels were significantly increased in blood from LysM-IL-6^OE mice (Figure 2C). Furthermore, the CD11b⁺ myeloid cells demonstrated an increased ROS production following PDBu stimulation by trend, underpinning their increased reactivity (Figure 2D). We detected no differences in the heart size or function in the LysM-IL-6^OE mice compared with controls. There were no structural or functional differences in the heart, as assessed by histology and echocardiography (see Supplementary material online, Figure S4).

Figure 2.

Interleukin-6 overexpression in myeloid cells evokes significant vascular dysfunction, increased oxidative stress formation, and an increased reactivity of myeloid cells. (A) Aortic constriction studies. Left panel: aortic constriction in response to prostaglandin F2α and potassium chloride, analysed by unpaired Student’s t-test. Middle panel: isometric tension studies of LysM-IL-6^OE and control aortas in response to acetylcholine, analysed by two-way ANOVA with Bonferroni’s multiple comparisons. Right panel: statistical analysis of acetylcholine -induced maximal relaxation with unpaired Student’s t-test. n = 5–11 mice. P = 0.0499 (prostaglandin F2α), P = 0.0002 (maximal relaxation acetylcholine). (B) Mesenteric artery contraction and relaxation. Left panel: contraction of mesenteric arteries in response to potassium chloride in LysM-IL-6^OE and control mice, analysed by unpaired Student’s t-test. Right panel: relaxation to acetylcholine of mesenteric arteries that have been precontracted with phenylephrine, Mann–Whitney test, n = 8. P < 0.0001 (maximal relaxation acetylcholine). (C) Reactive oxygen species/reactive nitrogen species levels in whole blood after 20 min stimulation with phorbol 12,13-dibutyrate in LysM-IL-6^OE vs. controls, n = 6–8, unpaired Student’s t-test. P = 0.003. (D) Flow cytometric analysis of reactive oxygen species levels detected by CellRox Deep Red staining in CD11b⁺ myeloid cells in blood of LysM-IL-6^OE mice compared with controls with and without phorbol 12,13-dibutyrate stimulation. Pre-gating on living and CD45.2⁺ cells. Kruskal–Wallis test with Dunn’s multiple comparison test. Quantification left panel: representative flow cytometry histograms; right panel. n = 7–8 mice. P = 0.0045 (control vs. LysM-IL-6^OE + phorbol 12,13-dibutyrate), P = 0.0035 (LysM-IL-6^OE vs. LysM-IL-6^OE + phorbol 12,13-dibutyrate). Data are presented as mean ± SEM, and P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Taken together, these data demonstrate that the chronic systemic inflammatory state evoked by chronic myeloid IL-6 overexpression is associated with vascular dysfunction without significant cardiac alterations.

Interleukin-6-induced vascular dysfunction is associated with vascular inflammation, increased reactive oxygen species formation and endothelin-1 expression, vascular smooth muscle cell phenotype alterations, and fibrosis in the vasculature

Flow cytometric analysis of CD11b⁺ cells in aorta showed that vascular dysfunction in LysM-IL-6^OE mice was accompanied by an increase in Ly6G⁺ Ly6C⁺ neutrophils and by Ly6G⁻ Lys6C⁺ monocytes/macrophages, but neither CX3CR1⁺ nor the CD115⁺ CD11b⁺ monocytes/macrophages, in the aortic vessel wall (Figure 3A and Supplementary material online, Figure S5A (gating strategy) and B). Total aortic CD11b⁺ cell numbers were not increased, but we noted a shift towards the Ly6G⁺ Ly6C⁺ neutrophils within this population (Figure 3A). The quantity of CD90.2⁺ T cells was increased in LysM-IL6^OE aortas, whereas no significant change in aortic CD4⁺ or CD8⁺ T cells was observed (see Supplementary material online, Figure S5C and D). In parallel to the described inflammation in the aortic vessel wall, increased ROS formation in the aortic vasculature was apparent (Figure 3B). In line, Mcp1, VCAM1, Cxcl1, Tnf, Nox2, Il6, STAT3, Rorc, iNOS, and VEGFa mRNA expression in the aortic vessel wall of LysM-IL-6OE mice was significantly increased (Figure 3C). Next to the increased protein expression of the inducible NO synthase (iNOS) in the LysM-IL-6^OE aortas contributing to increased vascular ROS formation (Figure 3D), ET-1, a potent vasoconstrictor and mediator of vascular dysfunction,⁴² was elevated in protein expression (Figure 3D) and histological analysis (Figure 3E). Stimulation of HPAECs with IL-6 and sIL-6R resulted in a significantly increased ET-1 expression (Figure 3F), suggesting that IL-6 directly triggers ET-1 expression in endothelial cells. This observation, in combination with the reported capacity of ET-1 to drive IL-6 expression in endothelial cells,⁴³ may trigger a vascular dysfunction vicious circle. Of note, IL-6 synthesis in pulmonary endothelial cells isolated from LysM-IL-6^OE mice was increased compared with controls (see Supplementary material online, Figure S6A). Expression of the IL-6 receptor IL-6R was increased in the aortic tissue of LysM-IL6^OE mice, further suggesting that IL-6 directly acts on the vessel wall in our experimental mice (see Supplementary material online, Figure S6B).

