Loss of Anoctamin 1 Reveals a Subtle Role for BK Channels in Lymphatic Muscle Action Potentials

Abstract

Ca²⁺ signaling plays a critical role in determining lymphatic muscle cell (LMC) excitability and contractility through its interaction with the Ca²⁺-activated Cl⁻ channel Anoctamin 1 (ANO1). In contrast, the large-conductance (BK) Ca²⁺-activated K⁺ channel (KCa) and other KCa channels have prominent vasodilatory actions via hyperpolarizing vascular smooth muscle cells. Here, we assessed the KCa family expression and contribution to mouse and rat lymphatic collecting vessel contractile function. BK channel expression was the only KCa channel consistently expressed in FACS-purified mouse LMCs. We used pharmacological inhibitors of BK channels, iberiotoxin (IbTX), and small-conductance (SK) Ca²⁺-activated K⁺ channels, apamin, to acutely inhibit KCa channels in ex vivo isobaric myography experiments and intracellular membrane potential recordings. Under basal conditions, BK channel inhibition had little to no effect on either mouse inguinal axillary lymphatic vessel (MIALV) or rat mesenteric lymphatic vessel (RMLV) contractions or action potentials (APs). We also tested BK channel inhibition under loss of ANO1 either by genetic ablation (Myh11CreERT²-Ano1 fl/fl, Ano1ismKO) or pharmacological inhibition with Ani9. In both Ano1ismKO MIALVs and Ani9-pretreated MIALVs, inhibition of BK channels increased contraction amplitude, increased peak AP potential, and broadened the peak of the AP spike. In RMLVs, BK channel inhibition also abolished the characteristic post-spike notch, which was exaggerated with ANO1 inhibition, and significantly increased the peak potential and broadened the AP spike. We conclude that BK channels are present and functional on mouse and rat LMCs but are otherwise masked by the dominance of ANO1.

Graphical Abstract

The specific ionic components contributing to the L-type (Cav1.2) voltage-gated Ca²⁺ channel dependent lymphatic myocyte (LMC) action potential (AP) are still being identified. Previous studies have identified a critical role for Anoctamin 1 (ANO1) and chloride conductance. Surprisingly, previous reports have demonstrated little involvement of big conductance (BK) potassium channels, which play a critical role in vascular smooth muscle regulation, in lymphatic muscle regulation. In the LMC AP, ANO1 limits the peak potential generated in Phase 0 (the synchronous activation of Cav1.2 channels) and is also responsible for driving the plateau phase of the AP, clamping membrane potential voltage near a presumed chloride reversal potential (E_Cl) around −11 mV. Loss or inhibition of ANO1 increases the spike upstroke speed, abolishes the AP plateau phase, and importantly results in greater peak membrane potential, which permits increased BK channel activation and contribution to the AP. Under conditions when ANO1 is absent or inhibited, the inhibition of BK channels (IbTX, 100 nM) further increases the peak spike potential, slows the initial transient post-spike repolarization, and results in a subtle increase in contraction strength.

Introduction

The propulsive contractions of the collecting lymphatic vessels (cLVs) in mammals provide the requisite force to return the macromolecules and fluid, filtered from the blood and recovered as lymph in the lymphatic capillaries, back to the blood circulation. This intrinsic lymph pump activity is necessary to overcome the prevailing adverse pressure gradient within the lymphatic circulation and to encourage lymph formation through suction transmitted upstream to the lymphatic capillaries. This intrinsic contractile activity accounts for a large proportion of lymph transport, particularly in the extremities and at rest, and can adapt to meet lymphatic demand (chronic changes in lymphatic pressure) (Dongaonkar et al., 2013; Dongaonkar et al., 2015). Loss of normal lymphatic contractility has been consistently described in lymphedema patients (Olszewski, 2008; Cintolesi et al., 2016), yet the contributions of various ion channels to the regulation of cLV pacemaking, tone, and phasic contraction amplitude remains poorly described. Our limited understanding of ionic regulation of lymphatic muscle cells (LMCs) limits the development of pharmaceutical interventions designed to rescue or enhance the intrinsic lymphatic pump.

LMC excitability has been historically linked to a Ca²⁺-activated Cl⁻ channel (Van Helden, 1993; Ferrusi et al., 2004), recently identified as Anoctamin 1 (ANO1, also described as TMEM16a) (Mohanakumar et al., 2018; Zawieja et al., 2019). It was recently shown that ANO1 mediates the pressure-dependent chronotropy typical of mammalian cLVs (Zawieja et al., 2019) through activation by diastolic inositol triphosphate receptor 1 (IP3R1)-dependent Ca²⁺ oscillations in LMCs (Zawieja et al., 2023). Ca²⁺-sensitive ion channels have also been well characterized in vascular smooth muscle cells (VSMCs), where Ca²⁺ release from either IP3R1 or ryanodine receptors can differentially regulate arterial myocyte excitability and vessel tone (Davis et al., 2023b). In VSMCs, transient Ca²⁺ release from ryanodine 2 channels, termed ‘sparks’ (Nelson et al., 1995), activate the large-conductance Ca²⁺-activated K⁺ (BK) channel to produce spontaneous outward currents (STOCs), which hyperpolarize the membrane potential and thereby promote vessel dilation. Increased intravascular pressure increases the frequency of Ca²⁺ sparks and STOCs, thereby acting as a brake to the myogenic response (Jaggar et al., 1998) and playing a critical role in blood flow regulation (Kassmann et al., 2019; Greenstein et al., 2020; Sytha et al., 2022; Johnson et al., 2023; Taylor et al., 2023). While the small conductance (SK) and intermediate conductance (IK) Ca²⁺-activated K⁺ channels also regulate blood flow, the expression of these channels is largely observed in endothelial cells. Endothelial SK and IK’s mediation of VSMC hyperpolarization is contingent upon myoendothelial hetero-cellular gap junctions; however, such junctions have not been observed in cLVs (Briggs Boedtkjer et al., 2013; Castorena-Gonzalez et al., 2018; Hald et al., 2018). While all KCa channels are regulated by Ca²⁺, BK channels are also regulated by voltage. Thus, the LMC-produced action potential (AP) may act as a regulator of BK channel activity.

Despite the prominent role of BK channels in the regulation of vascular tone, there are only a handful of studies which have assessed their regulation of LMC excitability and contractile function. Cotton et al., (1997) demonstrated that BK channels mediate 90% of outward current in whole-cell patch clamp of sheep mesenteric LMCs (Cotton et al., 1997). Inhibition of BK channels with paxilline (which has off target actions on SERCA (Bilmen et al., 2002)) increased human lymphatic thoracic duct contraction frequency, but surprisingly the BK channel opener NS-1619 had no effect. BK channel inhibition had no effect on contraction frequency in RMLVs (Mizuno et al., 1999). A recent study of murine popliteal lymphatic vessels appeared to support the notion that BK channels may be largely inactive under normal conditions, although their findings also demonstrated a role for BK channels in nitric oxide (NO) -mediated inhibition of lymphatic pacemaking and contractility. However, it is unresolved whether BK channels were activated directly in response to signaling downstream of NO (such as by phosphorylation) or indirectly by the subsequent Ca²⁺ alterations and voltage dynamics in the LMC.

Pharmacological inhibition or genetic ablation of Ano1 significantly increased the peak membrane potential and peak Ca²⁺ concentration during the LMC AP (Zawieja et al., 2019; Zawieja et al., 2023). As BK channels are both voltage- and Ca²⁺ - sensitive, we hypothesized that loss of Ano1 or inhibition of ANO1 with the specific inhibitor Ani9 (Boedtkjer et al., 2015; Seo et al., 2016) would create a cellular ionic environment more conducive to BK channel activity, even in the absence of stimulated NO signaling. We tested this hypothesis using isolated lymphatic vessel pressure myography and intracellular membrane potential recordings in both rat mesenteric lymphatic vessels (RMLVs) and mouse inguinal-axillary lymphatic vessels (MIALVs).

