Abstract
Background
We previously demonstrated that the human amniotic fluid (hAF) from II trimester of gestation is a feasible source of stromal progenitors (human amniotic fluid stem cells, hAFSC), with significant paracrine potential for regenerative medicine. Extracellular vesicles (EVs) separated and concentrated from hAFSC secretome can deliver pro-survival, proliferative, anti-fibrotic and cardioprotective effects in preclinical models of skeletal and cardiac muscle injury. While hAFSC-EVs isolation can be significantly influenced by in vitro cell culture, here we profiled EVs directly concentrated from hAF as an alternative option and investigated their paracrine potential against oxidative stress.
Methods
II trimester hAF samples were obtained as leftover material from prenatal diagnostic amniocentesis following written informed consent. EVs were separated by size exclusion chromatography and concentrated by ultracentrifugation. hAF-EVs were assessed by nanoparticle tracking analysis, transmission electron microscopy, Western Blot, and flow cytometry; their metabolic activity was evaluated by oximetric and luminometric analyses and their cargo profiled by proteomics and RNA sequencing. hAF-EV paracrine potential was tested in preclinical in vitro models of oxidative stress and dysfunction on murine C2C12 cells and on 3D human cardiac microtissue.
Results
Our protocol resulted in a yield of 6.31 ± 0.98 × 109 EVs particles per hAF milliliter showing round cup-shaped morphology and 209.63 ± 6.10 nm average size, with relevant expression of CD81, CD63 and CD9 tetraspanin markers. hAF-EVs were enriched in CD133/1, CD326, CD24, CD29, and SSEA4 and able to produce ATP by oxygen consumption. While oxidative stress significantly reduced C2C12 survival, hAF-EV priming resulted in significant rescue of cell viability, with notable recovery of ATP synthesis and concomitant reduction of cell damage and lipid peroxidation activity. 3D human cardiac microtissues treated with hAF-EVs and experiencing H2O2 stress and TGFβ stimulation showed improved survival with a remarkable decrease in the onset of fibrosis.
Conclusions
Our results suggest that leftover samples of II trimester human amniotic fluid can represent a feasible source of EVs to counteract oxidative damage on target cells, thus offering a novel candidate therapeutic option to counteract skeletal and cardiac muscle injury.
Keywords: Extracellular vesicles, Amniotic fluid, Paracrine effect, Oxidative stress, Cell viability, Metabolic dysfunction
Graphical abstract
Highlights
-
•
The human amniotic fluid (hAF) is a relevant source of extracellular vesicles (EVs).
-
•
hAF-EVs can deliver anti-oxidant effects.
-
•
hAF-EVs can improve cell bioenergetics.
-
•
hAF-EVs show metabolic profile with aerobic respiratory capacity.
-
•
hAF-EV content includes components related to antioxidant response pathways.
1. Background
Perinatal derivatives from extra-embryonic tissue are attracting increasing interest due to their regenerative potential against a variety of diseases. Mesenchymal stromal cells (MSC) from perinatal clinical waste (III trimester placenta membranes, umbilical cord, and amniotic fluid) or from leftover samples of prenatal screening (II trimester amniotic fluid from amniocentesis) have been proposed as alternatives over adult progenitors given their modulatory profile and high self-renewal capacity [[1], [2], [3]]. Moreover, being perinatal derivatives developmentally more immature, they have not been exposed to a lifetime of environmental stimuli (i.e. inflammaging) that may negatively affect their biological profile; besides, recent reports from preclinical and clinical studies suggest that they are safe and effective.
The human amniotic fluid (hAF) represents an easily exploitable source of progenitor cells which can be collected along pregnancy following amniocentesis procedures (as fetal human amniotic fluid-derived stem cells, hAFSC) or at term during scheduled C-section delivery (as perinatal hAFSC). hAFSC have shown remarkable paracrine potential in promoting tissue regeneration in several models of inflammatory-based or ischemic disease [[4], [5], [6], [7], [8], [9]]. Functional assays by our group and others indicated that extracellular vesicles (EVs) secreted by hAFSC (hAFSC-EVs) act as major conveyors of pro-survival, cardioprotective, neurotrophic, anti-inflammatory, and anti-fibrotic effects in different preclinical studies [7,8,[10], [11], [12], [13], [14], [15], [16], [17], [18], [19]]. EVs are membrane-bound nanoparticles with heterogeneous size distribution (from 50- up to 1000 nm) released by all cells; they act as mediators of intercellular signalling via the horizontal transfer to responder cells of their cargo enriched in bioactive molecules. As a matter of fact, MSC-EVs play pivotal roles in orchestrating different biological processes, including the modulation of the immune response and the activation of pro-resolving mechanisms driving tissue repair [20]. Since the EV content mirrors the paracrine profile of the parental cell, preconditioning strategies have been optimised to prime progenitor cells to enhance their regenerative potential. When stimulated in vitro by a short burst of hypoxia, hAFSC demonstrated to secrete EVs endowed with significant cardio-active profile [7,8,12]. Nevertheless, standardisation of the manufacturing of the hAFSC secretome, including EVs, is currently a matter of optimization. Therefore, here we investigated whether the II trimester hAF can represent an alternative appealing source of EVs with paracrine activity similar to hAFSC-EVs, thus offering an effortless and less time-consuming option for biotech and translational purposes.
The biological activity of hAF-EVs has been recently evaluated in preclinical models of murine neonatal hypoxic encephalopathy with relevant improvement of local angiogenesis [21], in inflammatory-related models with quenching of the T cell immune response [22] and in terms of modulation of the inflammasome activation in human monocytes [23]. Notably, a cell-free biological formulation of human term amniotic fluid enriched in EVs has been recently reported to significantly decrease inflammatory cytokine production in preclinical murine models of SARS-CoV-2 infection in vitro and in vivo [24]. Nevertheless, these promising results have been documented for III trimester hAF-EVs from clinical waste samples obtained by elective C-section procedures; currently, very little is known about the pro-resolving and regenerative capacity of more immature II trimester hAF-EVs.
Therefore, here we (i) validated a straightforward protocol to efficiently separate and concentrate EVs from leftover samples of II trimester hAF obtained during routine prenatal screening; (ii) provide their phenotypic characterization, and (iii) profile their paracrine potential in counteracting oxidative stress on responder cells and in restraining pro-fibrotic activation in vitro, two hallmarks of skeletal muscle and cardiac dysfunction with relevant clinical impact.
2. Material and methods
2.1. hAF-EVs separation and concentration
II trimester human amniotic fluid (hAF) samples were collected as leftover material via amniocentesis for routine prenatal screening donated for research purposes by healthy donors at IRCCS Istituto G. Gaslini in Genova, Italy. All patients provided informed written consent in accordance with specific authorization (P.R. 428REG2015 from Comitato Etico Regione Liguria) and in compliance with Helsinki Declaration ethical principles. hAF samples were obtained from 36.48 ± 0.64-year-old female healthy donors (n = 33 in total, with no prior history of oncological and/or infective diseases, including HIV and hepatitis infections) as validated for unaltered karyotype. hAF samples (4.33 ± 0.18 mL average volume) were subjected to centrifugation at 300×g for 5 min at room temperature to isolate cellular content. The supernatant was then further processed at 300×g for 10 min and then at 2000×g for 20 min at 4 °C to remove any remaining cellular debris. The supernatant was subsequently concentrated by means of ultrafiltration using 100 kDa selective cut-off membranes, according to manufacturer's instructions (Amicon Ultra-15 Centrifugal Filter, Merck Millipore) up to a final volume of 1 mL. The concentrated samples were stored at −80 °C until use. Size exclusion chromatography (SEC) was employed to isolate hAF-EVs by using IZON qEV original 70 nm columns (Izon Science). In accordance with manufacturer's guidelines, 1 mL of hAF was loaded onto the column and eluted with 1X Phosphate-buffered saline (PBS) solution. The hAF-EVs-enriched fractions were collected and concentrated by ultracentrifugation (UC) at 100,000×g for 120 min in an ultracentrifuge (Beckman Coulter Optima XPN-100; Beckman Coulter) with SW55Ti swinging bucket rotor. EV samples were then resuspended in sterile PBS solution for following analyses.