Figure 3.

Interleukin-6-induced vascular dysfunction is based on vascular inflammation combined with an increased endothelin-1 and inducible NO synthase expression. (A) Myeloid cell infiltration in aortas. Representative flow cytometry plots and statistical analysis of myeloid surface staining of aortas from LysM-IL-6^OE mice compared with controls and quantification of aortic myeloid cell staining. Pre-gating on living, CD45.2⁺, and CD11b⁺ cells. Neutrophils and monocytes were further gated on Ly6G and Ly6C, n = 9–15 mice, either unpaired Student’s t-test or Mann–Whitney test. P = 0.001 (CD11b⁺ Ly6G⁺) and P = 0.0101 (CD11b⁺ Ly6G⁺). (B) Vascular superoxide formation oxidative fluorescence microtopography of aortic sections. Left: representative image of aortic sections showing lamina autofluorescence (green) and reactive oxygen species formation (red), scale bar = 50 µm. Right: densitometric analysis of vascular superoxide, normalized to control mice per experimental day. n = 6, unpaired Student’s t-test. P = 0.0275. (C) Mcp1 (P < 0.001), Vcam1 (P = 0.01), Cxcl1 (P = 0.0), Cxcl2 (ns), Tnf (P  =  0.009), Nox2 (P = 0.005), Il6 (P  =  0.01), Il1β (ns), Stat3 (P = 0.002), Rorc (P = 0.02), iNOS (P = 0.005), and Vegf-a (P = 0.005) expression in the aorta of LysM-IL-6^OE normalized to control mice. Housekeeping gene: Tbp. n = 5–19, Mann–Whitney test or unpaired Student’s t-test. (D) Representative Western blot and statistical analyses for inducible NO synthase and endothelin-1 normalized to β-actin, n = 6–10, unpaired Student’s t-test. P = 0.0167 (inducible NO synthase) and P = 0.0071 (endothelin-1). (E) Immunohistochemical analysis of endothelin-1 in aortic sections. Left: representative images of endothelin-1 staining of aortic sections with positive and negative controls, scale bar = 50 µm. Right: quantification of the percentage of endothelin-1-positive area. The fatty tissue was excluded. n = 5–4, Mann–Whitney test. P = 0.02. (F) Endothelin-1 expression of human pulmonary arterial endothelial cell co-cultured with IL-6 and sIL-6R for 4 h (quantitative real-time PCR). n = 7, one-way ANOVA test. P = 0.045 (human pulmonary arterial endothelial cell vs. human pulmonary arterial endothelial cell co-cultured with IL-6 and sIL-6R 500pg) and P = 0.0102 (human pulmonary arterial endothelial cell co-cultured with interleukin-6 and sIL-6R 50pg vs. 500pg). Data are presented as mean ± SEM, and P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Focusing on the role of ROS in this context, we applied the ROS scavengers SOD and catalase, respectively, over 90 min in the organ bath (see Supplementary material online, Figure S7) and found no relevant improving effect. Additionally, application of the ET-1 antagonist bosentan displayed no effect (see Supplementary material online, Figure S7). This indicated that both ROS and ET-1 do not function as acute drivers of vascular dysfunction in this mouse model, but rather contribute to the chronic effects of myeloid cell-derived IL-6 on the vasculature.