Materials and Methods

Ethical Approval

Mice were used under approval of the University of Missouri Animal Care and Use Committee (ACUC) protocol 27320 “Regulation of Lymphatic Muscle Cell Function” and in compliance with the standards and requirements are outlined in the “Guide for the Care and Use of Laboratory Animals” by the Public Health Service Policy on Humane Care and Use of Laboratory Animals (OLAW assurance number D16–00249). For the rat membrane potential recording experiments, rat mesenteric tissues were collected immediately post-mortem from rats under the University of Missouri ACUC protocol (41500) titled “Regulation of lymphatic vessel function”. For rat pressure myography experiments, procedures and care were performed in compliance with protocols approved by the Texas A&M University Institutional Animal Care and Use Committee (Protocol 2018–0386).

Mice

Male C57BL/6J wild-type (WT) mice (15–35g) and Myh11Cre-EGFP reporter mice (Strain# 007742) PMID: 12209023, were purchased from The Jackson Laboratory (Bar Harbor, MA, USA). Anoctamin 1 flox/flox (Ano1 fl/fl) mice were a kind gift from Dr. Jonathan Jaggar (University of Tennessee Health Science Center) (Leo et al., 2021); the Y-linked Myh11CreER^T2 mice (Wirth et al., 2008) were a gift from Stefan Offermanns, Max-Planck-Institut für Herz-und-Lungendforschung, Bad Nauheim, Germany. Mouse genotyping was performed using the HotSHOT method (Truett et al., 2000) with DNA isolated from tail clips upon weaning. Myh11CreER^T2, Myh11Cre-EGFP, and Ano1 fl/fl were confirmed via genotyping PCR. Mice were allowed ad libitum access to food and water and housed under normal light and dark cycles in cages of up to five mice. Myh11CreER^T2-Ano1 fl/fl (Ano1ismKO) and Ano1 fl/fl control mice were induced with 1 mg tamoxifen (100 μl i.p. injection, 10 mg/ml) for 5 consecutive days. Mice were not used in a blinded or randomized order as the phenotype of Ano1ismKO MIALVs is readily apparent by its significantly lower contraction frequency.

Mice were anesthetized by ketamine-xylazine (100/10 mg/kg) cocktail and euthanized via cervical dislocation once at a stable anesthetic plane as determined by an unresponsive pedal reflex. The MIALVs were isolated as previously described (Zawieja et al., 2018). An incision in the skin was made along the spine from the base of the tail to the top of the front leg. The resulting skin flap was pinned and cleared of the connective tissue attaching it to the abdominal wall to reveal the thoracoepigastric vein and located adjacent to it. The MIALV was cleaned of matrix and adipocytes to allow for edge-based wall tracking and cut into single-valved sections for the ensuing isolated vessel protocols.

Rats

Male outbred Sprague-Dawley rats weighing 180–325 g were purchased from Inotiv and Envigo and given ab libitum access to food and water. Rats were anesthetized by either ketamine-xylazine (100/10 mg/kg) cocktail or isoflurane (4% for induction, 2–3% for maintenance) and prepared for midline laparotomy. After the midline incision, the jejunum was ligated at the upstream and downstream ends. The jejunum and associated mesentery were then isolated and placed in chilled albumin (0.5%)-physiological salt solution (APSS) or Krebs-BSA buffer. Rats were euthanized by exsanguination while at the appropriate anesthetic plane anesthetic plane as determined by an unresponsive pedal reflex. The tissue from jejunum was pinned out in a Sylgard dish and RMLVs were dissected from the tissue.

Isobaric Myography

Experiments were performed within the same day of tissue isolation; no single protocol was longer than 4 hours. Tissue was isolated in the morning and experiments concluded within 12 hours. Vessels were maintained in their respective tissues (mesenteric or flank tissue) and vessel isolation immediately preceded cannulation and experimentation. Isolated MIALVs or RMLVs were cannulated onto glass micro-pipettes (80 to 100 μm diameter) in a self-heating observation chamber in either Krebs-BSA or APSS buffer. The pipettes were connected to a single pressure reservoir initially set to 3 cmH₂O. Vessels were allowed to slowly reach 37–38°C and equilibrated for 30–45 minutes while spontaneous contractions began and stabilized. While equilibrating, the pressure was transiently set to 7–8 cmH₂O and the vessel lengthened axially to remove slack, then returned to 3 cmH₂O. The length of the vessel was maintained constant over the remainder of the experiment. The vessel was imaged either using an inverted Leica DMi1 or DMIL or with an Olympus BX61W1, Olympus BX51W1, or Olympus CH-2 upright microscope using a 10x objective. Vessel wall diameter was tracked in real time with a custom designed Labview (LabVIEW; National Instruments, Austin, TX) program. The following protocols were used:

1. After equilibration RMLVs were stepped to 1, 3, 5, 7 cmH₂O for 5–8 minutes at each pressure. RMLVs were returned to 3 cmH₂O and incubated with either 100 nM IbTX or 100 nM Penitrem A for 15 minutes and then the pressure steps repeated.

2. In a similar experiment, MIALVs were stepped down from 3-2-1-0.5 cmH₂O. The diameter was then recorded for 3 minutes at each pressure from 0.5-1-2-3-5 cmH₂O. MIALVs were returned to 3 cmH₂O and incubated with 100 nM IbTX for 15 minutes or a vehicle control (3 μl water) and the pressure protocol repeated.

3. MIALVs from Ano1 fl/fl controls mice or Ano1ismKO mice were equilibrated at 3 cmH₂O and then treated with 100 nM apamin followed by 100 nM IbTX at 3-minute intervals.

4. MIALVs isolated from male C57BL/6J or male Ano1ismKO mice were equilibrated at 3 cmH₂O and then treated with 0.5, 1, 1.5, 3, 5, 7, 10 μM Ani9.

5. MIALVs (one left and one right) from C57BL/6J were equilibrated at 3 cmH₂O. One vessel from each mouse was pretreated with 3 μM Ani9; the other vessel was not. All vessels were then treated with 100 nM apamin followed by 100 nM IbTX at 3-minute intervals.

At the end of each mouse myograph experiment the bath was replaced with Krebs Ca²⁺-free Krebs (MIALVs) for 15 minutes prior to taking passive diameter at each pressure. For the larger RMLVs, the bath was exchanged with Ca²⁺-free APSS and passivation was ensured by adding caffeine (100 mM) to the bath, and validated by failure to respond to 20uM Substance P. The bath was then changed back to plain Ca²⁺-free APSS before measuring passive diameters. The final 1–2 min of steady state data at each experimental pressure or condition was used for analysis.