2.2. Characterization of hAF-EVs
hAF-EV size distribution and yield were determined by Nanoparticle Tracking Analysis (NTA, Nanosight NS300, Malvern Panalytical). Samples were acquired and recorded under a controlled continuous flow at 25 °C. For each measurement, 5 videos of 60 s were captured. Samples were characterised using NTA 3.2 software with a detection threshold equal to 5 as the ratio of total completed tracks over total valid tracks. EV morphological evaluation was performed by transmission electron microscopy (TEM) negative staining. hAF-EV samples were absorbed on a glow-discharged carbon-coated formvar copper grid and negatively stained with 2 % uranyl acetate. EV pictures were examined by a Talos L120C operating at 120 kV. Images were acquired with a Ceta CCD camera (all FEI, Thermo Fisher Scientific). Dimension distribution analysis was performed using ImageJ software (https://imagej.download.it/). Canonical expression of EV markers was analysed by Western Blot (WB) and flow cytometry. Samples were prepared following two different protocols, according to the specific marker to be evaluated. To define TSG101, Syntenin-1, ALIX and APO-B48 expression, hAF-EV and hAF samples were boiled at 95 °C with Laemmli SDS sample buffer 6X (VWR International, Dietikon), for 10 min; for CD63 and CD81 expression, hAF-EVs and hAF samples were mixed with Laemmli sample buffer 6X without SDS. Samples were then separated on 4–20 % Mini-PROTEANTGXTM Precast Gel, and transferred onto a PVDF membrane with a semi-dry transfer system (all from Bio-Rad Europe). Membranes were incubated with the following primary antibodies: anti-TSG101 (1:1000 ab125011); anti-Syntenin-1 (1:1000 ab19903); anti-ALIX (1:1000 ab186429); anti-APO-B48 (1:500 ab20737, all from Abcam); anti-CD63 (1:1000, 10628D, Invitrogen) and anti-CD81 (1:1000, 555675, Becton-Dickinson, BD). IRDye 680RD- or 800CW- goat anti-mouse or goat anti-rabbit secondary antibodies were then used (LI-COR Biosciences, LicorBio). Infrared signal was detected using an Odyssey CLx Detection System (LI-COR Biosciences). Concentrated hAF samples were used as comparative reference. CD9, CD63 and CD81 (JSR Life Science) expression was also investigated by flow cytometry (FC) as previously described [25]. 1 × 1010 hAF-EVs resuspended in 100 μL of PBS1X were incubated overnight at 10 °C and 400 rpm with 1 μL of CD9, CD63, and CD81 (JSR Life Sciences Ex-C9-SP; Ex-C63-SP; Ex-C81-SP; ratio 1:1:1) mixed beads, corresponding to 1.2 × 105 beads in total (for each test). After 24 h, 1 μL of 10 μg/mL of FITC-conjufìgated CD9 (Biolegend 312104) or 10 μg/mL of PE-conjugated CD63 (Biolegend 353004) or 5 μg/mL of PE-conjugated CD81 (Biolegend 349505) was added to 100 μL of hAF-EVs and bead-containing samples, which were then acquired (20000 events) with CytoFLEX (Beckman Coulter) and analysed using Kaluza software (Beckman Coulter). hAF-EVs samples underwent bead-based EVs immunocapture and were analysed by MACSPlex human Exosome Kit (Miltenyi Biotec), according to previously validated studies [26,27]; hAF-EVs were incubated with 37 fluorescently labelled capture bead populations, each coated with a specific antibody binding the respective surface epitope, and 2 control bead populations, followed by EVs detection reagent (i.e. fluorescently labelled antibodies for the canonical CD9/CD63/CD81 tetraspanin markers). Median fluorescence intensity (MFI) was measured on a MACSQuantAnalyzer10 flow cytometer (Miltenyi Biotec). All markers were analysed simultaneously. Surface epitope levels were referenced to EV-specific epitopes by subtracting the respective fluorescence values of blank control from MFI values for individual epitopes and normalizing them for CD9/CD63/CD81 MFI, reflecting EV concentration. Super-resolution microscopy was performed on a Nanoimager S Mark II microscope from ONI (Oxford Nanoimaging) using the EV profiler Kit (ONI) according to the manufacturer's protocol. The microscope was equipped with a 100x, 1.4NA oil immersion objective, an XYZ closed-loop piezo 736 stage, and triple emission channels split at 640, 488 and 555 nm. For EV characterization, the EV profiler Kit (ONI) was used following manufacturer's protocol. The Kit contains anti CD9-488, CD63-568 and CD81-647 fluorescent antibodies and all the buffers and reagents necessary for the experiment. The CD81-647 antibody was substituted with the anti-human HLA-G one conjugated with APC (Miltenyi Biotec). Images were performed in dSTORM mode and acquired sequentially in total reflection fluorescence (TIRF) mode. Single-molecule data was filtered using NimOS software (v.1.18.3, ONI). Data has been analysed with the Collaborative Discovery (CODI) online analysis platform (www.alto.codi.bio from ONI) and the drift correction pipeline version 0.2.3 was used [28].
2.3. Molecular profiling of hAF-EVs cargo
hAF-EVs samples were lysed and proteins denatured, reduced, and alkylated with 50 μL of iST-LYSE buffer (PreOmics) for 10 min at 95 °C on an Eppendorf ThermoMixer at 1000 rpm. Protein concentration in lysed samples was assessed by tryptophan fluorescence emission assay and 8 μg of protein lysates were used for subsequent analyses. Protein Aggregation Capture (PAC)-based protein isolation and digestion were performed on a KingFisher™ Apex magnetic handling station (Thermo Scientific) in a 96-well format. More in detail, 1:1 Sera-Mag™ SpeedBead Carboxylate Modified Magnetic Particles 45152105050250 and 65152105050250 (Cytiva) were added to lysed samples in plate #1 with a protein/bead ratio of 1:4 (w/w). 70 % ACN (v/v) was used to induce protein aggregation. After mixing, the solution was allowed to settle to precipitate proteins on beads (two cycles of 1 min of mixing at medium speed, followed by a 10 min pause each). Sequential washes with 100 % ACN (x3), 70 % ethanol and isopropanol (plates #2–6) were performed for 2.5 min at slow speed, without releasing the beads from the magnet. The captured proteins were then digested in 100 μL of 25 mM Tris, pH 8, with 0.7 μg trypsin (Promega) and 0.3 μg Lys-C (Wako) for 2.5 h at 37 °C in plate #7. Once the process was completed, the magnetic beads were removed from the digested samples and placed back into plate #1. Peptide mixtures were acidified using 2 % trifluoroacetic acid (TFA) to quench protease activity and desalted according to the in-StageTip (iST) method [29]. Eluted peptides were dried by vacuum centrifugation and resuspended in 2 % ACN, 0.1 % formic acid (FA) in water. Peptides were separated on an EASY-Spray PepMap RSLC C18 column (50 cm × 75 μm, 2 μm particle size, Thermo Scientific) using a 50 min gradient ranging from 2 % solution B (80 % ACN, 5 % dimethyl sulfoxide (DMSO), and 0.1 % FA) to 45 % B at a flow rate of 250 nL/min. The mass spectrometer was operated in positive polarity and data-independent acquisition (DIA) mode. Full scans (m/z 375–1500) were acquired in the Orbitrap at 70,000 resolution with the automatic gain control (AGC) target set to 3 × 106. Precursors were selected for data-independent fragmentation with an isolation window width of 34 m/z and 19 loop count. The higher collisional dissociation energy for MS/MS fragmentation was set to 27 %. MS2 scans were acquired at 35,000 resolution with 3 × 106 AGC target. Raw files were analysed by Spectronaut v18 (Biognosys AG) using a library-free approach (directDIA) under default settings. Enzymes/Cleavage Rules were set to Trypsin/P, LysC. The library was generated against the Uniprot Human database (release UP000005640_9606, November 2022). Carbamidomethylation was selected as a fixed modification, while methionine oxidation and N-terminal acetylation were selected as variable modifications. The false discovery rate (FDR) of peptide spectrum match (PSM) and peptide/protein groups was set to 0.01. For quantification, Precursor Filtering was set to Identified (Qvalue) and MS2 was chosen as quantity MS-level. Raw files were processed by Spectronaut v18 (Biognosys AG) using the directDIA search against the UniProt Human database (release UP000005640_9606, November 2022) under default settings.
Oximetric and luminometric analyses were performed on hAF-EVs permeabilized by 0.03 % digitonin. Oxygen consumption rate (OCR) was assayed by a thermostatically controlled oxygraph apparatus equipped with an amperometric electrode. ATP synthesis through FoF1-ATP synthase (ATP synthase) was evaluated by a luminometer, employing the luciferin/luciferase chemiluminescent method in the presence of the following solutions: 0.1 mM ADP, 0.6 mM ouabain, 0.25 mM di(adenosine)-5-penta-phosphate (an adenylate kinase inhibitor) [30]. Oxidative phosphorylation (OxPhos) efficiency was assessed by means of calculating the ratio between synthesized ATP and OCR (P/O value). In the presence of succinate as respiratory substrates, the P/O ratio around 1.5 indicates that ATP production and oxygen consumption are coupled, thus minimizing the reactive oxygen species (ROS) production. hAF-EVs samples were processed by QIAzol™ Lysis Reagent (Qiagen) suspension and RNA extraction was performed with miRNeasy Micro Kit (Qiagen). Whole-transcriptome RNA-sequencing (RNAseq) analysis was performed by Next-Generation Sequencing, using the Universal Plus™ Total RNAseq library preparation kit with NuQuant® with targeted transcript depletion with AnyDeplete (Tecan) for globin genes. The yields of final libraries were assessed by Qubit 4.0 fluorimeter, and their sizes were measured by 2100 Agilent Bioanalyzer (Agilent). The libraries were analysed by paired-end sequencing on NextSeq550 Illumina platform, 2 × 75bp. FASTQ files are available in the ArrayExpress database (www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-14034. Raw FASTQ sequences were processed with DRAGEN RNA v4.0.4 pipeline (Illumina) and genes quantification files were extracted. The comparison of individual gene expression levels used TPMs (Transcripts Per Million) as the measurement unit. A median value was computed for each gene across samples, and genes with expression levels below 1 TPM were excluded due to their potential as artifacts. The average of all gene medians was then calculated, and genes exhibiting a median expression higher than this threshold were selected for the enrichment analysis, which was performed through the freely available Enrichr tool (https://maayanlab.cloud/Enrichr/).