In regard to the complex long-term vascular effects evoked by myeloid cell-derived IL-6 overexpression on the vasculature, we found that the amount of interstitial collagen thickness in the vascular wall of LysM-IL-6^OE mice was moderately increased, whilst the aortic wall thickness remained unchanged (Figure 4A). This is in line with the concept that vascular inflammation promotes vascular fibrosis.⁴⁴ To investigate the mechanistic underpinnings, we examined cultured VSMCs isolated from LysM-IL-6^OE and control mice by immunocytochemistry (Figure 4B): here, no significant differences in proliferation (measured via Ki67) were apparent, although the presence of 10% serum in the medium may have masked minor changes. Expression of the mechanical stress marker F-actin did not differ between the VSMCs isolated from LysM-IL-6^OE and control mice. However, there was a trend in SMA to be less expressed in LysM-IL-6^OE VSMCs compared with controls (Figure 4B). This was corroborated in aortic tissue, where we found significantly less SMA mRNA expression in the LysM-IL-6^OE compared with control mice (Figure 4C). We found increased matrix metallopeptidase-9 (Mmp9) mRNA levels in the LysM-IL-6^OE mice (see Supplementary material online, Figure S8). The mRNA levels of Mmp2, collagen (Col1a1, Col1a2, Col3a1), or vimentin did not differ significantly (see Supplementary material online, Figure S8).

Figure 4.

Interleukin-6-induced vascular dysfunction is associated with an altered vascular smooth muscle cell phenotype and fibrosis formation. (A) Collagen deposition in aortic sections. Sirius Red staining of aortic sections. Left: representative image of aortic sections (images without polarized light are shown below), scale bar = 50 µm. Right: aortic wall thickness and collagen thickness measurement at 10 different points/section with ImageJ software, n = 5, unpaired Student’s t-test. P = 0.0079 (collagen thickness). (B) Immunocytochemical analysis of vascular smooth muscle cell phenotype. Vascular smooth muscle cells were isolated from LysM-IL-6^OE mice and control mice and cultured. Cultured vascular smooth muscle cell were stained with smooth muscle alpha-actin, F-actin, Ki67, and DAPI (60×). Representative images are shown in the top row. Quantification is shown in the bottom row. n = 3 mice per group of two independent experiments. Single images of three biological replicates per mouse were analysed, and the mean values each mouse were compared, unpaired Student’s t-test. (C) Quantitative real-time PCR analysis for alpha SMA in LysM-IL-6^OE mice aortas (red) vs. control aortas. Housekeeping gene: Gapdh. n = 10–12 mice per group, unpaired Student’s t-test. P = 0.03. Data are presented as mean ± SEM, and P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Interleukin-6 produced by bone - marrow-derived cells correlates with vascular dysfunction and systemic inflammation

To elucidate the contribution of myeloid cells derived from the BM, we generated chimeric mice transplanted with different ratios of BM isolated from LysM-IL-6^OE mice (100, 50, and 10%) mixed with BM of control mice up to 100% (Figure 5A). Interestingly, circulating IL-6 levels in plasma (Figure 5B), vascular endothelial dysfunction (Figure 5C), and oxidative stress levels in blood (Figure 5D) all correlated with the amount of LysM-IL-6^OE mice BM transferred and were most significantly pronounced in WT mice reconstituted with 100% LysM-IL-6^OE BM cells. Importantly, vascular function in WT mice transplanted with only 10% of LysM-IL-6^OE BM was unchanged to controls (Figure 5C), indicating a dose-dependent effect of IL-6 on systemic inflammation and vascular dysfunction. The amount of CD11b⁺ myeloid cells invading in the aortic vessel and spleen as markers of the IL-6-driven chronic systemic inflammation also correlated with the transferred amount of LysM-IL-6^OE mice BM (Figure 5E and F).

Figure 5.