Membrane Potential Recordings

Isolated MIALVs from tamoxifen-injected floxed controls and Ano1ismKO mice and RMLVs were isolated and cannulated as described above. Vessels were equilibrated at 3 cmH₂O and contractions allowed to stabilize. A bolus of wortmannin was applied at low concentration (<2.5 μM) to block myosin light chain kinase (MLCK) and reduce the contraction amplitude to <5 μm, which would otherwise dislodge the sharp electrode impalements. An additional bolus of wortmannin (1 μM) was added as necessary to maintain the small contraction amplitude throughout the course of the experiments. Impalements were made using intracellular microelectrodes (250–300 MΩ) filled with 1 M KCl. Vm was sampled at 1 kHz using a SEC 05x amplifier (NPI) connected to a Grass S48 stimulator, viewed with a Tektronix TDS3052 digital oscilloscope, and recorded using a custom LabVIEW program. Upon impalement, Vm was allowed to stabilize and data were later adjusted with the microelectrode retraction offset voltage recorded at the end of the experiment. The detection of APs evidenced successful impalements into LMCs (Behringer et al., 2017; Hald et al., 2018) since lymphatic endothelial cells do not exhibit APs (Castorena-Gonzalez et al., 2018). After recording baseline APs in MIALVs, 100 nM apamin and then 100 nM IbTX were added to the bath with light mixing. In separate experiments, MIALVs were isolated from WT C57Bl6 mice and contractions blunted as above. Once contractions were sufficiently blunted, the vessels were pretreated with 3 μM Ani9. Following successful impalement, stabilization, and recording of APs under in the presence of Ani9 the MIALV was then treated with 100 nM IbTX.

APs were analyzed using an in-house Python algorithm to determine resting Vm, diastolic depolarization, threshold Vm, spike Vm, plateau Vm, time over threshold, and time over 0 mV (Zawieja et al., 2018). The AP “notch” value noted in RMLVs was determined with the ‘Find Peaks’ function in the BAR (Ferreira, 2015) package using on FIJI (Schindelin et al., 2012) with 1mV as the criteria. Diastolic depolarization rate was obtained from a linear fit from the minimum membrane potential to the threshold potential and expressed as mV/s. The fast upstroke of the AP was fitted as V(t) = e^t/τ from the threshold potential to the peak spike potential, with the time constant τ (in ms) organized such that a low value of τ reflects a steeper curve. Membrane potential recordings containing at least three consecutive and stable APs were analyzed and averaged to represent a single vessel at a given pharmacological state.

LMC Dissociation and FACS Collection

Both left and right full-length MIALVs were isolated from Myh11Cre-EGFP for digestion into a single cell suspension for FACS purification as previously described. In brief, full-length left and right MIALVs were isolated and cleaned of excess matrix and adipocytes. Vessels were equilibrated in a low-Ca²⁺ PSS solution supplemented with 0.1 mg/ml bovine serum albumin (BSA, Amersham Life Science, Arlington Heights, IL) for 10 min. Vessels were digested with 26 U/ml papain (Sigma, St. Louis, MO) and 1 mg/ml dithioerythritol for 30 min at 37°C and were gently agitated every few minutes. This solution was replaced with 1.95 collagenase H (U/ml, Sigma), 1.8 mg/ml collagenase F (Sigma), and 1 mg/ml elastase (Worthington LS00635) in low-Ca²⁺ PSS and incubated for another 3–5 min at 37°C. The vessels were then washed with low-Ca²⁺ PSS and triturated with a fire-polished Pasteur pipette to dissociate the cells into a single-cell suspension, then passed through a Falcon cap strainer (35 μm), and resuspended in ice-cold low-Ca²⁺ PSS for sorting. GFP⁺ cells from Myh11Cre-EGFP vessels were then FACS-purified using a Beckman-Coulter MoFlo XDP instrument straight into RNA isolation buffer for RT-PCR analysis. Cells were gated for singlets and collected with an efficiency of >90%.

FACS and RT-PCR of LMC KCa Channels

RNA was isolated from the FACS-purified LMCs or from whole MIALVs, dissected and cleaned as described above, using the Arcturus PicoPure RNA isolation kit (ThermoFisher Scientific, Waltham, MA) as per the listed instructions with additional on-column DNAse digestion (Qiagen, Valencia, CA). RNA was eluted in 20 μl of water and reverse-transcribed into cDNA with SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, Waltham, MA) using oligo (dT) and random hexamer priming. The PCR reaction mixture contained first-strand cDNA as the template, 2 mM MgCl2, 0.25 μM primers, 0.2 mM deoxynucleotide triphosphates, and GoTaq^® Flexi DNA polymerase (Promega, Madison, WI). The PCR protocol was as follows: an initial denaturation step at 95°C for four min, then 35 repetitions of the following cycle: denaturation (94°C, 30 s), annealing (58°C, 30 s), and extension (72°C, 30 s). This was followed by a final elongation step for 5 min at 72°C. The PCR reaction was separated via gel electrophoresis (2% agarose) and then stained with SYBR-Safe (ThermoFisher Scientific, Waltham, MA) for visualization with UV trans-illumination. Mouse primers were purchased from IDT and are as follows (Forward, Reverse): Kcnn1 (SK1, NM_032397) GCTCAGAAGCTCCGAAGTGT, GATGGAGCAGTCTAGCGGTC; Kcnn2 (SK2, NM_080465) GAGCGCTCAGCATTGTAGGA, GCCAACTCTACCGCCATC; Kcnn3 (SK3,NM_080465) GACCGAACTGTCTTGGGGTT, GCCCGAGATGGGGTATAGGA; Kcnn4 (SK4/IK, NM_032397) GACATCAGCGCAAGATGCTG, CTTCTGTGAGTTCATGTGGAGC; Kcnma1 (BK, NM_001253358) CTTCACAACATCTCCCCTAACC, GCATGCATCTGCTGACTCTA; Cacna1c (Cav1.2, NM_00159533) CGTAGGAGCACGTTCGATAAC, CAATGGCCAAGAACACATTCAG. Expected amplicon sizes are SK1 352bp, SK2 242bp, SK3 294bp, IK 290bp, BK 122bp, Cav1.2 319bp.

Data Analysis

Recorded MIALV and RMLV diameters were used to determine passive diameter (MaxD, μm), end-diastolic diameter (EDD, μm), and end-systolic diameter (ESD, μm). Additionally, the following lymphatic pump function indices were calculated at each transmural pressure:

• 1. Contraction frequency = Contractions/Minute

• 2. Contraction amplitude = EDD − ESD

• 2. Tone = 100 * (MaxD-EDD)/MaxD

• 3. Normalized Stroke Area (nSA) = (π(EDD/2)² − π(ESD/2)²)/π(MaxD/2)²

• 4. Normalized Pump Flow (nPF) = nSA*Frequency

Solutions and Chemicals

In the MIALV studies and RMLV Vm studies, HEPES buffered Krebs solution was prepared as (in mM) 146.9 NaCl, 4.7 KCl, 2 CaCl₂•2H₂O, 1.2 MgSO₄, 1.2 NaH₂PO₄•H₂O, 3 NaHCO₃, 1.5 NaHEPES, and 5 d-glucose, pH 7.4, at 37°C. Krebs-BSA buffer included 0.5% (wt/vol) BSA (SigmaAldrich). Krebs and Krebs-BSA were both titrated to pH 7.4 with HCl. Ca²⁺-free Krebs solution included 3 mM EGTA in place of CaCl₂.

For RMLV pressure myograph studies, albumin-physiological salt solution (APSS) was prepared as (in mM) 145.0 NaCl, 4.7 KCl, 2.0 CaCl2, 1.2 MgSO4, 1.2 NaH2PO4, 0.02 EDTA, 5.0 glucose, 2.0 sodium pyruvate, and 3.0 MOPS plus 0.5% purified BSA (wt/vol). Ca²⁺-free APSS was prepared by substituting CaCl₂ with 3.0 mM EDTA. IbTX was dissolved in water at 100 μM, aliquoted and stored at −20°C. Penitrem A was dissolved in dimethyl sulfoxide at 100 μM, aliquoted and stored at −20°C. All chemicals were purchased from MilliporeSigma, except for IbTX (AnaSpec Inc and Tocris) and Penitrem A (Enzo Life Sciences).