2.4. Analysis of hAF-EV paracrine potential in vitro
2.4.1. Cell culture
The mouse myoblast C2C12 cell line was purchased from Interlab Cell Line Collection (ICLC) and cultured at 37 °C and 5 % CO2 in high glucose Dulbecco's Modified Essential Medium (DMEM) medium with 10 % FBS, 2 % l-glutamine and 1 % penicillin/streptomycin (all EuroClone), as previously described [7]. Human 3D microtissue (hMT) was generated from human induced pluripotent cell (iPS)-derived cardiomyocytes (hCM), human cardiac fibroblast (hCF), and human aortic endothelial cells (hAEC) according to Ref. [31]. Briefly, hCM were obtained differentiating iPS cells as previously described [11]. hCF were derived from enzymatic digestion of leftover cardiac atrial appendage tissue samples obtained from patients with no significant coronary artery disease, undergoing heart surgery for aortic regurgitation. Cardiac tissue was donated for research purposes at Istituto Cardiocentro Ticino-EOC, Switzerland. All patients provided informed written consent in accordance with specific authorization (Comitato Etico Cantonale, Bellinzona, Switzerland; Ref.CE 2923) and in compliance with Helsinki Declaration ethical principles. hCF were obtained following enzymatic dissociation of the atrial specimens. Briefly, atrial specimens were minced and incubated for 45 min at 37 °C with a APS1X buffer containing 1 mg/mL Liberase™ (Roche). Obtained cells were cultured in EGM-2 complete medium, composed by EBMTM-2 Basal Medium and EGM TM-2 Single QuotsTM Supplements (CC-3156, Lonza). Lastly, hAEC were purchased from Lonza (CC-2535, Lonza) and cultured in EGM-2 complete medium supplemented with 10 % FBS. Human 3D microtissue (hMT), were obtained combining hCM, hCF and hAEC in the proportion of 1:0.2:0.2 (3500:750:750 cells) using low-binding BIOFLOAT™ 96-well plates (faCellitate). After a centrifugation at 1100 rpm for 5 min, hMT were further maintained in vitro in EGM-2 complete medium. Two days after plating hMT were spontaneously beating and used in vitro.
2.4.2. Preclinical models of oxidative stress
hAF-EVs pro-survival paracrine potential was evaluated on C2C12 cells undergoing 1 μM H2O2 oxidative stress. C2C12 were primed with 5 × 107 hAF-EVs particles/ml under serum-free conditions for 3 h. Oxidative stress and cellular damage were subsequently induced by administering 1 μM H2O2 for 2 h. Cells were then cultured in complete medium for 20 h. Cell viability was then assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using a 0.5 mg/mL MTT solution (Sigma-Aldrich) and absorbance read at 570 nm on a Biotek ELx808 Absorbance Microplate Reader with Biotek Gen5 2.03 software. Energy metabolism and oxidative damage accumulation were also evaluated on C2C12 cells in control conditions and undergoing oxidative stress with or without EV priming by assaying the aerobic ATP synthesis, the OCR, the lactate dehydrogenase (LDH) activity, and the malondialdehyde (MDA) concentration. The activity of ATP synthase was evaluated on 1 × 105 cells resuspended in PBS with 0.6 mM ouabain and 0.25 mM di(adenosine)-5-Penta-phosphate, and permeabilized with 0.03 mg/mL digitonin. The reaction was monitored with a luminometer employing the luciferin/luciferase chemiluminescent method, stimulating the cells with 10 mM pyruvate, 5 mM malate, and 0.1 mM ADP. OCR activity was measured on 1 × 105 digitonin-permeabilized cells resuspended in PBS by an amperometric electrode in a closed chamber, using 10 mM pyruvate and 5 mM malate as respiratory substrate. As for hAF-EVs, OxPhos efficiency was analysed by P/O value; in the presence of pyruvate plus malate, P/O ratio should be around 2.5 with energy production and respiration being coupled. Lactate dehydrogenase (EC 1.1.1.27) activity was assayed spectrophotometrically at 340 nm, following the NADH oxidation. The assay medium contained: 100 mM Tris–HCl pH 7.4, 0.2 mM NADH, and 5 mM pyruvate. MDA concentration was evaluated by the thiobarbituric acid reactive substance (TBARS) assay [32]. The TBARS solution was composed of 0.25 M HCl, 0.25 mM trichloroacetic acid, and 26 mM thiobarbituric acid. An amount of 50 μg of cell homogenate protein dissolved in 300 μL of Milli-Q water was added along with 600 μL of TBARS solution. For 1 h, the mixture was incubated at 95 °C and evaluated spectrophotometrically at 532 nm. MDA standard solutions with concentrations between 1 and 20 μM were employed for the calibration. hMT were pre-treated with 1 × 107 hAF-EVs/hMT for 3 h before exposing them to 1 mM H2O2 for 2 h hMT were then cultured in complete EGM2 medium for 24 h and analysed by CCK8 assay (Dojindo, Tabaru as per manufacturer's instructions).
To induce ROS production, hCF were treated with 10 ng/mL TGFβ1 (CYT-716, Prospect) for 3 h and then incubated with 1 μg/mL of dihydroethidium (DHE, Thermo Fisher Scientific) for 30 min at 37 °C. Live cells were then counterstained with Hoechst 33342 (1 μg/mL - Thermo Fisher Scientific). Images were acquired with Lionheart FX automated microscopy and analysed with Gen5 software (Biotek) to evaluate DHE mean fluorescent signal. To induce the pro-fibrotic activation of hCF into myofibroblasts, hMT were treated with 10 ng/mL TGFβ1 (CYT-716, Prospect) after being primed with 1 × 107 hAF-EVs/hMT and analysed after 7 days. hMT dimension was evaluated by bright field pictures. Images were acquired with Lionheart FX automated microscopy and analysed with Gen5 software (Biotek).
2.4.3. Uptake of hAF-EVs from target cells
hAF samples (500 μL) were labelled with 5 μL of the commercially available lipophilic near-infrared fluorescent cyanine dye DiR (2.5 mg/mL; Thermo Fisher Scientific) and incubated at 37 °C for 5 min under gentle shaking. hAF-EVs were then separated by SEC, thus helping eliminate the unbound dye in excess, and concentrated by UC, as described above in paragraph 2.1. C2C12 cells and hMT were incubated under serum-free conditions with DiR-labelled hAF-EVs and live images were acquired 24 h later using the automated microscope BioTek Lionheart FX (Biotek); acquisition was performed within a heated chamber (37 °C).
2.4.4. Biochemical and molecular analyses of target cells
hMT were fixed with 4 % PFA solution for 5 min at room temperature (RT). hMT were then permeabilized with 0.3 % Triton X (Triton X detergent, Sigma-Aldrich) and blocked in 2 % bovine serum albumin (BSA, Merck) in PBS for 40 min at RT, followed by a 5 min wash with PBS. hMT were incubated for two days at RT under slow agitation with the following primary antibodies: Cardiac Troponin T for hCM (cTnT, 1:300, 564766, BD Biosciences); Vimentin for hCF (1:500, ab92547, Abcam); and Cleaved-Caspase 3 (C-Casp3, 1:1000, Cell Signaling). hMT were then incubated with fluorophore-conjugated secondary antibodies for 24 h at RT (Alexa Fluor-488; Alexa Fluor-594 and Alexa Fluor-633, 1:400, Thermo Fisher Scientific) then included for imaging into chamber slide in 1 % low melt Agarose (H26417-14, Thermo Fisher Scientific). Samples were imaged on the Stellaris 5 Confocal Microscope (Leica) at 20X magnification and processed with ImageJ (https://imagej.download.it/) software. Same threshold was used for all the samples.
Total RNA from hMT was obtained using TRIzol™ (Thermo Fisher Scientific) following manufacturer's instructions. Obtained RNA was further transcribed into cDNA using GoScript™ Reverse Transcription System (Promega Madison) as for manufacturer's instructions. Real time qRT-PCR was then performed on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Fold change of Collagen I (COLL-I) gene expression was evaluated by 2−ΔΔCt method, considering human GAPDH as housekeeping reference and hMT in control conditions as calibrator. Primer sequences were the following: human COLL-I Forward: AGTGGTTTGGATGGTGCCAA Reverse: GCACCATCATTTCCACGAGC; human GAPDH forward: TGCACCACCAACTGCTTAGC Reverse: GCATGGACTGTGGTCATGAG.
2.5. Statistical analyses
Results are presented as mean with standard error of the mean (s.e.m) of at least three (n = 3) independent experiments as technical (C2C12 cell line) and biological (hAF-EVs, hMT and hCF) replicates. hAF-EV samples were tested as independent preparations, each obtained from a corresponding independent donor. According to normality analysis, comparisons were drawn by one-way ANOVA followed by post-hoc Tukey's multiple comparisons test, by Kruskal-Wallis non parametric test, and by Student's t-test where appropriate. Analyses were performed using Graph-Pad Prism Version 8.0.2 (GraphPad Software, https://www.graphpad.com) with statistical significance set at *p < 0.05. For proteomic analysis, the quantification data obtained from Spectronaut (Protein Quant Pivot Report) was imported into Perseus software version 1.6.15.0 [33]. To ensure data quality, protein groups with less than 70 % valid intensity values were filtered out. The raw intensities were then log2-transformed and normalized using quantile normalization to account for technical variations. Missing values were imputed with random numbers drawn from a normal distribution to simulate low abundance values close to noise levels. The quantified proteome was divided into five quantiles based on the median abundance of each protein. Enrichment analysis was performed on the most abundant proteins (top 5th quantile) using ShinyGO v0.80 [34] with statistical significance set at FDR <0.05 for biological processes and cellular components.
3. Results
3.1. hAF is enriched with small EVs with heterogeneous phenotype
hAF samples were processed by SEC followed by concentration of EVs by ultracentrifugation (Suppl Fig. 1A); hAF-EV yield was 6.31 ± 0.98 × 109 particles/hAF ml (Suppl Fig. 1B); EVs showed canonical round cup-shaped morphology and 209.63 ± 6.10 nm and 125.99 ± 54.31 nm average size by NTA and TEM analyses (Fig. 1A–B). hAF-EVs were found positive for the CD9, CD63 and CD81 tetraspanin signature (Fig. 1C–D). Expression of Syntenin-1, TSG101, and ALIX markers by WB further confirmed the enrichment of small EVs in the preparations with concomitant lack of ApoB-positive lipoprotein cross-contamination (Fig. 1D). hAF-EV phenotypic profile by MACSPlex assay showed a positive trend of enrichment for CD133/1, CD326, CD24, CD29 and SSEA4 (Fig. 1E). Single particle analysis by super‐resolution microscopy indicated 26.61 ± 5.26 % of small hAF-EVs co-expressing HLA-G on their surface, alongside CD9 and CD63 (Fig. 1F).