Bone marrow and blood interleukin-6 levels correlate with systemic and vascular inflammation and dysfunction. (A) Experimental approach of bone marrow transplantation. Schematic representation of the experimental design: different ratios of bone marrow isolated from LysM-IL-6^OE mice mixed with bone marrow from control mice (100, 50, and 10%) were transplanted into C57BL6-Ly5.1 mice. The transplantation scenarios included wild-type bone marrow → wild type (black circles), 100% LysM-IL-6^OE bone marrow → wild type (red circles completely filled with red colour), and mixed bone marrow consisting of 50% LysM-IL-6^OE/50% wild type → wild type (half red circles) or 10% LysM-IL-6^OE/90% wild type → wild type (red unfilled circles). Final analysis was conducted 70 days after bone marrow transfer. (B) Interleukin-6 levels in serum were measured by ELISA and Bioplex analysis in the bone marrow chimeric mice. n = 12–13, Kruskal–Wallis test with comparison of the mean of each column to the 100% control bone marrow column. P = 0.0245 (100% control bone marrow vs. 50% LysM-IL-6^OE bone marrow) and P < 0.0001 (100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). (C) Left: isometric tension studies of isolated aortic rings of bone marrow chimeric mice in response to acetylcholine. n = 5–16 mice/group, two-way ANOVA, Bonferroni’s multiple comparison. P < 0.0001 (comparison of the endpoint of the aortic relaxation curves of 100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). Right: comparison of the maximal relaxation of the aortic relaxation curves in response to acetylcholine shown on the left-hand side. P = 0.003 (comparison of the maximum relaxation of the aortic relaxation curves of 100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). (D) Reactive oxygen species/reactive nitrogen species measurement in blood after 20 min stimulation with phorbol 12,13-dibutyrate in bone marrow chimeric mice, n = 5–14, Kruskal–Wallis test with comparison of the mean of each column to the 100% control bone marrow column. P < 0.001 (100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). (E) Flow cytometric analysis of the CD11b⁺ cells in the spleen of bone marrow chimeric mice. n = 4–7 mice/group, Kruskal–Wallis test with comparison of the mean of each column to the 100% control bone marrow column. P = 0.0134 (100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). (F) Flow cytometric analysis of the CD11b⁺ cells in the aorta of bone marrow chimeric mice. n = 4–7 mice/group, Kruskal–Wallis test with comparison of the mean of each column to the 100% control bone marrow column. P = 0.0215 (100% control bone marrow vs. 100% LysM-IL-6^OE bone marrow). Data are presented as mean ± SEM, and P values of <0.05 were considered significant and marked by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

These findings show that vascular dysfunction and inflammation, as well as systemic inflammation and ROS formation, are driven by BM cell-derived IL-6 in a dose-dependent manner.

Discussion

Our results highlight the crucial long-term impact of myeloid cell-derived IL-6 on the development of vascular inflammation and dysfunction and underline a clear dose-dependent effect.

For us as clinical scientists based in cardiology, this mouse model was generated with the main aim to decipher the role of myeloid cell-derived IL-6 in CVD. This is of high clinical relevance, as elevated IL-6 levels in patients with CVD (as also seen for example in obesity⁴⁵) seem to predict a poorer outcome,^22,46 underlining the need for a better understanding of IL-6 in CVD.

The well-established central role of IL-6 in systemic inflammation⁴⁷ was confirmed in our mouse model. Additionally, our mouse model highlights the central role of IL-6 in inflammatory bowel disease (IBD).¹⁵ This is in line with the observation that patients with IBD have a higher risk of cardiovascular events compared with patients without IBD despite an unchanged incidence of conventional cardiovascular risk factors.¹⁷ Our mouse model also reflects the cardiovascular comorbidity of patients with IBD. One relevant factor of the cardiovascular comorbidity in IBD might be the chronic systemic inflammation.¹⁷ The microbiome, which is relevant in CVD development⁴⁸ and IBD,⁴⁹ might represent a further interconnecting factor.

To the best of our knowledge, this is the first report on the chronic effects of IL-6 on the vasculature in a mouse model. Elevated levels of IL-6, activated downstream of the cytokine IL-1β, are known to be associated with an increased rate of adverse cardiovascular events in patients with chronic atherosclerotic disease.^50,51 The inflammation concept in CAD supports the idea to specifically target the IL-6 receptor pathways to prevent or attenuate CAD.⁵² Interleukin-6 was found in atherosclerotic plaques⁵³ and shown to promote atherosclerotic lesion progression in mice.⁵⁴ Recently, it has been demonstrated that treatment approaches of antagonizing IL-6 could reduce various biomarkers of systemic inflammation associated with the atherothrombotic process in patients with high atherosclerotic risk.^55,56 In contrast, a potentially atheroprotective role of IL-6 has also been reported.^57,58 This underscores that experimental results on the role of IL-6 in the cardiovascular system must be interpreted carefully.²²