Statistical Analysis

Statistical analysis and graphing were done in GraphPad Prism. The reported ‘n’ values equate to animal number as only a single vessel per rat or mouse was used for any specific protocol. The exception to this is MIALV contraction experiments comparing with or without Ani9 pretreatment, in which each of the 5 wildtype C57BL/6J mice were represented by 2 vessels (1 from the left and 1 from the right MIALV; treatment group randomly assigned). This was done to mitigate effects of biological variability only; vessels from the same mouse were not paired in analysis. Otherwise, multiple but unique protocols were performed using both the left and right MIALVs. Contraction indices and Vm experiments were analyzed with a 2-way repeated measures ANOVA with the Geisser-Greenhouse correction for unequal variance, and when appropriate, followed by Sidak’s or Tukey Kramer’s multiple comparison test with individual variances computed for each comparison. In instances when no contractions were recorded, no value was given for contraction amplitude and mixed-effects analysis was used in lieu of 2-way ANOVA in these situations. Sidak’s test was used when comparing contraction indices pre vs post drug/vehicle at a single pressure, or Ano1ismKO vs C57BL/6J at a single concentration; Tukey’s was used when comparing contraction or Vm indices between two drug states (control, apamin, or both apamin + IbTX within a given genotype or pretreatment condition. Comparison of the percent of RMLV APs displaying a notch before or after IbTX was determined by paired 2-tail t-test. The notch potential reached before and after Ani9 was also compared by a paired 2-tail t-test. Statistical significance was deemed as p<0.05, although 0.05<p<0.1 are also stated. One RMLV in the pressure-IbTX study was excluded from analysis owing to impaired diastolic refilling indicative of an air bubble in the pipette line. Data are presented as mean and SD in the figures and enumerated in the Statistical Summary Supplement.

Results

Limited Role for BK Channels in Rat cLVs Under Normal Conditions

We first tested whether BK channels may be differentially activated in response to transmural pressure by performing repeated pressure step protocols (Figure 1A) with BK channel inhibition by either 100 nM IbTX or 100 nM Penitrem A. IbTX had no significant effect on contraction frequency (Figure 1B), contraction amplitude (Figure 1C), nSA (Figure 1D), or nPF (Figure 1E). However, RMLV vessel tone was significantly increased by IbTX, albeit mildly, with post hoc test revealing differences only at pressures 3 and 7 cmH₂O (Figure 1F). We repeated this same protocol in RMLVs using the BK inhibitor Penitrem A (100 nM) in lieu of IbTX. We observed no difference in contraction frequency, contraction amplitude, nSA, nPF, nor vessel tone across the control pressure step and the pressure step in the presence of 100 nM Penitrem A (Statistical Summary Supplement). These results largely support the previous findings for a lack of BK channel contribution to lymphatic contractile regulation under basal conditions or in response to a pressure challenge.

Figure 1.

Effect of BK channel inhibition by IbTX on contractile parameters of RMLVs at physiological pressures. Isolated and pressurized RMLVs were challenged by a pressure step protocol which was repeated in the presence of IbTX (100 nM) after a 15-minute incubation (A). Contraction frequency (B), contraction amplitude (C), nSA (D), nPF (E), and vessel tone (F) before and after IbTX (100 nM) were assessed by 2-way repeated measures ANOVA followed by Sidak’s test for multiple comparisons. n=6 (one vessel per animal). Mean and SD shown.

Mouse LMCs Express BK channels

However, BK channels are regulated by both Ca²⁺ and voltage. Rat LMC APs briefly exceed 0 mV during the AP spike. On the other hand, normal mouse LMC APs peak at −5 mV, but peak membrane potential will reach +10 mV to +20 mV when ANO1 is inhibited or lost (Zawieja et al., 2023). As genetic knockout models are limited in the rat, we transitioned to the mouse model to make use of Myh11CreER^T2-inducible deletion of Ano1 to study BK activation under those conditions. We first tested the expression of KCa channels using whole MIALVs (n=3, 1 female, 2 male samples). Kcnma1, which encodes the pore-forming α-subunit of BK channels, was detected in all the MIALVs whole vessel samples (Figure 2A). Additionally SK1 (Kcnn1) and IK (Kcnn4) were also consistently detected in the whole MIALV, and 1 sample MIALV was positive for SK1–3, IK, and BK channels. With limited RNA yield from two MIALVs per mouse (left and right), we pooled 4 MIALVs from 2 mice and observed expression of all the KCa channels (Figure 2B). We next tested the specific KCa expression in mouse LMCs using FACS-purified LMCs (Figure 2C) from MIALVs isolated from Myh11Cre-EGFP mice in 3 separate experiments (one female and two male). Both BK and Cav1.2 were observed in all 3 FACS-purified LMC samples. SK3 expression was detected in only 1 of the 3 FACS-purified LMC samples and we did not observe SK1, SK2 or IK expression within this 3-sample cohort (Figure 2C). All primers sets produced their amplicons of their expected size using whole brain mRNA as a positive control (Figure 2D). Expression of the pore-forming α-subunit of the voltage-gated Ca²⁺ channel (Cacna1c; Cav1.2) served as a positive control and was detected in all MIALV-derived LMC samples.

Figure 2.

Expression of KCa channels in MIALVs and FACS-purified mouse LMCs. We performed RT-PCR profiling on whole MIALVs from one mouse (A), whole MIALVs pooled from 2 mice (B), and FACS purified LMCs isolated from MIALVs (C) of Myh11Cre-EGFP mice, measuring the KCa channels SK1, SK2, SK3, IK, and BK (Kcnma1). CaV1.2 expression served as a LMC marker. Brain mRNA (D) served as a positive control. For whole MIALV, RT-PCR was performed 4 separate times, 1 of which was 4 MIALVs pooled from 2 mice. For FACS purified LMCs PCR results are from 1 of 3 independent FACS experiments (2 male, 1 female), however only this sample shown in C displayed SK3 expression.

SK and BK Channels Do Not Contribute to MIALV Contractile Regulation

We replicated our RMLV isobaric pressure myography study from Figure 1 using MIALVs isolated from wildtype C57BL/6 mice. MIALVs were subjected to a similar experimental pressure step protocol, which was repeated in the presence of 100 nM IbTX or a vehicle (water) control (Figure 3A). Neither IbTX nor the vehicle control significantly altered contraction frequency (Figure 3B,C) or contraction amplitude (Figure 3D,E) within this experimental cohort. However, nPF was significantly, but mildly, reduced at 2 cmH₂O in our vehicle control group (Figure 3G), although nPF was not statistically different in the IbTX treated group (Figure 3F). Both IbTX and vehicle control increased vessel tone by 2-way RM ANOVA. Post-hoc tests revealed significant increases in tone at 0.5 and 1 cmH₂O in the IbTX -treated MIALVs (Figure 3H) and 2 cmH₂O in the vehicle control group (Figure 3I). That the vehicle (water) group also had a significantly elevated vessel tone suggested the pressure challenge itself can produce sustained effects, at least on the order of minutes, and ultimately confounds the apparent mild increase in vessel tone observed in the IbTX -treated groups. Thus, we confined subsequent investigations to a single pressure.

Figure 3.

Role of BK channels in pressure-dependent regulation of MIALV contractility. MIALVs isolated from two cohorts of C57BL/6J mice were pressurized and challenged by a pressure step protocol. which was repeated in the presence of either IbTX (100 nM) or a vehicle (water) control after a 15-minute incubation (A). Contraction frequency (B,C), contraction amplitude (D,E), nPF (F,G), and vessel tone (H,I) following IbTX or vehicle were compared to the values acquired in initial pressure challenge through a 2-way repeated measures ANOVA followed by Sidak’s test. n=6 for IbTX group, n=7 for vehicle control group (one vessel per animal). Mean and SD shown.