Fig. 1.
Characterization of hAF-EVs. A) Representative graphical output of hAF-EVs size distribution by nanoparticle tracking analysis; B) hAF-EVs morphology and ultrastructure analysis by TEM with representative image of hAF-EVs and evaluation of the particle distribution according to size (n = 3); scale bar: 500 nm; C) Flow cytometry analysis of hAF-EVs for the expression of the CD9, CD63 and CD81 tetraspanin antigens; graph shows the mean ± s.e.m value referring to each antigen expression MFI (n = 4); D) Representative cropped images of Western Blot analyses of hAF-EVs and hAF for the expression of the canonical EV markers Syntenin-1, TSG101, ALIX, CD81 and CD63 and for APO B48 as lipoprotein marker (n = 4); E) Immunophenotyping of hAF-EVs by flow cytometry and MacsPlex Assay for surface antigens profiling; the graph shows the mean ± s.e.m value referring to each antigen expression MFI (n = 6); F) Super-resolution microscopy analysis on hAF-EV for the expression of CD9, CD63 and HLA-G; the graph on the left shows the mean ± s.e.m value referring to the percentage of clusters positive for: triple expression of HLA-G, CD9 and CD63 and single expression of HLA-G or CD63 or CD9 (n = 5); representative images on the right represent single hAF-EV expressing CD63 (green), HLA-G (red), CD9 (magenta), scale bar: 200 and 100 nm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
3.2. hAF-EVs antagonise oxidative stress on target cells
C2C12 viability was significantly affected by H2O2 injury, as decreasing to 71.79 ± 3.08 % compared to control cells treated with vehicle solution (****p < 0.0001); hAF-EV stimulation did not alter cells in standard condition, while their priming before oxidative injury resulted in relevant rescue of viability up to 91.29 ± 12.84 % (*p < 0.05, Fig. 2A). Fluorescently DiR-labelled hAF-EVs (DiR + hAF-EVs) were uptaken by target C2C12 cells as analysed after 24 h incubation (Fig. 2B). C2C12 exposed to H2O2 stress presented metabolic alteration with impaired ATP synthesis and OCR with enhanced lactate dehydrogenase (LDH) activity and increased malondialdehyde accumulation (****p < 0.0001). hAF-EVs priming appreciably counteracted such signs of metabolic dysfunction (****p < 0.0001, Fig. 2C). A human 3D cardiac microtissue (hMT, [35]) culture system was also employed as in vitro preclinical model of cardiac oxidative stress. hMT were affected by oxidative stress as assessed by CCK8 assay, with hAF-EVs pre-treatment significantly rescuing their viability (****p < 0.0001, Fig. 2D). Immunostaining analysis for C-Casp3 further confirmed a relevant 2-fold increased expression (*p < 0.05) in hMT undergoing oxidative injury, while hAF-EVs stimulation promptly reduced the activation of cell death program to physiological levels (**p < 0.01, Fig. 2D). DiR + hAF-EVs were uptaken by target hMT as analysed after 24 h incubation (Fig. 2E).
Fig. 2.
hAF-EV paracrine potential against oxidative stress from H2O2injury. A) On the left: representative images of C2C12 cells under control conditions (Ctrl); after 2 h exposure to 1 μM H2O2 (H2O2), following 3 h treatment with hAF-EVs (hAF-EVs) and after being primed with hAF-EVs for 3 h and exposed to 1 μM H2O2 for 2 h (hAF-EVs + H2O2), scale bar: 200 μm. On the right: graph showing the mean ± s.e.m value referring to C2C12 viability with and without oxidative stress and hAF-EV priming by MTT assay (Ctrl: 100 %, n = 9; H2O2: 71.80 ± 3.10 %, n = 9; hAF-EVs + H2O2: 91.30 ± 3.71 %, n = 12; hAF-EVs: 89.30 ± 3.90 %, n = 12; ****p < 0.0001; *p = 0.0228 H2O2 versus hAF-EVs + H2O2). B) Representative images of hAF-EV uptake from target C2C12 cells in vitro; images were obtained on live cells visualized by means of phase contrast microscopy (Bright-field) while DiR + hAF-EVs were in red (CYN5); scale bar: 200 μm. C) Metabolic profile of C2C12 with and without oxidative stress (n = 8) and with hAF-EV priming (n = 12). The graphs show the mean ± s.e.m value of the following analyses: ATP synthesis by nmol ATP/min/106 cells (Ctrl: 53.91 ± 0.70; H2O2: 24.54 ± 0.70; hAF-EVs + H2O2: 49.15 ± 0.90; hAF-EVs: 52.80 ± 0.61; ****p < 0.0001; ***p = 0.0005 Ctrl versus hAF-EVs + H2O2; **p = 0.0032 hAF-EVs + H2O2 versus hAF-EVs, nmol: nanomoles, min: minutes); oxygen consumption rate (OCR) by nmol O/min/106 cells (Ctrl: 21.81 ± 0.34; H2O2: 12.41 ± 0.31; hAF-EVs + H2O2: 19.70 ± 0.92; hAF-EVs: 21.75 ± 0.30; ****p < 0.0001; *p = 0.0382 and p = 0.0241 for Ctrl versus hAF-EVs + H2O2and hAF-EVs + H2O2 versus hAF-EVs, respectively; O: oxygen) and P/O ratio (Ctrl: 2.45 ± 0.01; H2O2: 1.98 ± 0.01; hAF-EVs + H2O2: 2.41 ± 0.01; hAF-EVs: 2.43 ± 0.01; ****p < 0.0001); LDH activity by U/mg (Ctrl: 0.65 ± 0.01; H2O2: 1.30 ± 0.02; hAF-EVs + H2O2: 0.63 ± 0.01; hAF-EVs: 0.62 ± 0.01; ****p < 0.0001; U: units; mg: milligrams) and MDA activity by μM/mg (Ctrl: 4.10 ± 0.08; H2O2: 7.15 ± 0.15; hAF-EVs + H2O2: 4.71 ± 0.07; hAF-EVs: 3.86 ± 0.08; ****p < 0.0001; μM: micromolar; U: units; mg: milligrams). D) Viability analysis on hMT under control conditions (Ctrl), after 2 h exposure to 1 mM H2O2 (H2O2), following 3 h treatment with hAF-EVs (hAF-EVs) and after being primed with hAF-EVs for 3 h and exposed to 1 mM H2O2 for 2 h (hAF-EVs + H2O2). The graph on the left refers to the CCK8 viability assay showing the mean ± s.e.m value referring to hMT viability in fold change with and without oxidative stress and hAF-EVs priming (n = 7; Ctrl: 1.00 ± 0.01; H2O2: 0.84 ± 0.02; hAF-EVs + H2O2: 0.95 ± 0.01; ****p < 0.0001; *p = 0.0217). Panel on the right refers to cleaved Caspase-3 expression (C-Casp3) by hMT under control conditions (Ctrl), after 2 h exposure to 1 mM H2O2 (H2O2), following 3 h treatment with hAF-EVs (hAF-EVs) and after being primed with hAF-EVs for 3 h and exposed to 1 mM H2O2 for 2 h (hAF-EVs + H2O2) with representative images of immunohistochemical staining for cTnT-positive cardiomyocytes (green) and apoptotic C-Casp3-positive cells (red); nuclei are in blue by DAPI; scale bar: 50 μm. On the right graph showing mean ± s.e.m value of C-Casp3 area in percentage (Ctrl: 0.30 ± 0.02 %, n = 4; H2O2: 0.70 ± 0.13 %, n = 7; hAF-EVs + H2O2: 0.24 ± 0.03 %, n = 6; *p = 0.0374; **p = 0.0074); E) Representative images of hAF-EV uptake from hMT in vitro; images were obtained on live hMT visualized by phase contrast microscopy (Bright-field) while DiR + hAF-EVs were in red (CYN5); scal bar: 200 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
3.3. hAF-EVs prevent the pro-fibrotic commitment of target cells
H2O2-induced activation of cardiac fibroblast into pro-fibrotic myofibroblast in hMT was detected by a 2-fold increased expression of Collagen I mRNA; such effect was tamed down by hAF-EVs (*p < 0.05, Fig. 3A). We further confirmed that reactive oxygen species (ROS, detected by DHE) are released by hCF undergoing TGFβ stimulation for 3 h (*p < 0.05, Fig. 3B). We translated this finding to our 3D hMT model; hMT exposed to TGFβ over 7 days were remarkably smaller (****p < 0.0001), in agreement to Ref. [36]; treatment with hAF-EVs showed a trend in preventing their size condensation (Fig. 3C). TGFβ-stimulated hMT also presented a significant 1.8- and 2.5-fold increase of Vimentin- and αSMA-positive hCF over cTnT-positive cardiomyocytes, respectively (**p < 0.01, Fig. 3D; *p < 0.05, Fig. 3E). hMT receiving hAF-EVs showed substantial reduction of Vimentin-positive and αSMA-positive cells over cTnT-positive ones (*p < 0.05 and ****p < 0.0001 respectively, Fig. 3D–E).