In our study, we detected that IL-6 induces vascular dysfunction systemically—in both large and small vessels. This was paralleled by an increased ROS formation, recapitulating findings by Wassmann et al.⁵⁹ in mice treated with IL-6 over 18 days. In parallel, Mcp1, Vcam1, Cxcl1 and 2, Tnf, iNOS, Nox2, Stat3, and Rorc, key drivers and relevant components of vascular dysfunction and inflammation, were upregulated in the LysM-IL-6^OE aortas. The increased infiltration of myeloid cells into the aortic vessel wall and the increased vascular ROS formation detected in LysM-IL-6^OE mice are fully compatible with the activating effect of IL-6 on myeloid cells.^8,60 In comparison with mice with AngII-induced vascular dysfunction (1 week of AngII treatment), the number of myeloid cells invading into the aortic vessel wall seemed higher in the AngII-treated mice.⁶¹ This suggests that it is necessary to differentiate between long-term inflammation, as seen in the LysM-IL-6^OE mouse model, and the short-term inflammation in the AngII model. However, since ROS scavengers as catalase could not attenuate vascular dysfunction when applied to LysM-IL-6^OE aortas in vitro, this indicates that not acute exposure to oxidative stress, but rather long-term impact of chronic IL-6-driven inflammation renders the vasculature dysfunctional.

We therefore focussed on these long-term effects: we found a moderately increased fibrosis in the aortic vessel walls of the LysM-IL-6^OE mice in line with the reported fibroblast stimulating effect of IL-6.⁶² Although this increase in the interstitial collagen thickness was significant, we were not faced with a major difference in size. This finding may pave the way for long-term IL-6-driven alterations of the vasculature and reflect an ongoing process. In any case, the increased mRNA expression of MMP-9 is compatible with an increased collagen turnover.⁶³ Further, we found an altered phenotype of VSMCs in the form of loss of contractile markers, suggesting a phenotypic switch towards a more synthetic phenotype.^64,65 We therefore hypothesize that the vessels in the LysM-IL-6^OE mice are most likely in the process of an altered collagen formation. Nevertheless, they still provide an increased capacity to constrict upon stimulus. Taken together, these findings conclude that the vascular dysfunction initiated by myeloid cell-derived IL-6 overexpression involves the activation of multiple vascular cell types and release of downstream mediators and finally impacts the vascular collagen and VSMC phenotype.

Vascular dysfunction in LysM-IL-6^OE mice was associated with an altered VSMC phenotype but did not evoke blood pressure elevation and systemic hypertension. The nitric oxide release of iNOS, which was upregulated in the LysM-IL-6^OE aortas, could potentially blunt a potential blood pressure increase. The increased aortic ET-1 expression in the LysM-IL-6^OE mice is strengthened by reports that chronic endothelial ET-1 overexpression is associated with normal blood pressure⁶⁶ (in contrast to short-term endothelial overexpression of ET-1 resulting in hypertension⁶⁷). Interestingly, our data demonstrate IL-6 to be capable of driving vascular ET-1 expression. In total, this suggests that chronic IL-6 expression has the potential to trigger a vicious cycle of vascular dysfunction and inflammation. High expression of the IL-6 receptor in the aortic tissue in LysM-IL-6^OE mice suggests that IL-6 can directly impact the vasculature. This assumption is in line with data reported for human Endothelial cells (ECs).⁶⁸ Further analysis has to follow on the exact IL-6 signalling in ECs and VSMCs under chronic IL-6 exposure. Here, the dose–response curve of IL-6 in the cardiovascular system must be kept in mind to determine at which IL-6 quantity chronic IL-6 exposure evokes changes in the cardiovascular system. The BM transfer experiments we performed suggest that the number of IL-6-producing myeloid cells in the BM correlates directly with systemic and vascular inflammation. Further studies on the impact of anti-IL6 treatment in this mouse model—and in a mouse model of vascular dysfunction—are needed.