Subtle Role for BK Channels to Slightly Inhibit Contraction Amplitude in the Absence of Ano1

We then tested our central hypothesis that KCa channels, particularly BK channels due to its voltage-dependency, would be activated in the absence of ANO1 and contribute to MIALV regulation. MIALVs from both Ano1 fl/fl controls and Ano1ismKO mice were tested with 100 nM apamin followed by 100 nM IbTX (Figure 4A). Consistent with our previous work, Ano1ismKO vessels had a significant reduction in contraction frequency compared to their respective Ano1 fl/fl controls regardless of the presence of the KCa channels inhibitors (Figure 4B). No significant difference in contraction amplitude or vessel tone was noted between Ano1 fl/fl and Ano1ismKO MIALVs (Figure 4C,D). When comparing within each group to the Krebs control period, SK inhibition with 100 nM apamin alone had no effect on the contractile parameters in either MIALVs from Ano1 fl/fl controls or Ano1ismKO mice. The layering of 100 nM IbTX in the presence of 100 nM apamin significantly, but mildly, increased contraction frequency (Figure 4E) and vessel tone (Figure 4I) in MIALVs from Ano1 fl/fl controls, but surprisingly not in our MIALVs from Ano1ismKO mice. However, contraction amplitude (Figure 4F) and nSA (Figure 4G) were significantly increased by IbTX in only MIALVs isolated from Ano1ismKO mice. Neither of these changes were dramatic enough to change nPF (Figure 4H) in either genotype. Thus, in the absence of ANO1, inhibition of BK channels slightly increased the strength of MIALV contraction.

Figure 4.

Effect of SK and BK channel inhibition on contractile function of MIALVs from Ano1ismKO and Ano1 fl/fl control mice. MIALVs isolated from Ano1ismKO and Ano1 fl/fl mice were pressurized to 3 cmH₂O under control conditions (“C”) and treated with a layered application of the KCa inhibitors apamin (100 nM) (“A”) and IbTX (100 nM) (“A+I”) (A). Contraction frequency (B, E), contraction amplitude (C, F), tone (D, I), nSA (G), and nPF (H) were assessed by 2-way repeated measures ANOVA. In post hoc tests, drug states were compared across (Sidak’s test; B-D) or within (Tukey’s test; E-I) genotype. n=5 for Ano1 fl/fl (circles), n=7 for Ano1ismKO (squares), one vessel per animal. Mean and SD shown.

One of the limitations to mouse studies with inducible genetic manipulation, such as gene deletion, is the possibility for compensatory or unintended transcriptional changes as consequence of gene deletion or tamoxifen injection, which could include differences in KCa channel expression. We performed a concentration response using the specific ANO1 inhibitor, Ani9, in MIALVs isolated from male C57BL/6J (Figure 5A) mice and male Ano1ismKO (Figure 5B) mice to identify the minimal effective concentration, as assessed by contraction frequency, of Ani9. There was no difference in the contraction frequency between Ano1ismKO MIALVs and WT MIALVs concentrations of 3 μM Ani9 and higher (Figure 5C). Contraction frequency in MIALVs from Ano1ismKO mice was not significantly affected by any of the Ani9 concentrations tested although one vessel of the four lost contractions at the highest concentration (Figure 5C). Vessel tone was not significantly different across the genotypes regardless of the Ani9 concentration (Figure 5D). Curiously, contraction amplitude was not significantly different at baseline between Ano1ismKO and WT MIALVs, but was significantly higher in C57BL/6J MIALVs at 1.5 μM Ani9 and higher. Ani9 appeared to display opposite actions on amplitude – increasing amplitude in C57BL/6J but decreasing it in Ano1ismKO MIALVs (Figure 5E) presumably due to off-target effects.

Figure 5.

Concentration response for Ani9 in MIALVs isolated from C57BL/6J and Ano1ismKO mice, pressurized at 3 cmH₂O. Representative diameter traces for C57BL/6J (A) and Ano1ismKO (B) MIALVs over the Ani9 concentration response. Contraction frequency (C) and vessel tone (D) were assessed by 2-way repeated measures ANOVA. Because one vessel was noncontractile at the highest concentration of Ani9, contraction amplitude (E) was assessed by a mixed effects model. Sidak’s test was used to compare genotypes at each concentration of Ani9. n=6 for C57BL/6J and n=4 for Ano1ismKO (one vessel per animal). Mean and SD shown.

We repeated the apamin and IbTX experiment with acute pharmacological inhibition of ANO1 by 3 μM Ani9 in place of genetic deletion (Figure 6A) to rule out potential compensatory expression changes common in genetic knockout models. Ani9-pretreated MIALVs had a small but significant increase in contraction frequency in response to apamin although there was not a further increase in frequency with the subsequent application of IbTX (p=0.051) (Figure 6B). No significant change in contraction frequency was detected in the control C57BL/6J MIALVs without Ani9 pretreatment to apamin or IbTX. In C57BL/6J MIALVs pretreated with 3 μM Ani9, both apamin and IbTX significantly increased contraction amplitude (Figure 6C), and IbTX significantly increased nSA (Figure 6D). We also observed a significant increase in nPF in Ani9-pretreated MIALVs with both apamin and IbTX (Figure 6E), likely due to the increase in frequency given the small amplitude changes. Only apamin slightly increased vessel tone in the Ani9-pretreated MIALVs (Figure 6F). Consistent with the Ano1ismKO MIALVs, IbTX pretreatment increased contraction strength only when Ano1 was blocked by Ani9.

Figure 6.

Effect of SK and BK channel inhibition on contractile parameters of MIALVs with acute ANO1 inhibition by Ani9. C57BL/6J MIALVs pressurized to 3 cmH₂O in Krebs buffer only (“K”) or with pretreatment of the ANO1 blocker Ani9 (3 μM) received layered application of apamin (100 nM) (“A”) and IbTX (100 nM) (“A+I”) (A). Contractile indices contraction frequency (B), amplitude (C), nSA (D), nPF (E), and vessel tone (F) were assessed by 2-way repeated measures ANOVA. Tukey’s test was used to compare the different KCa inhibition conditions within a given pretreatment status. n=6 for group without Ani9 pretreatment (circles); n=6 for group with Ani9 pretreatment (squares), two vessels per animal (one per group). Mean and SD shown.