Fig. 3.
hAF-EV paracrine potential against oxidative stress from pro-fibrotic activation. A) Real-time qRT-PCR analysis for Collagen 1 (COLL-1) expression over GAPDH as housekeeping. The graph shows the mean ± s.e.m fold change value of COLL-1/GAPDH of hMT with and without oxidative stress and hAF-EVs priming (n = 7; Ctrl: 1.00 ± 0.10; H2O2: 1.93 ± 0.39; hAF-EVs + H2O2: 0.91 ± 0.20; *p = 0.049 Ctrl versus H2O2; *p = 0.0292 H2O2 versus hAF-EVs + H2O2). B) Evaluation of ROS production by DHE assay on hCF with and without TGFβ treatment; the graph shows the mean ± s.e.m of fold change value (Ctrl: 1.02 ± 0.03, n = 15; TGFβ: 1.12 ± 0.02, n = 16; *p = 0.023). C) Evaluation of hMT size variation (Δ size in μm) cultured in control conditions (Ctrl), with TGFβ treatment (TGFβ) and with hAF-EV and TGFβ treatment (hAF-EVs + TGFβ) after 7 days (Ctrl: 22.30 ± 4.50, n = 21; TGFβ: −1.93 ± 3.20, n = 22; hAF-EVs + TGFβ: 5.63 ± 4.00, n = 13; ****p < 0.0001; *p = 0.0256; μm: micron). D) Immunohistochemical staining for Vimentin (VIM) over cardiac Troponin T (cTnT) expression within hMT cultured in control conditions (Ctrl), with TGFβ treatment (TGFβ) and with hAF-EV and TGFβ treatment (hAF-EVs + TGFβ); on the left: representative images showing cTnT-positive cardiomyocytes (green) and VIM-positive fibroblasts (red), nuclei are in blue by DAPI staining; scale bar: 50 μm; on the right, the graph shows the mean ± s.e.m of VIM/cTnT area in arbitrary units (Ctrl: 37.74 ± 3.36, n = 14; TGFβ: 73.68 ± 7.51, n = 21; hAF-EVs + TGFβ: 41.77 ± 4.35, n = 16; **p = 0.002; *p = 0.0476). E) Immunohistochemical staining for alpha smooth muscle actin (aSMA) over cardiac Troponin T (cTnT) expression within hMT cultured in control conditions (Ctrl), with TGFβ treatment (TGFβ) and with hAF-EV and TGFβ treatment (hAF-EVs + TGFβ); on the left: representative images showing cTnT-positive cardiomyocytes (green) and aSMA-positive myofibroblasts (red), nuclei are in blue by DAPI staining; scale bar: 50 μm; on the right, the graph shows the mean ± s.e.m of aSMA/cTnT area in arbitrary units (Ctrl: 2.90 ± 0.39, n = 18; TGFβ: 7.20 ± 1.20, n = 21; hAF-EVs + TGFβ: 0.80 ± 0.18, n = 10; *p = 0.0498; **p = 0.0085; ****p < 0.0001). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
3.4. hAF-EVs are enriched with functional molecular cargo
The identified proteins within hAF-EV cargo (n = 3351) were divided into 5 quantiles (Q1-5, Fig. 4A); biological process and cellular component gene ontology (GO) analyses of the 670 more expressed in Q5 suggested the presence of proteins involved in extracellular vesicle organization and transport (Supplementary Fig. 2), confirming EV identity. We also appreciated the presence of proteins related to different pathways involved in energetic metabolism (glycolysis, Krebs cycle, oxidative phosphorylation) and antioxidant response (glutathione metabolism, catalase, superoxide dismutase pathway, peroxiredoxin family, Fig. 4B and Table 1), thus suggesting EV protective role against oxidative stress. MSC-EVs have been previously shown to conduct aerobic metabolism [30,37]. Likewise, hAF-EVs undergoing OxPhos evaluation presented de novo ATP synthesis and oxygen consumption (Fig. 4C). Whole-transcriptome RNAseq analysis of hAF-EVs resulted in a total of 8558 RNA species with TPMs >1. We then performed enrichment analysis of the 633 transcripts with a TPMs level higher than total transcript median average (18.37 TPM). GO enrichment analysis for biological processes highlighted the presence of RNA species involved in ATP biosynthesis (Fig. 4D); GO for molecular function identified genes involved in the oxidoreduction-driven active transmembrane transporter activity (Fig. 4E), and KEGG analysis confirmed these data suggesting the presence of RNA involved in the oxidative phosphorylation (Fig. 4F and Table 2). This analysis also allowed the identification of different transcripts belonging to ribosomal constituents, in addition to few ribonucleoproteins.
Fig. 4.
Characterization of hAF-EV cargo. A) Heatmap of protein expression levels in hAF-EV samples (n = 6). The 3351 identified proteins are divided into five quantiles (Q1-Q5) based on their median log2 intensity, with Q1 representing the lowest and Q5 representing the highest values. B) Rank plot showing proteins detected in hAF-EVs (x-axis) ranked from highest to lowest median log2 protein abundance (y-axis). Proteins related to energy metabolism and antioxidant response are highlighted. C) Metabolic profile of hAF-EV samples (n = 6) in terms of ATP synthesis (523.97 ± 18.64 nmol ATP/min/mg), OCR (328.61 ± 13.63 nmol O/min/mg) and P/O (1.60 ± 0.03). D-F) Enrichment analysis from RNAseq of hAF-EV samples (n = 7) with enrichment analysis for GO biological process, GO molecular function and KEGG human gene ontology sorted by p-value ranking; arrows pointing at ATP biosynthetic process, oxidoreduction-driven active transmembrane transporter activity and oxidative phosphorylation. GO: gene ontology; Q: quantile; SOD: superoxide dismutase; OxPhos: oxidative phosphorylation; nmol: nanomoles; min: minutes; mg: milligrams; O: oxygen; KEGG: Kyoto encyclopaedia of genes and genomes.
Table 1.
List of proteins involved in different pathways involved in energetic metabolism and antioxidant response as identified within hAF-EVs by proteomic analysis.
| Glycolysis | PPP | Krebs Cycle | OxPhos | Glutatione metabolism | Catalase, SOD Pathway | Peroxiredoxin family |
|---|---|---|---|---|---|---|
| GAPDH | PGD | IDH1 | SDHB | GSTP1 | CAT | PRDX6 |
| PKM | TALDO1 | MDH1 | CYB5R3 | GSTO1 | SOD1 | PRDX2 |
| ENO1 | TKT | ACO1 | CYB5R2 | LANCL1 | PRDX5 | |
| PGK1 | PGLS | DLST | ATP5F1B | GSTA2 | TXNL1 | |
| TPI1 | RBKS | ACO2 | ATP5F1A | GPX3 | PXDN | |
| ALDOA | DERA | SUCLG2 | CYB561 | GSR | ||
| PGAM1 | SHPK | MDH2 | ETFB | GSS | ||
| GPI | G6PD | CS | ETFA | GSTM2 | ||
| ALDOB | RPIA | IDH2 | NDUFA6 | GSTT1 | ||
| PKLR | PDHB | COX7A2 | GSTM1 | |||
| PFKP | FH | NDUFV1 | HAGH | |||
| ALDOC | SLC25A1 | MT-CO2 | MGST2 | |||
| PFKL | SUCLG1 | NDUFS2 | GSTM3 | |||
| BPGM | IDH3G | SDHA | GPX1 | |||
| PFKM | IDH3A | ATP5PO | GCLC | |||
| TIGAR | NDUFS3 | GSTA4 | ||||
| HKDC1 | UQCR10 | GGT7 | ||||
| NDUFB10 | GSTK1 | |||||
| ATP5MC1 | ABCC1 | |||||
| SDHB | GSTT2 | |||||
| GSTCD | ||||||
| MGST3 | ||||||
| GSTM4 | ||||||
| GSTP1 |
Table 2.
List of genes identified by enrichment analysis for biological process, molecular function and KEGG human gene ontology in the hAF-EV cargo by RNA sequencing.
| ATP Biosyntetic Process (GO:0006754) | Oxidoreduction-Driven Active Transmembrane Transporter Activity (GO:0015453) | Oxidative Phosporylation |
|---|---|---|
| ATP5ME | COX7C | COX7C |
| ALDOA | COX4I1 | ATP5ME |
| ATP5MC2 | UQCRH | COX4I1 |
| ATP5MG | NDUFS5 | ATP5MC2 |
| ATP5MK | UQCRB | UQCRH |
| ATP5MF | COX6B1 | ATP5MG |
| ATP5PO | COX8A | UQCRQ |
| ATP5PD | NDUFB10 | NDUFS5 |
| ATP5F1A | NDUFA3 | UQCRB |
| ATP5F1D | COX5A | COX6B1 |
| ATP5F1C | NDUFB2 | COX8A |
| ATP5MJ | NDUFA1 | ATP6V1F |
| ATP5F1B | UQCR10 | ATP5MF |
| ATP5PF | COX5B | ATP5PO |
| NDUFB4 | ATP5PD | |
| COX7A2 | ||
| NDUFB10 | ||
| NDUFA13 | ||
| ATP5F1A | ||
| NDUFA3 | ||
| COX6C | ||
| ATP5F1D | ||
| COX5A | ||
| NDUFB2 | ||
| ATP6V0C | ||
| NDUFA1 | ||
| UQCR10 | ||
| ATP5F1C | ||
| COX5B | ||
| ATP5F1B | ||
| COX6A1 | ||
| NDUFB4 | ||
| ATP5PF |
4. Discussion
We previously characterised the paracrine therapeutic profile of secretome fractions from hAFSC obtained from leftover and clinical waste samples of hAF from II and III trimester of gestation. Immature hAFSC obtained from prenatal screening via routine amniocentesis procedure can exert relevant cardio-active effects by secreting pro-resolving and anti-aging EVs [8,38]. Nonetheless, the separation and concentration of secretome components from hAFSC require prolonged in vitro cell expansion and different steps for EV processing. Here we focused on profiling EVs directly concentrated from leftover samples of II trimester hAF as starting material, to assess their paracrine potential and whether they can offer a relevant alternative.