The reported mouse model, as all genetic mouse models, certainly is not fully physiologic. However, extrapolating murine experimental knowledge from bench to bedside can raise necessary awareness that patients with elevated IL-6 levels (e.g. due to chronic IL-6-driven inflammatory diseases) are at risk to develop vascular inflammation. Since IL-6 levels correlate not only with systemic inflammation but also with vascular dysfunction and inflammation, it must be one treatment goal to keep the underlying inflammatory situation limited.

Conclusion

Long-term myeloid cell-derived IL-6 expression evokes a chronic systemic inflammatory state with autoimmune colitis as a leading symptom. This is associated with significant vascular inflammation and dysfunction, ROS formation, elevated vascular ET-1 expression, alterations of the VSMCs, and increased collagen formation. Vascular dysfunction and ROS formation were driven by BM cell-derived IL-6 in a directly dose-dependent manner. Based on our findings, we conclude that long-term reduction in systemic IL-6 levels (e.g. by treating the existing autoimmune disease) is essential to reduce the associated vascular phenotype.

Further research focused on the complex impact of central cytokines as IL-6 on vascular regulation in (chronic) inflammatory diseases will lead to a better understanding of the vascular component in inflammatory diseases and new targets amenable for drug therapy.

Lead author biography

Tanja Knopp studied anthropology in Mainz, Germany, and focused on the impact of interleukin-6 on the vasculature and on the coagulation cascade during her thesis. As a post-doc in Bern, Switzerland, she is now working in the field of thrombosis and haemostasis.

Rebecca Jung studied biology in Mainz, Germany. As a PhD candidate, she concentrated on the role of the cytokines IL-6 and IL-17A in vascular dysfunction development and on the cardiovascular comorbidity in the IL-17A-driven autoimmune skin disease psoriasis. She meanwhile switched from university to industry and continued working in the field of autoimmune diseases.

Data availability

The data underlying this article will be shared on request to the corresponding author.

Supplementary material

Supplementary material is available at European Heart Journal Open online.

Author contribution

R.J., T.K., J.W., M.B., K.P., I.G., K.Z., A.L., P.E., J.L., T.B., M.M., V.R., and C.R. performed experiments and statistical analysis. N.H., T.W., and J.M. supported the generation of the genetic mouse model. M.O., A.D., K.S., I.F., I.B., I.A.M., A.N.R.W., and T.M. were fruitful discussion partners and supported the analysis and writing and correction of the manuscript. K.S.K. corrected the manuscript. S.R. performed mouse endoscopy. P.W. supported the whole project with discussion, analysis, and writing. A.W. and S.K. designed the mouse and the project. SK made the mouse, planned the experiments, acquired funding, performed the analysis, supervised PhD candidates, and wrote the manuscript.

Funding

This work was supported by the German Federal Ministry for Education and Research (BMBF 01EO1503, CTH Mainz TRP Project X.II and junior group ‘Systemic inflammation and vascular disease’) and the Deutsche Forschungsgemeinschaft (DFG) with the grant KA 4035/1-1 (S.K.). It was partially funded by the Boehringer Ingelheim Foundation ‘Novel and neglected cardiovascular risk factors: Molecular mechanisms and therapeutic implications’ (S.K., J.W., M.M., and P.W.) and the DZHK grant ‘Platelet signatures and psoriasis in cardiac dysfunction’ (S.K. and P.W.). S.K., A.W., K.S.K., and A.N.R.W. were supported by the DFG/SFB grant TRR156/2–246807620. P.W. was supported by the DFG WE4361/14-1 and M.M. by the DZHK (FKZ 81X3210105) and the Else Kroner-Fresenius Foundation (2021_ 2020_EKEA.14). N.H. and A.W. were supported by CRC1292/2–318346496. M.B. was supported by the National Institutes of Health (1R01HL141513, 1R01HL139641, 1R01AI153613) and the DFG (BO3482/3-3, BO3482/4-1). K.Z. was supported by a PhD fellowship from the Marie Skłodowska Curie Innovative Training Network ‘TICARDIO’ (Marie Skłodowska Curie grant agreement No 813409). K.S. received funding from the German Research Foundation (Deutsche Forschungsgemeinschaft; SCHA 808/9-2 and Sonderforschungsbereich 1531, project A09; project number 456687919) and I.F. from the German Research Foundation (Sonderforschungsbereich 1531, project B03; project number 456687919). K.S.K. was supported by the Physician Scientist Programme, University Hospital Heidelberg.