BK Channels Limit Peak AP Potential and Assist in Repolarization in the Absence of ANO1

BK channel inhibition by IbTX increased contraction amplitude if ANO1 was either genetically deleted or already pharmacologically inhibited. As each contraction is elicited by an AP in the LMCs, we used intracellular membrane potential recordings in pressurized and contracting MIALVs from Ano1 fl/fl or Ano1ismKO mice to identify how BK channels affect the LMC APs. Ano1 fl/fl APs occasionally had a small spike reaching up to −8 mV which then settled to a plateau at approximately −10 to −11 mV (Figure 7A). In contrast, Ano1ismKO APs had a spike waveform that reached significantly higher membrane potential and lacked a distinct plateau phase (Figure 7B). Layering 100 nM apamin and then 100 nM IbTX had little effect on the shape of the Ano1 fl/fl control APs (Figure 7C), whereas IbTX increased the peak potential and broadened the AP at the higher membrane potentials (Figure 7D). As expected, the AP frequency was significantly lower in the Ano1ismKO MIALVs compared to Ano1 fl/fl MIALVS and no effect of apamin or IbTX was observed (Figure 8A). Quantification of the AP parameters confirmed that neither 100 nM apamin nor 100 nM IbTX significantly changed Ano1 fl/fl AP minimum potential (Figure 8B), diastolic depolarization rate (Figure 8C), threshold potential of upstroke initiation (Figure 8D), peak spike potential (Figure 8E), AP upstroke velocity (Figure 8F), or duration of the AP (Figure 8G,H). Apamin was also without effect on the APs recorded from Ano1ismKO LMCs, but IbTX significantly increased peak spike potential (Figure 8E) and the duration of the AP over 0 mV (Figure 8G) without a significant change in the total duration of the AP (Figure 8H). We further confirmed these findings by recording membrane potential in WT MIALVs pretreated with 3 μM Ani9 and subsequently 100 nM IbTX. Similar to the APs in Ano1ismKO MIALVs, 100nM IbTX had no effect on AP frequency (6.76 ± 3.79 APs/min vs 7.32 ± 3.32), minimum potential (-34.6 ± 3.5 mV vs −35.8 ± 4.0 mV), threshold potential (-24.5 ± 3.2 mV vs −24.2 ± 4.6 mV), diastolic depolarization rate (0.74 ± 0.64 mV/s vs 1.00 ± 0.95 mVs/s), nor the fast upstroke velocity constant (τ) (25.7 ± 13.3 ms vs 24.5 ± 15.1 ms) in MIALVs treated with 3 μM Ani9 pre- and post-100 nM IbTX respectively. However, peak potential was significantly increased by 100 nM IbTX (5.33 ± 3.35 mV vs 11.5 ± 4.33 mV; p=0.005). Time over threshold was not different (0.42 ± 0.06 s vs 0.49 ± 0.06 s) nor did time over 0 mV reach statistical significance (0.03 ± 0.02 s vs 0.08 ± 0.04 s; p=0.058 comparing 3 μM Ani9 to 3 μM Ani9 + 100nM IbTX respectively). These experiments were performed in 5 mice, one vessel per mouse (n=5) and in many cases within the same cell pre- and post-IbTX and assessed by paired 2-tail t-test. The lack of significance for the time over 0 mV could be explained by incomplete inhibition of ANO1 by 3 μM Ani9. While 3 μM Ani9 can inhibit contraction frequency to a similar level as observed in Ano1ismKO MIALVs (Figure 5), it is likely that 3 μM Ani9 does not fully inhibit ANO1, especially at the high Ca²⁺ and membrane potential conditions achieved during the peak of the AP, and thus uninhibited ANO1 could still mediate early post-spike repolarization when BK is inhibited.

Figure 7.

Membrane potential recordings from MIALVs from Ano1 fl/fl and Ano1ismKO mice in response to layered application of apamin (100 nM) and IbTX (100 nM). MIALVs from Ano1 fl/fl and Ano1ismKO mice were pressurized to 3 cmH₂O, and spontaneous contractions blunted by a bolus of wortmannin (1–2 μM) to prevent the electrode from dislodging. Membrane potential of LMCs were recorded by sharp electrodes. Representative 12-second traces (A, B) overlaid by KCa inhibition were zoomed in (C, D) to compare AP shape. Traces reveal a stark contrast in AP shape between the two genotypes: Ano1ismKO LMCs exhibited a slow diastolic depolarization and a sharp spike AP that reaches +10 mV. This is in contrast to the small spike and hill AP in the Ano1 fl/fl control LMCs. IbTX had a dramatic effect on the shape of the Ano1ismKO AP shape as it increased peak potential and blunted repolarization, although IbTX did not have this effect on the APs recorded in Ano1 fl/fl LMCs. Apamin appeared to have little effect on the recorded AP shape in either group.

Figure 8.

AP characteristics of MIALVs from Ano1 fl/fl and Ano1ismKO mice in response to KCa inhibition. Analysis of recorded MIALV membrane potential under control (“C”) conditions, which includes contraction blunting by wortmannin (1–2 μM) and upon layered application of apamin (100 nM) (“A”) and then IbTX (100 nM) (“A+I”). The AP characteristics including AP frequency (A), minimum potential (B), diastolic depolarization rate (C), threshold potential (D), peak potential (E), upstroke velocity constant tau (F), and AP duration as assessed by time over 0 mV (G) and time over threshold potential (H) were assessed by 2-way repeated measures ANOVA. Tukey’s test was used to compare KCa inhibition conditions within a given genotype. n=5 Ano1 fl/fl, n=6 Ano1ismKO MIALVs (one vessel per animal). Mean and SD shown.

We next returned to the rat model to assess whether a similar activation of BK channels would occur with ANO1 inhibition by Ani9. Vm recordings of the pressurized RMLVs under control conditions also consisted of APs with a spike that consistently reached peak membrane potentials of 0 mV followed by a slight repolarization that gives way to depolarization into a “hill” or “plateau” (Figure 9A,C). Thus the rat APs had a post-spike “notch” in the AP waveform. Inhibition of BK channels with 100 nM IbTX altered the rat LMC AP waveform by increasing the spike height (Figure 9A) and abrogating the “notch” (Figure 9B). Subsequent layering of Ani9 altered the AP shape from a spike and plateau into a broad spike AP (Figure 9A). Using a second vessel from the same rat, 3 μM Ani9 was added first, prior to BK inhibition, which caused a dramatic change in the AP profile (Figure 9C): the “notch” became exaggerated and repolarized significantly (Figure 9D), and was followed by a second spike which was significantly more depolarized than the previous plateau potential (Figure 9E). Strikingly, 100 nM IbTX also completely removed the exaggerated “notch” into a similar single broad spike AP (Figure 9C). We further quantified other parameters of the APs recorded in response to 100 nM IbTX with or without Ani9 pretreatment. Surprisingly, the addition of IbTX increased AP frequency regardless of Ani9 pretreatment (Figure 10A). As in the mouse, neither IbTX nor apamin significantly altered the minimum membrane potential (Figure 10B), diastolic depolarization rate (Figure 10C), threshold potential (Figure 10D), or duration of the rat LMC AP as assessed by time over threshold (Figure 10G). In contrast to the mouse LMC AP, IbTX increased peak membrane potential under both control conditions and when ANO1 was inhibited by Ani9 (Figure 10E). Inhibition of SK channels with apamin also slightly increased peak potential (Figure 10E) in RMLVs that were pretreated with Ani9. Similarly, IbTX increased the time spent over 0 mV in RMLVs with or without Ani9 (Figure 10F), whereas apamin only increased time over 0 mV when Ani9 was present (Figure 10F).

Figure 9.

Sharp electrode LMC membrane potential recordings in pressurized RMLVs (3 cmH₂O) with or without pretreatment of Ani9, and subsequent inhibition of KCa channels with IbTX (100 nM) and then apamin (100 nM). Spontaneous contractions were blunted by wortmannin (1–2 μM) to prevent the electrode from dislodging. Representative 1-second traces of the resulting AP during the responses to their respective inhibitor (A, C). Each AP is numbered starting at 1 following each drug application and mixing to demonstrate the change in AP shape. RMLV APs had a spike followed by a repolarization phase that formed a “notch” (arrow in A) prior to stabilizing into a hill or plateau before fully repolarizing (A). IbTX (100 nM) abrogated the notch (A,B), while Ani9 (3 μM) exaggerated the notch (C,D) and altered the plateau into a second spike (C,E). Subsequent IbTX resolved the spike-notch-spike complex into a single spike AP. In the RMLVs that were not pretreated with Ani9, Ani9 was subsequently added at the end of the experiment to ensure that the AP shapes were similar regardless of drug order. AP notch characteristics (B, D, E) were analyzed by 2-tailed paired t-test. n=5 RMLVs for each with and without Ani9 pretreatment. Two vessels were used per animal (one for each drug sequence group). Mean and SD shown.