The hAF is a complex biofluid and it becomes enriched with heterogeneous metabolites during gestation [39,40] hAF composition reflects the changes during pregnancy, especially during the III trimester, due to the contribution of fetal urine and pulmonary, cardiovascular, renal, and endothelial secretions [41]. hAF-EVs represent a heterogeneous population from different contributions: placenta membranes, cells present in the amniotic fluid (including hAFSC), and cells deriving from the fetal pulmonary and gastrointestinal tract. The first evidence of hAF-EVs as diagnostic elements comes from a study in 2017 showing the procoagulant capacity of phosphatidylserine- and tissue factor-enriched hAF-EVs during amniotic fluid embolism driving disseminated intravascular coagulation [42]. Small EVs from hAF have been shown to act as informative biomarkers for antenatal hydronephrosis diagnosis, according to their moesin content [43] and to be dysregulated in their microRNA (miRNA) components in fetuses with congenital diaphragmatic hernia [44]. Likewise, III trimester hAF-EVs have been found functionally related to preeclampsia by means of increased expression of CD105 (endoglin), which may concur to anti-angiogenic effects [28].
To the best of our knowledge, here we present first-time evidence that II trimester hAF is enriched with EVs with paracrine potential in antagonising oxidative stress on target cells. By optimising EV separation from hAF, we obtain a relevantly high particle yield with canonical EV morphology and dimension. While we cannot identify a unique origin for II trimester hAF-EVs, we found a positive trend of the enrichment for CD133/1, CD326, CD24, CD29 and SSEA4 antigens in their phenotypic signature, implying a contribution from amniotic fluid and fetal urine [28], as well as by immature stem cells [45], including hAFSC [7]. Compared to III trimester hAF-EVs, our EVs showed limited placental inception as by HLA-G expression [28], thus suggesting fetal origin with less committed potential.
We have demonstrated that hAFSC secretome components, including hAFSC-EVs, are remarkably active in counteracting oxidative stress and exacerbation of fibrosis on cardiac cells and the myocardial tissue in preclinical models of disease [12,46]; here we investigated whether II trimester hAF-EVs may exert similar effects. II trimester hAF-EVs exerted cytoprotective potential on murine myoblasts exposed to H2O2 injury, similarly to what we initially reported for hAFSC-EVs on the same cell line in vitro [7], by means of metabolic rescue based on supporting ATP production and limiting activation of intracellular oxidative pathways. We confirmed these results on a human cardiac microtissue model, with relevant hAF-EVs trophic potential in preserving cell viability and counteracting oxidative injury, a hallmark of cardiac dysfunction. Notably, another read-out of cardiac injury triggered by oxidative stress is the commitment of fibroblasts into pro-fibrotic myofibroblasts [47]; myofibroblasts produce extracellular matrix components leading to fibrosis development and resulting into extensive scarring [48]. We confirmed that hAF-EVs can protect hMT against H2O2-dependent fibroblast activation as early as within the first 24 h. Moreover, myofibroblast activation by TGFβ stimulation is a well-known pathway [49] with one of the TGFβ-activated cascades being the oxidative stress [50]; in our 3D cardiac model of oxidative-related fibrosis, hAF-EVs promptly quenched the expansion of activated myofibroblasts to the detriment of the cardiomyocyte counterpart. Overall, this data suggests a therapeutically relevant paracrine role of hAF-EVs against the scarring process, possibly through prevention of oxidative stress induction.
hAF-EVs were also found expressing aerobic respiratory capacity, although with limited OxPhos efficiency; this may indicate that immature and “developmentally juvenile” EVs from early-mid gestation amniotic fluid may present significant potential in rescuing cell bioenergetics, thus counteracting oxidative stress leading to inflammaging. While previous studies indicated that human umbilical cord-MSC-EVs can express the respiratory complexes I, IV, and V able to conduct the OxPhos metabolism, functional ATP synthesis was detected only in EVs released from MSC obtained by term perinatal derivatives, hence indicating that gestational stage may impact on aerobic metabolism potential [30]. II trimester hAF-EVs seem not to be affected by any requirement for gestational maturation, thus representing candidate therapeutics to improve the energy metabolism of the injured cells. Indeed, hAF-EV characterization by proteomics and RNA sequencing further suggested a healing role against oxidative stress, with their cargo including components related to energetic metabolism, antioxidant response pathways, ATP synthesis, oxidoreduction-driven transmembrane transporter activity and OxPhos. Notably, While the hAF-EV morphological features are comparable to those of their cellular counterpart (as for II trimester hAFSC-EVs), we have appreciated a different proteomic profile. The II trimester hAFSC-EV proteome content that we previously characterized is enriched with molecular mediators involved in cardiovascular development, vascular remodelling and myocardial renewal, thus supporting their relevant cardioactive and cardioprotective paracrine role [38]. Here, the proteomic analysis of the hAF-EV cargo indicates protein elements involved in EV organization and transport along with mediators that may be involved in energetic metabolism signalling. While hAFSC-EVs may represent a more homogeneous population as obtained by in vitro cell culture and by hAFSC-conditioned medium as staring material, hAF-EV preparations may be enriched in vesicles secreted into the amniotic fluid by different cell sources (amniotic membrane progenitors, hAFSC in the amniotic fluid, fetal cells, etc.). Thus, their cargo may be more heterogeneous.
Recently, a few studies on the pro-regenerative angiogenic and anti-inflammatory potential of hAF-EVs separated from III trimester/term amniotic fluid obtained during scheduled C-section delivery procedures have been also reported [21,22,24]. From a translational perspective, III trimester hAF may offer a feasible source of EVs as future theranostic tools. Further analyses to provide a direct comparison of the paracrine effects of more immature II trimester hAF-EVs versus the perinatal III trimester ones are required to identify the source with the most relevant paracrine potential for different therapeutic applications according to the specific disease.
4.1. Conclusions
In this study we characterised EVs obtained by a straightforward protocol from leftover samples of early-mid gestation hAF from prenatal screening. hAF-EVs were able to improve the bioenergetics of injured cells via paracrine effects. These findings may support hAF-EVs as future candidate therapeutics against inflammatory-based dysfunction affecting the skeletal and cardiac muscle. Additional experiments are required to pinpoint the EV functional mechanism(s) of action by targeting molecular candidates within their cargo and to consolidate our findings in other relevant preclinical models of inflammation-related disease.
Supplementary Material
Supplementary Figuresare available in the Supplementary Material.
Ethics approval
All procedures were performed in compliance with relevant laws and institutional guidelines and have been approved by the appropriate institutional committee. The work described in this study has been carried out in compliance with the guidelines of the Declaration of Helsinki for the use of leftover and clinical waste samples of human amniotic fluid and human adult cardiac tissue as approved by the Regional Ethic Committees (Comitato Etico Regionale Liguria ref. P.R. 428REG2015 and Comitato Etico Cantonale, Bellinzona, Switzerland ref.CE 2923). Samples of human amniotic fluid and atrial specimens were obtained following written informed consent from donors. The patients/participants provided their written informed consent to donate the tissue for research purposes.
CRediT authorship contribution statement
Senesi Giorgia: Writing – original draft, Methodology, Investigation, Data curation. Guerricchio Laura: Writing – original draft, Methodology, Investigation, Data curation. Ghelardoni Maddalena: Writing – original draft, Methodology, Investigation, Data curation. Bertola Nadia: Formal analysis. Rebellato Stefano: Formal analysis. Grinovero Nicole: Data curation. Bartolucci Martina: Formal analysis. Costa Ambra: Methodology. Raimondi Andrea: Formal analysis. Grange Cristina: Formal analysis. Bolis Sara: Formal analysis. Massa Valentina: Formal analysis. Paladini Dario: Resources. Coviello Domenico: Resources. Pandolfi Assunta: Resources. Bussolati Benedetta: Resources. Petretto Andrea: Supervision, Data curation. Fazio Grazia: Supervision, Data curation. Ravera Silvia: Supervision, Data curation. Barile Lucio: Resources. Balbi Carolina: Writing – review & editing, Supervision, Project administration, Conceptualization. Bollini Sveva: Writing – review & editing, Supervision, Project administration, Conceptualization.
Declaration of competing interest
The authors have nothing to disclose nor competing interests to declare.
Acknowledgements
The Authors thank all the other members of their laboratory for their insight and technical support. Bertola N. N.B. has been supported by the Italian Ministry of Health (Ricerca Corrente) and the Italian Ministry of Health 5 × 1000 funds 2021. Rebellato S. is a fellow of the University of Milano-Bicocca, Milan, Doctoral Program in Molecular and Translational Medicine (DIMET). Prof. Lucio Barile obtained financial support from Swiss National Foundation, SINERGIA grant number 202302 and Gustav & Ruth Jacob Foundation, Lugano, (2023). This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
Footnotes
Supplementary data to this article can be found online at https://doi.org/10.1016/j.redox.2024.103241.
Contributor Information
Barile Lucio, Email: lucio.barile@eoc.ch.
Balbi Carolina, Email: carolina.balbi@uzh.ch.
Bollini Sveva, Email: sveva.bollini@unige.it.
Appendix ASupplementary data
The following are the Supplementary data to this article:
figs1.
figs2.
Data availability
Data will be made available on request.
