Canthin-6-one analogs block Newcastle disease virus proliferation via suppressing the Akt and ERK pathways

Abstract

Newcastle disease virus, a member of the Paramyxoviridae family, causes significant economic losses in poultry worldwide. To identify novel antiviral agents against NDV, 36 canthin-6-one analogs were evaluated in this study. Our data showed that 8 compounds exhibited excellent inhibitory effects on NDV replication with IC₅₀ values in the range of 5.26 to 11.76 μM. Besides, these analogs inhibited multiple NDV strains with IC₅₀ values within 12 μM and exerted antiviral activity against peste des petits ruminants virus (PPRV) and canine distemper virus (CDV). Among these analogs, 16 presented the strongest anti-NDV activity (IC₅₀ = 5.26 μM) and minimum cytotoxicity (CC₅₀ > 200 μM) in DF-1 cells. Furthermore, 16 displayed antiviral activity in different cell lines. Our results showed that 16 did not affect the viral adsorption while it can inhibit the entry of NDV by suppressing the Akt pathway. Further study found that 16-treatment inhibited the NDV-activated ERK pathway, thereby promoting the expression of interferon-related genes. Our findings reveal an antiviral mechanism of canthin-6-one analogs through inhibition of the Akt and ERK signaling pathways. These results point to the potential value of canthin-6-one analogs to serve as candidate antiviral agents for NDV.

INTRODUCTION

Newcastle disease virus (NDV), belonging to the Paramyxoviridae family, has a nonsegmented single-stranded negative-sense RNA genome which encoding 6 structural proteins including the nucleoprotein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase protein (HN), and the large polymerase protein (L) (Ganar et al., 2014). Newcastle disease (ND), caused by the infection of virulent NDV, poses extensive economic losses in the poultry industry worldwide. So far, vaccination is the major method to control ND and no antiviral drugs are available for NDV (Song et al., 2015).

It is a well-established and efficient strategy to develop potential therapeutic agents based on natural products. The canthin-6-one alkaloid, mainly isolated from diverse plants such as the Rutaceae and Simaroubaceae families, is a subclass of the β-carboline alkaloid (Dai et al., 2016). Since 1952, more than 60 canthin-6-one alkaloids have been discovered and they were reported to have a broad range of biological activities including anticancer, antifungal, antiparasitic, and antiviral effects (Dai et al., 2016). In 2014, Dejos et al. reported that canthin-6-one showed an inhibitory effect on multiple cancer cell lines by interfering with the G2/M transition (Dejos et al., 2014). 9-Hydroxycanthin-6-one was reported to inhibit the Wnt/β-catenin pathway through the activation of GSK3β, and this inhibitory effect may be used in cancer therapies (Ohishi et al., 2015). Canthin-6-one has potential anti-inflammatory activity in LPS-stimulated macrophages by suppressing the Akt and NF-κB pathway (Cho et al., 2018). As for antiviral activities, more studies focused on β-carboline alkaloids. Previous studies found that the β-carboline alkaloids could inhibit various kinds of viruses such as tobacco mosaic virus (TMV), human immunodeficiency virus (HIV), herpes simplex virus (HSV), dengue virus (DENV), human papillomavirus (HPV), murine cytomegalovirus (MCMV), vesicular stomatitis virus (VSV) and so on (Hudson et al., 1986; Bag et al., 2014; Laine et al., 2014; Chen et al., 2015; Quintana et al., 2016). We found that three 1-formyl-β-carboline derivatives block NDV proliferation through interfering with the viral adsorption and entry processes (Wang et al., 2021). Besides, a bivalent β-carboline derivative inhibits macropinocytosis-dependent entry of pseudorabies virus (PRV) by targeting the dual-specificity tyrosine phosphorylation-regulated kinase 1A (Wang et al., 2023b). However, the activity and mechanism of canthin-6-one alkaloids inhibiting virus proliferation were rarely studied. Drymaritin, isolated from Drymaria diandra, showed anti-HIV activity with an IC₅₀ value of 0.699 μg/ml (Hsieh et al., 2004). In 2020, we found that 3 C-ring truncated canthin-6-one analogs showed an inhibitory effect on NDV proliferation with the effective concentrations on μM level, which enlightened us to investigate the anti-NDV activity of more canthin-6-one analogs (Wang et al., 2020).

Here, 36 canthin-6-one analogs were screened for antiviral activity against NDV. 16 was identified as the most effective inhibitor of NDV proliferation, Furthermore, we attempted to clarify the mechanism underlying the antiviral effect of canthin-6-one analogs in this study.

MATERIALS AND METHODS

Cells, Reagents, Viruses and Canthin-6-one Analogs

All the canthin-6-one analogs were synthesized as previously described (Dai et al., 2018a; Dai et al., 2018b). All compounds were dissolved to 100 mM in DMSO and their structures were presented in Table S1. DF-1, Vero, HeLa, and BHK-21 cells were cultured in high-glucose Dulbecco's modified Eagle's medium (Sigma-Aldrich, St. Louis，MO) supplemented with 10% fetal bovine serum (Gibco, Carlsbad，CA) at 37°C with 5% CO₂. The F48E9 strain (Accession number: MG456905; A velogenic strain of NDV), LaSota strain (Accession number: ON713864; A lentogenic strain of NDV), PPMV-1/SX-01/Ch/15 strain (Accession number: KX247376; A mesogenic strain of NDV), Blackbird/China/08 strain (Accession number: KC934169; A velogenic strain of NDV), and PPRV Nigeria75/1 strain (Accession number: KY628761) were provided by the College of Veterinary Medicine, Northwest A&F University (Yangling, China). CDV-11 was purchased from Qilu Animal Health (China).