Figure 10.

AP characteristics of RMLVs in response to KCa inhibition, with or without prior ANO1 inhibition. Analysis of recorded membrane potential of pressurized RMLVs (3 cmH₂O) with pretreatment of Ani9 (3 μM) or without (Krebs alone, “K”), and upon layered application of apamin (100 nM) (“A”) and IbTX (100 nM) (“A+I”). Spontaneous contractions were blunted by wortmannin (1–2 μM) to prevent the electrode from dislodging. AP parameters for frequency (A), minimum potential (B), diastolic depolarization rate (C), threshold potential (D), peak potential (E), AP duration as assessed by time over 0 mV (F) and time over threshold (G) were assessed by 2-way repeated measures ANOVA. Tukey’s test was used to compare KCa inhibition conditions within a given pretreatment status. n=5 without Ani9 pretreatment, n=5 with Ani9 pretreatment. Two vessels were used per animal (one for each group). Mean and SD shown.

Discussion

The regulation of lymphatic muscle excitability and pacemaking remains an understudied topic with the specific contributions of many ions channels yet to be identified. Here, we provided greater context to the role of the Ca²⁺-activated K⁺ channels, particularly BK channels, in LMC ionic regulation. We showed that mouse LMCs express Kcnma1, the pore forming subunit that form tetrameric BK channels. Consistent with previous reports, inhibition of BK channels in either mouse or rat lymphatic collecting vessels had a negligible effect on lymphatic muscle contraction regulation under “physiological conditions”. However, when the Ca²⁺-activated Cl⁻ channel ANO1 was genetically deleted or pharmacologically inhibited, the conditions were sufficient in which BK channel function is appreciably enhanced and noticeably contributes to ionic regulation of the LMC AP. Under these conditions BK channels slightly inhibit lymphatic contractility by depressing the peak membrane potential achieved during the AP and participating in repolarization which ultimately reduce the contraction amplitude. This is presumably through limiting fulminant activation of the voltage-gated L-type Ca²⁺ channels which are required for lymphatic APs (Van Helden, 1993; Ferrusi et al., 2004) and determine contraction amplitude (Telinius et al., 2014b; To et al., 2020; Davis et al., 2022; Davis et al., 2023a). Increased BK activity could contribute to the mechanism underlying lymphatic contractile dysfunction in disease states, particularly as a recent study demonstrated BK involvement in NO-mediated inhibition lymphatic contractile function (Kim et al., 2021). Inflammation and NO production from iNOS expressing immune cells has been documented in metabolic disease states and as contributors to lymphatic contractile dysfunction (Liao et al., 2011; Torrisi et al., 2016; Zawieja et al., 2016; Kataru et al., 2020).

Functional BK activity in LMCs was first described by Cotton et al. 1997 in the seminal patch clamp studies of sheep mesenteric lymphatic vessels (Cotton et al., 1997). It was estimated that 90% of the outward current observed in the sheep mesenteric LMCs was via BK channels, based on current inhibition upon BK channel blockers IbTX and Penitrem A. However, the role of BK channels in the regulation of lymphatic muscle contractility and pacemaking in intact vessels is less clear. A previous study thoroughly assessed the role of the major multiple K⁺ channel families and their regulation on lymphatic vessel contractility using human thoracic duct vessels with wire myography. In that study, neither the SK channel blocker apamin nor the SK channel opener NS-309 had any effect on the human thoracic duct contractility (Telinius et al., 2014a). Similarly, we did not consistently see significant effects from inhibition of SK channels with apamin in our mouse contractile and electrophysiology studies. The lack of effect of apamin is not surprising as Kcnn1–4 transcript were not consistently identified in our RT-PCR of FACS-purified LMCs suggesting nonexistent or weak expression. However, our whole vessel profile showed expression of all SK1–4 channels though these are likely expressed in lymphatic endothelial cells, fibroblasts, and immune cells. Inhibition of SK channels in those cells could have downstream indirect effects on the LMC excitability. SK channel activity in blood vessel endothelial cells can regulate VMSC excitability through hetero-cellular myoendothelial junctions, such junctions are absent in lymphatic vessels (Castorena-Gonzalez et al., 2018; Hald et al., 2018) nor have hetero-cellular gap junctions between LMCs and non-LMC cells been detected (Briggs Boedtkjer et al., 2013). The study by Telinius et al. (Telinius et al., 2014a) also assessed the role of BK channels by inhibition with paxilline and activation by NS-1619. 10 μM paxilline increased contraction frequency but had no effect on contraction amplitude or baseline tension, the corollary to vessel tone, but surprisingly the BK channel activator NS-1619 had no effect on any parameter (Telinius et al., 2014a). While NS-1619 binds to the Kcnma1 (Slo1) alpha subunit to activate the BK channel, the alternatively spliced variant Slo1_9a does not respond to NS1619, which could explain the lack of effect in that study (Gessner et al., 2012). While we did not employ paxilline in in our experimental strategy (due in part to noted off target effects on SERCA (Bilmen et al., 2002), we did not observe a consistent effect of IbTX on contraction frequency except in the RMLV membrane potential recording experiments, which are performed in the presence of a low concentration of wortmannin. However, IbTX did significantly increased contraction strength as determined by amplitude and nSA when ANO1 was genetically ablated or pharmacologically inhibited. Admittedly, the increase in contraction amplitude when BK was inhibited under these conditions was small: contraction amplitude increased by 5 μm on average at 3 cmH₂O. This is a seemingly meager change in contractile output considering the dramatic change in the AP peak potential and the broadening of the AP peak we observed when IbTX was added in the Ano1ismKO MIALVs. In a few of our experiments, BK channel inhibition with IbTX resulted in a slight increase in vessel tone in some but this effect was not consistently significant. This likely suggests we are underpowered to fully account for that parameter’s biological variability and its sensitivity to technical variability. Tissue location differences may also explain the difference in BK channel activity in lymphatic vessel regulation of lymphatic pacemaking and contractility. A recent study using mouse popliteal lymphatic collecting vessels reported a significant increase in contraction frequency, but not amplitude, when BK was inhibited by either 300 nM IbTX or 100 nM Penitrem A. Additionally, contraction frequency, but not amplitude, was inhibited by the BK agonist NS11021with higher concentrations preventing contractions (Kim et al., 2021). NS11021 works by increasing the open probability and channel opening time independent of Ca²⁺ and even at negative voltages (Rockman et al., 2020). Thus in popliteal, inhibition of AP generation by NS11021 may occur at lower concentrations than would otherwise be required to inhibit contraction amplitude once an AP is initiated. In our study, the capability of BK channels to decrease contraction amplitude, albeit in a limited fashion, appears to be tied to whether ANO1 channels are present and functional.