References
- 1.Pozzobon M., D'Agostino S., Roubelakis M.G., Cargnoni A., Gramignoli R., Wolbank S., Gindraux F., Bollini S., Kerdjoudj H., Fenelon M., Di Pietro R., Basile M., Borutinskaite V., Piva R., Schoeberlein A., Eissner G., Giebel B., Ponsaert P. General consensus on multimodal functions and validation analysis of perinatal derivatives for regenerative medicine applications. Front. Bioeng. Biotechnol. 2022;10 doi: 10.3389/fbioe.2022.961987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Silini A.R., Di Pietro R., Lang-Olip I., Alviano F., Banerjee A., Basile M., Borutinskaite V., Eissner G., Gellhaus A., Giebel B., Huang Y., Janev A., Erdani Kreft M., Kupper N., Abadia-Molina A.C., Olivares E.G., Pandolfi A., Papait A., Pozzobon M., Ruiz-Ruiz C., Soritau O., Susman S., Szukiewicz D., Weidinger A., Wolbank S., Huppertz B., Parolini O. Perinatal derivatives: where do we stand? A roadmap of the human placenta and consensus for tissue and cell nomenclature. Front. Bioeng. Biotechnol. 2020;8 doi: 10.3389/fbioe.2020.610544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Papait A., Silini A.R., Gazouli M., Malvicini R., Muraca M., O'Driscoll L., Pacienza N., Toh W.S., Yannarelli G., Ponsaerts P., Parolini O., Eissner G., Pozzobon M., Lim S.K., Giebel B. Perinatal derivatives: how to best validate their immunomodulatory functions. Front. Bioeng. Biotechnol. 2022;10 doi: 10.3389/fbioe.2022.981061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bollini S., Cheung K.K., Riegler J., Dong X., Smart N., Ghionzoli M., Loukogeorgakis S.P., Maghsoudlou P., Dube K.N., Riley P.R., Lythgoe M.F., De Coppi P. Amniotic fluid stem cells are cardioprotective following acute myocardial infarction. Stem Cell. Dev. 2011;20:1985–1994. doi: 10.1089/scd.2010.0424. [DOI] [PubMed] [Google Scholar]
- 5.Zani A., Cananzi M., Fascetti-Leon F., Lauriti G., Smith V.V., Bollini S., Ghionzoli M., D'Arrigo A., Pozzobon M., Piccoli M., Hicks A., Wells J., Siow B., Sebire N.J., Bishop C., Leon A., Atala A., Lythgoe M.F., Pierro A., Eaton S., De Coppi P. Amniotic fluid stem cells improve survival and enhance repair of damaged intestine in necrotising enterocolitis via a COX-2 dependent mechanism. Gut. 2014;63:300–309. doi: 10.1136/gutjnl-2012-303735. [DOI] [PubMed] [Google Scholar]
- 6.Lazzarini E., Balbi C., Altieri P., Pfeffer U., Gambini E., Canepa M., Varesio L., Bosco M.C., Coviello D., Pompilio G., Brunelli C., Cancedda R., Ameri P., Bollini S. The human amniotic fluid stem cell secretome effectively counteracts doxorubicin-induced cardiotoxicity. Sci. Rep. 2016;6 doi: 10.1038/srep29994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Balbi C., Piccoli M., Barile L., Papait A., Armirotti A., Principi E., Reverberi D., Pascucci L., Becherini P., Varesio L., Mogni M., Coviello D., Bandiera T., Pozzobon M., Cancedda R., Bollini S. First characterization of human amniotic fluid stem cell extracellular vesicles as a powerful paracrine tool endowed with regenerative potential. Stem Cells Transl. Med. 2017;6:1340–1355. doi: 10.1002/sctm.16-0297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Costa A., Balbi C., Garbati P., Palama M.E.F., Reverberi D., De Palma A., Rossi R., Paladini D., Coviello D., De Biasio P., Ceresa D., Malatesta P., Mauri P., Quarto R., Gentili C., Barile L., Bollini S. Investigating the paracrine role of perinatal derivatives: human amniotic fluid stem cell-extracellular vesicles show promising transient potential for cardiomyocyte renewal. Front. Bioeng. Biotechnol. 2022;10 doi: 10.3389/fbioe.2022.902038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Villa F., Bruno S., Costa A., Li M., Russo M., Cimino J., Altieri P., Ruggeri C., Gorgun C., De Biasio P., Paladini D., Coviello D., Quarto R., Ameri P., Ghigo A., Ravera S., Tasso R., Bollini S. The human fetal and adult stem cell secretome can exert cardioprotective paracrine effects against cardiotoxicity and oxidative stress from cancer treatment. Cancers. 2021;13:3729. doi: 10.3390/cancers13153729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sedrakyan S., Villani V., Da Sacco S., Tripuraneni N., Porta S., Achena A., Lavarreda-Pearce M., Petrosyan A., Soloyan H., Filippo R.E.D., Bussolati B., Perin L. Amniotic fluid stem cell-derived vesicles protect from VEGF-induced endothelial damage. Sci. Rep. 2017;7 doi: 10.1038/s41598-017-17061-2. 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mellows B., Mitchell R., Antonioli M., Kretz O., Chambers D., Zeuner M., Denecke B., Musante L., Ramachandra D.L., Debacq-Chainiaux F., Holthofer H., Joch B., Ray S., Widera D., David A.L., Huber T.B., Dengjel J., De Coppi P., Patel K. Protein and molecular characterization of a clinically compliant amniotic fluid stem cell-derived extracellular vesicle fraction capable of accelerating muscle regeneration through enhancement of angiogenesis. Stem Cell. Dev. 2017;26:1316–1333. doi: 10.1089/scd.2017.0089. [DOI] [PubMed] [Google Scholar]
- 12.Balbi C., Lodder K., Costa A., Moimas S., Moccia F., van Herwaarden T., Rosti V., Campagnoli F., Palmeri A., De Biasio P., Santini F., Giacca M., Goumans M.J., Barile L., Smits A.M., Bollini S. Reactivating endogenous mechanisms of cardiac regeneration via paracrine boosting using the human amniotic fluid stem cell secretome. Int. J. Cardiol. 2019;287:87–95. doi: 10.1016/j.ijcard.2019.04.011. [DOI] [PubMed] [Google Scholar]
- 13.Gatti M., Zavatti M., Beretti F., Giuliani D., Vandini E., Ottani A., Bertucci E., Maraldi T. Oxidative stress in alzheimer's disease: in vitro therapeutic effect of amniotic fluid stem cells extracellular vesicles. Oxid. Med. Cell. Longev. 2020;2020 doi: 10.1155/2020/2785343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zavatti M., Gatti M., Beretti F., Palumbo C., Maraldi T. Exosomes derived from human amniotic fluid mesenchymal stem cells preserve microglia and neuron cells from aβ. Int. J. Mol. Sci. 2022;23:4967. doi: 10.3390/ijms23094967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Mezzasoma L., Bellezza I., Orvietani P., Manni G., Gargaro M., Sagini K., Llorente A., Scarpelli P., Pascucci L., Cellini B., Talesa V.N., Fallarino F., Romani R. Amniotic fluid stem cell-derived extracellular vesicles are independent metabolic units capable of modulating inflammasome activation in THP-1 cells. Faseb. J. 2022;36 doi: 10.1096/fj.202101657R. [DOI] [PubMed] [Google Scholar]
- 16.Gatti M., Beretti F., Zavatti M., Bertucci E., Ribeiro Luz S., Palumbo C., Maraldi T. Amniotic fluid stem cell-derived extracellular vesicles counteract steroid-induced osteoporosis in vitro. Int. J. Mol. Sci. 2020;22:38. doi: 10.3390/ijms22010038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Li B., Lee C., O'Connell J.S., Antounians L., Ganji N., Alganabi M., Cadete M., Nascimben F., Koike Y., Hock A., Botts S.R., Wu R.Y., Miyake H., Minich A., Maalouf A.F., Zani-Ruttenstock E., Chen Y., Johnson-Henry K.C., De Coppi P., Eaton S., Maattanen P., Delgado Olguin P., Zani A., Sherman P.M., Pierro A. Activation of wnt signaling by amniotic fluid stem cell-derived extracellular vesicles attenuates intestinal injury in experimental necrotizing enterocolitis. Cell Death Dis. 2020;11:750–752. doi: 10.1038/s41419-020-02964-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Antounians L., Catania V.D., Montalva L., Liu B.D., Hou H., Chan C., Matei A.C., Tzanetakis A., Li B., Figueira R.L., da Costa K.M., Wong A.P., Mitchell R., David A.L., Patel K., De Coppi P., Sbragia L., Wilson M.D., Rossant J., Zani A. Fetal lung underdevelopment is rescued by administration of amniotic fluid stem cell extracellular vesicles in rodents. Sci. Transl. Med. 2021;13:eaax5941. doi: 10.1126/scitranslmed.aax5941. [DOI] [PubMed] [Google Scholar]
- 19.Costa A., Quarto R., Bollini S. Small extracellular vesicles from human amniotic fluid samples as promising theranostics. Int. J. Mol. Sci. 2022;23:590. doi: 10.3390/ijms23020590. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Welsh J.A., Goberdhan D.C.I., O'Driscoll L., Buzas E.I., Blenkiron C., Bussolati B., Cai H., Di Vizio D., Driedonks T.A.P., Erdbrugger U., Falcon-Perez J.M., Fu Q.L., Hill A.F., Lenassi M., Lim S.K., Mahoney M.G., Mohanty S., Möller A., Nieuwland R., Ochiya T., Sahoo S., Torrecilhas A.C., Zheng L., Zijlstra A., Abuelreich S., Bagabas R., Bergese P., Bridges E.M., Brucale M., Burger D., Carney R.P., Cocucci E., Crescitelli R., Hanser E., Harris A.L., Haughey N.J., Hendrix A., Ivanov A.R., Jovanovic-Talisman T., Kruh-Garcia N.A., Ku'ulei-Lyn Faustino V., Kyburz D., Lässer C., Lennon K.M., Lötvall J., Maddox A.L., Martens-Uzunova E.S., Mizenko R.R., Newman L.A., Ridolfi A., Rohde E., Rojalin T., Rowland A., Saftics A., Sandau U.S., Saugstad J.A., Shekari F., Swift S., Ter-Ovanesyan D., Tosar J.P., Useckaite Z., Valle F., Varga Z., van der Pol E., van Herwijnen M.J.C., Wauben M.H.M., Wehman A.M., Williams S., Zendrini A., Zimmerman A.J., Consortium M.I.S.E.V., Théry C., Witwer K.W. Minimal information for studies of extracellular vesicles (MISEV2023): from basic to advanced approaches. J. Extracell. Vesicles. 2024;13 doi: 10.1002/jev2.12404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Li P., Lu X., Hu J., Dai M., Yan J., Tan H., Yu P., Chen X., Zhang C. Human amniotic fluid derived-exosomes alleviate hypoxic encephalopathy by enhancing angiogenesis in neonatal mice after hypoxia. Neurosci. Lett. 2022;768 doi: 10.1016/j.neulet.2021.136361. [DOI] [PubMed] [Google Scholar]
- 22.Del Rivero T., Milberg J., Bennett C., Mitrani M.I., Bellio M.A. Human amniotic fluid derived extracellular vesicles attenuate T cell immune response. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.977809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nunzi E., Mezzasoma L., Bellezza I., Zelante T., Orvietani P., Coata G., Giardina I., Sagini K., Manni G., Di Michele A., Gargaro M., Talesa V.N., Di Rienzo G., Fallarino F., Romani R. Microbiota-associated HAF-EVs regulate monocytes by triggering or inhibiting inflammasome activation. Int. J. Mol. Sci. 2023;24:2527. doi: 10.3390/ijms24032527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chanda D., Del Rivero T., Ghimire R., More S., Mitrani M.I., Bellio M.A., Channappanavar R. Acellular human amniotic fluid-derived extracellular vesicles as novel anti-inflammatory therapeutics against SARS-CoV-2 infection. Viruses. 2024;16:273. doi: 10.3390/v16020273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Balbi C., Bolis S., Vassalli G., Barile L. Flow cytometric analysis of extracellular vesicles from cell-conditioned media. J. Vis. Exp. 2019;144 doi: 10.3791/59128. [DOI] [PubMed] [Google Scholar]
- 26.Koliha N., Wiencek Y., Heider U., Jungst C., Kladt N., Krauthauser S., Johnston I.C.D., Bosio A., Schauss A., Wild S. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles. J. Extracell. Vesicles. 2016;5 doi: 10.3402/jev.v5.29975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wiklander O.P.B., Bostancioglu R.B., Welsh J.A., Zickler A.M., Murke F., Corso G., Felldin U., Hagey D.W., Evertsson B., Liang X., Gustafsson M.O., Mohammad D.K., Wiek C., Hanenberg H., Bremer M., Gupta D., Bjornstedt M., Giebel B., Nordin J.Z., Jones J.C., El Andaloussi S., Gorgens A. Systematic methodological evaluation of a multiplex bead-based flow cytometry assay for detection of extracellular vesicle surface signatures. Front. Immunol. 2018;9:1326. doi: 10.3389/fimmu.2018.01326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Gebara N., Scheel J., Skovronova R., Grange C., Marozio L., Gupta S., Giorgione V., Caicci F., Benedetto C., Khalil A., Bussolati B. Single extracellular vesicle analysis in human amniotic fluid shows evidence of phenotype alterations in preeclampsia. J. Extracell. Vesicles. 2022;11 doi: 10.1002/jev2.12217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kulak N.A., Pichler G., Paron I., Nagaraj N., Mann M. Minimal, encapsulated proteomic-sample processing applied to copy-number estimation in eukaryotic cells. Nat. Methods. 2014;11:319–324. doi: 10.1038/nmeth.2834. [DOI] [PubMed] [Google Scholar]
- 30.Panfoli I., Ravera S., Podesta M., Cossu C., Santucci L., Bartolucci M., Bruschi M., Calzia D., Sabatini F., Bruschettini M., Ramenghi L.A., Romantsik O., Marimpietri D., Pistoia V., Ghiggeri G., Frassoni F., Candiano G. Exosomes from human mesenchymal stem cells conduct aerobic metabolism in term and preterm newborn infants. Faseb. J. 2016;30:1416–1424. doi: 10.1096/fj.15-279679. [DOI] [PubMed] [Google Scholar]
- 31.Lisi V., Senesi G., Bertola N., Pecoraro M., Bolis S., Gualerzi A., Picciolini S., Raimondi A., Fantini C., Moretti E., Parisi A., Sgro P., Di Luigi L., Geiger R., Ravera S., Vassalli G., Caporossi D., Balbi C. Plasma-derived extracellular vesicles released after endurance exercise exert cardioprotective activity through the activation of antioxidant pathways. Redox Biol. 2023;63 doi: 10.1016/j.redox.2023.102737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bertola N., Degan P., Cappelli E., Ravera S. Mutated FANCA gene role in the modulation of energy metabolism and mitochondrial dynamics in head and neck squamous cell carcinoma. Cells. 2022;11:2353. doi: 10.3390/cells11152353. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tyanova S., Temu T., Sinitcyn P., Carlson A., Hein M.Y., Geiger T., Mann M., Cox J. The Perseus computational platform for comprehensive analysis of (Prote)Omics data. Nat. Methods. 2016;13:731–740. doi: 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]
- 34.Ge S.X., Jung D., Yao R.ShinyGO. A graphical gene-set enrichment tool for animals and plants. Bioinformatics. 2020;36:2628–2629. doi: 10.1093/bioinformatics/btz931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Campostrini G., Meraviglia V., Giacomelli E., van Helden R.W.J., Yiangou L., Davis R.P., Bellin M., Orlova V.V., Mummery C.L. Generation. Functional analysis and applications of isogenic three-dimensional self-aggregating cardiac microtissues from human pluripotent stem cells. Nat. Protoc. 2021;16:2213–2256. doi: 10.1038/s41596-021-00497-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Lee M., Jung K.B., Jo S., Hyun S., Moon K., Seo J., Kim S., Son M. Modelling cardiac fibrosis using three-dimensional cardiac microtissues derived from human embryonic stem cells. J. Biol. Eng. 2019;13:15–16. doi: 10.1186/s13036-019-0139-6. eCollection 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Bruschi M., Santucci L., Ravera S., Bartolucci M., Petretto A., Calzia D., Ghiggeri G.M., Ramenghi L.A., Candiano G., Panfoli I. Metabolic signature of microvesicles from umbilical cord mesenchymal stem cells of preterm and term infants. Proteonomics Clin. Appl. 2018;12 doi: 10.1002/prca.201700082. [DOI] [PubMed] [Google Scholar]
- 38.Costa A., Ceresa D., De Palma A., Rossi R., Turturo S., Santamaria S., Balbi C., Villa F., Reverberi D., Cortese K., De Biasio P., Paladini D., Coviello D., Ravera S., Malatesta P., Mauri P., Quarto R., Bollini S. Comprehensive profiling of secretome formulations from fetal- and perinatal human amniotic fluid stem cells. Int. J. Mol. Sci. 2021;22:3713. doi: 10.3390/ijms22073713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Underwood M.A., Gilbert W.M., Sherman M.P. Amniotic fluid: not just fetal urine anymore. J. Perinatol. 2005;25:341–348. doi: 10.1038/sj.jp.7211290. [DOI] [PubMed] [Google Scholar]
- 40.Suliburska J., Kocylowski R., Komorowicz I., Grzesiak M., Bogdanski P., Baralkiewicz D. Concentrations of mineral in amniotic fluid and their relations to selected maternal and fetal parameters. Biol. Trace Elem. Res. 2016;172:37–45. doi: 10.1007/s12011-015-0557-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bowen C.M., Ditmars F.S., Gupta A., Reems J., Fagg W.S. Cell-free amniotic fluid and regenerative medicine: current applications and future opportunities. Biomedicines. 2022;10:2960. doi: 10.3390/biomedicines10112960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hell L., Wisgrill L., Ay C., Spittler A., Schwameis M., Jilma B., Pabinger I., Altevogt P., Thaler J. Procoagulant extracellular vesicles in amniotic fluid. Transl. Res. 2017;184:12–20.e1. doi: 10.1016/j.trsl.2017.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Li J., Fu Y., Liu Q., Shen K., Yao R., Fu Y., Lu Y., Xie M., Jian W., Guo M., Dai L., Zhang W. Multiomics-based study of amniotic fluid small extracellular vesicles identified moesin as a biomarker for antenatal hydronephrosis. Clin. Transl. Med. 2023;13 doi: 10.1002/ctm2.1360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Fabietti I., Nardi T., Favero C., Dioni L., Cantone L., Pergoli L., Hoxha M., Pinatel E., Mosca F., Bollati V., Persico N. Extracellular vesicles and their miRNA content in amniotic and tracheal fluids of fetuses with severe congenital diaphragmatic hernia undergoing fetal intervention. Cells. 2021;10:1493. doi: 10.3390/cells10061493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Wang H., Gong P., Li J., Fu Y., Zhou Z., Liu L. Role of CD133 in human embryonic stem cell proliferation and teratoma formation. Stem Cell Res. Ther. 2020;11:208. doi: 10.1186/s13287-020-01729-0. 0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Balbi C., Lodder K., Costa A., Moimas S., Moccia F., van Herwaarden T., Rosti V., Campagnoli F., Palmeri A., De Biasio P., Santini F., Giacca M., Goumans M.J., Barile L., Smits A.M., Bollini S. Supporting data on in vitro cardioprotective and proliferative paracrine effects by the human amniotic fluid stem cell secretome. Data Brief. 2019;25 doi: 10.1016/j.dib.2019.104324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Aujla P.K., Kassiri Z. Diverse origins and activation of fibroblasts in cardiac fibrosis. Cell. Signal. 2021;78 doi: 10.1016/j.cellsig.2020.109869. [DOI] [PubMed] [Google Scholar]
- 48.Kurose H. Cardiac fibrosis and fibroblasts. Cells. 2021;10:1716. doi: 10.3390/cells10071716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Leask A. TGFbeta. Cardiac fibroblasts, and the fibrotic response. Cardiovasc. Res. 2007;74:207–212. doi: 10.1016/j.cardiores.2006.07.012. [DOI] [PubMed] [Google Scholar]
- 50.Liu R., Gaston Pravia K.A. Oxidative stress and glutathione in TGF-beta-mediated fibrogenesis. Free Radic. Biol. Med. 2010;48:1–15. doi: 10.1016/j.freeradbiomed.2009.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.