A critical role for a Ca²⁺-activated Cl⁻ channel (CaCC) in lymphatic muscle excitability was initially postulated by the seminal work of Dirk van Helden and subsequently studies by Pierre von der Weid (Van Helden, 1993; von der Weid et al., 2008). ANO1 was recently identified as the canonical CaCC (Caputo et al., 2008; Schroeder et al., 2008; Yang et al., 2008) and was shown to be critical for normal lymphatic collecting vessel contractile function in both human and mouse cLVs (Mohanakumar et al., 2018; Zawieja et al., 2019; Zawieja et al., 2023). We have previously shown that the mouse LMC AP is dramatically regulated by ANO1, a finding which was recapitulated in this study as APs from Ano1ismKO or WT vessels treated with Ani9 have higher peak potentials and lack the characteristic AP plateau. Ca²⁺ imaging in our previous study on Ano1ismKO MIALVs also showed that peak Ca²⁺ during the AP was higher in magnitude but shorter in duration, mimicking the change in the AP shape in the present study (Zawieja et al., 2019). As BK channels are regulated independently by both Ca²⁺ and voltage (Cui et al., 1997; Horrigan & Aldrich, 2002), the loss of ANO1 results in an electrical and chemical environment permissive to BK channel activity during the AP. That the studies utilizing a BK agonist did not observe changes in the contraction amplitude lends further credence to the dominance of ANO1 in shaping the LMC AP. This is particularly true for the mouse AP, which lack the characteristic post-spike repolarization notch observed in both rat and human APs, and which may have lower BK expression in their LMCs compared to other mammals. To this point, we demonstrated that the “notch” in the rat LMC AP is driven by BK channel activity as it was lost in response to IbTX but exaggerated with Ani9 in the RMLVs we studied. To relate the rat LMC AP to the typical cardiac myocyte AP, BK channels are playing a role during both Phase 0 (participating in setting peak potential) and in the slight repolarization in Phase 1 similar to I_to, (transient outward). Although even in the RMLVs the contribution of BK is masked by ANO1. Ano1 also participates in setting the peak potential by limiting the degree of depolarization, but also prevents the excessive repolarization of the “notch” and ultimately is responsible for driving the AP plateau. This was readily demonstrated in Figure 9C where Ani9 application resulted in a spike-exaggerated notch-secondary spike/hill AP waveform. The simplest answer as to how ANO1 accomplishes each of these feats, which requires different directionality in ion flux, is that the Cl⁻ reversal potential (E_Cl) in LMCs is likely near to the voltage of the AP plateau. Presumably the plateau phase of the LMC AP is a consequence of the ANO1 clamping voltage to its E_Cl. While most reports of E_Cl in smooth muscle posit a value between −20 to −30 mV (Bulley & Jaggar, 2014), micro- and nano-domain structuring are likely capable of achieving the necessary local Cl⁻ concentrations to support such a depolarized E_Cl because LMCs express the Na⁺-K⁺-Cl⁻ transporter NKCC1 (Mohanakumar et al., 2018; Shelton et al., 2020). In some interstitial cells of Cajal populations, NKCC1 is also responsible for setting E_Cl near −11mV (Lees-Green et al., 2014; Zhu et al., 2016; Youm et al., 2019; Zheng et al., 2020). Lastly, in Ano1ismKO MIALVs inhibition of BK channels broadened the peak of the AP without dramatic effects on total AP duration. BK channel auxiliary subunits can determine voltage sensitivity (Zhang & Yan, 2014). The specific BK auxiliary subunits expressed in LMCs, if any, has yet to be explored, and may explain the seemingly lack of significant BK activity at the mouse LMC plateau potential of −10 mV to −11 mV.

It was recently shown that ANO1 is activated by Ca²⁺ released by IP3R1 channels during diastole to drive the diastolic depolarization (Hancock et al., 2023; Zawieja et al., 2023), however our results implicate BK activity during the AP when significant Ca²⁺ influx occurs through the L-type Ca²⁺ channels (Zawieja et al., 2018). The patch clamp study by Cotton et al 1997 also demonstrated that BK outward current was increased in response to the L-type channel activator BayK8644 and BK currents were abrogated in the presence of the L-type inhibitor nifedipine(Cotton et al., 1997). BK channels in VSMCs are commonly coupled to ryanodine receptors and activated by “Ca²⁺ sparks” (Nelson et al., 1995; Greenstein et al., 2020; Taylor et al., 2023). Further investigation is needed to determine whether BK channels are also coupled to ryanodine receptors (which can also release Ca²⁺ in response to Ca²⁺ influx through L-type channels) in LMCs, or if BK channels are responding directly to the Ca²⁺ influx from L-type channels.

One limitation of this study is that the Cre line used for the deletion of Ano1 is Y-linked. This precludes the use of females in the inducible genetic knockout approach, although female Ano1 fl/fl control mice were included. In future work, we plan to incorporate the recently-developed autosomal Myh11CreER^T2 line which will allow a deletion in both male and female mice (Deaton et al., 2023). Additionally, the rats in this study were also males, to allow for a more direct comparison to the mouse studies, but nonetheless the role sex plays in BK activation in LMCs remains to be addressed.

This study provides novel context of the contribution of BK channels in the regulation of lymphatic muscle excitability and contractility. We show that the contractile activity and AP waveform of lymphatic muscle in both mouse and rat are largely unaffected by BK or SK inhibition under control conditions. Loss of ANO1 dramatically alters the lymphatic AP profile in LMCs from mice and rats. In both cases, the contribution of the BK channels to the LMC AP becomes appreciable given the changes in the AP waveform following IbTX, but even still the changes are likely biologically insignificant to lymph transport. Though consistently observed, the increase in contraction amplitude following BK inhibition, while ANO1 was blocked or inhibited, was only a few μm in magnitude nor was it dramatic enough to consistently increase our calculated measure of lymph pumping (nPF). Changes in vessel tone in response to BK inhibition was inconsistent, neither did BK inhibition alter resting membrane potential to account for any change in tone, though IP3R1 activity appears to be the dominant regulator of MIALV tone (Zawieja et al., 2023). Regardless, the small magnitude of tone change would also be of little consequence to lymph flow.

In conclusion, our results provide further evidence for the foundational role ANO1 plays in the regulation of LMC excitability (Mohanakumar et al., 2018; Zawieja et al., 2019) as it is able to effectively mask the electrical consequences of BK channels. These findings will better inform existing computational models of the lymphatic action potential (Hancock et al., 2022; Hancock et al., 2023) and provides further that BK channels are a minor player amongst the K⁺ channels that determine LMC excitability and repolarization (Telinius et al., 2014a; Davis et al., 2020; Kim et al., 2021; Kim et al., 2023).

Key Points:

• Mouse and rat lymphatic muscle cells express functional BK channels.

• BK channels have little contribution to either rat or mouse lymphatic collecting vessel contractile function under basal conditions across a physiological pressure range.

• ANO1 limits the peak membrane potential achieved in the action potential and sets plateau potential limiting the voltage dependent activation of BK.

• BK channels are activated when ANO1 is absent or blocked and slightly impairs contractile strength by reducing the peak membrane potential achieved in the action potential spike and accelerating the post-spike repolarization.

Abbreviations:

ANO1

anoctamin 1

AP

action potential

BK

large-conductance Ca²⁺-activated K⁺

CaCC

Ca²⁺-activated chloride channel

cLV

collecting lymphatic vessel

FACS

fluorescence-activated cell sorting

IbTX

iberiotoxin

IK

intermediate-conductance Ca²⁺-activated K⁺

KCa

Ca²⁺-activated K⁺

LMCs

lymphatic muscle cells

MIALV

mouse inguinal axillary lymphatic vessel

NO

nitric oxide

RMLV

rat mesenteric lymphatic vessel

SK

small-conductance Ca²⁺-activated K⁺

Vm

membrane potential

VSMC

vascular smooth muscle cell

WT

wildtype

Biography

Rebecca Harlow is a PhD Student in Biomedical Sciences at Texas A&M University. Her research interests are physiological regulation and adaptation of lymphatic pump function and pacemaking.

Data Availability Statement

All study data are included in the article and in the supplemental statistical summary document.