Cytotoxicity Assay

Cell viability was assessed using a commercial CCK-8 kit (Solarbio, China) as previously described (Wang et al., 2023a).

Plaque Assay

Plaque assay was conducted as described previously (Wang et al., 2023a). Virus titers were calculated as plaque forming units (PFU)/mL.

Time of Addition Assay

DF-1 cells were cultured in 12-well plates prior to infection with F48E9 (MOI = 0.01). At designated time points post-infection, 16 was added to the cells at a final concentration of 100 μM. At 24 h post-infection, the cell culture supernatant was collected and subjected to plaque assay.

Virucidal Assay

NDV (5 × 10⁴ PFU/100 μL) was incubated with or without different concentrations of 16 (20, 50, and 100 μM) at 4°C for 1 h. After incubation, samples were diluted to a final virus titer of 50 PFU/100 μL. BHK-21 cells were infected with the samples (200 μL) described above. After 1 h of infection, cells were washed with phosphate buffer saline (PBS), and covered with medium-containing methyl cellulose. At 72 h post-infection, cells were fixed and stained with crystal violet solution for 30 min.

Adsorption Assay

The adsorption assay was conducted as described previously with some modifications (Wang et al., 2023a).

Entry Assay

The entry assay was conducted as previously described with some modifications (Wang et al., 2023b). Briefly, DF-1 cells were infected with F48E9 (MOI = 10) at 4°C for 1 h to allow viral adsorption. After that, viruses that had not entered were inactivated with a low pH buffer (40 mM Na citrate, 10 mM KCl, 135 mM NaCl, pH 3.0) and then incubated with 16 in the incubator. After 4 h of incubation, cell samples were subjected to western blot or immunofluorescence assay.

RNA Extraction and Quantitative Real-Time PCR

RNA isolation and quantitative real-time PCR (qPCR) were performed as previously described (Wang et al., 2023a). Samples were normalized to the quantity of 28S rRNA or GAPDH gene. The primers used in this study are listed in Table 1.

Table 1.

List of primers used in this study.

Gene name	Forward primer (5′-3′)	Reverse primer (5′-3′)
IFN-α	CAAAGCCTCCTCAACCGGAT	AGGCGCTGTAATCGTTGTCT
IFN-β	TTCTCCTGCAACCATCTTCGT	TGGCTGCTTGCTTCTTGTCC
MX1	AAGCCTGAGCATGAGCAGAA	TCTCAGGCTGTCAACAAGATCA
OASL	AGATGTTGAAGCCGAAGTACC	CTGAAGTCCTCCCTGCCTGT
CDV	TCTTTGAGGCGATTCATGGTG	AAACTCATGCAACCCAAGAGC
PPRV	CATTACCCGTTCAAGACTGCT	AACTACCTCAACAAGGCGGAT
F48E9	TCATGCCCAGCTACCTGTCG	CTGTTGGATTTCAGACCGCATC
28S rRNA
(DF-1)	GGTATGGGCCCGACGCT	CCGATGCCGACGCTCAT
GAPDH
(Vero)	TCCGACTTCAACAGCGACACC	TGTTGCTGTAGCCAAATTCGT

Immunofluorescence Assay

Immunofluorescence assay was conducted as described previously (Wang et al., 2023a). NDV NP monoclonal antibody (gifted by Chan Ding) was used at a 1:400 dilution. Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG (H1L) (Yeasen catalog number 33206ES60) was used at a 1:200 dilution. Actin filaments were stained with TRITC-phalloidin (2 μg/mL) for 30 min. Cell nuclei were stained with 1 μg/mL of DAPI for 10 min and images were analyzed using a confocal laser scanning microscope (Revolution WD, Andor).

Western Blot Analysis

Western blot was conducted as described previously (Wang et al., 2023a). The following antibodies were applied. NDV NP monoclonal antibody (gifted by Chan Ding) was used at a 1:1,000 dilution. β-Actin monoclonal antibody (Proteintech. catalog number 66009-1-Ig) was used at a 1:2,000 dilution. Phospho-Akt (p-Akt) monoclonal antibody (Proteintech. catalog number 66444-1-Ig) was used at a 1:1,000 dilution. Akt monoclonal antibody (Proteintech. catalog number 60203-2-Ig) was used at a 1:1,000 dilution. ERK1/2 polyclonal antibody (Proteintech. catalog number 11257-1-AP) was used at a 1:2,000 dilution. Phospho-ERK1/2 polyclonal antibody (Proteintech. catalog number 28733-1-AP) was used at a 1:1,000 dilution. Anti-rabbit IgG, HRP-linked antibody (Cell signaling technology. catalog number 7074) was used at a 1:2,000 dilution. Anti-mouse IgG, HRP-linked antibody (Cell signaling technology. catalog number 7076) was used at a 1:2,000 dilution.

Statistical Analysis

All treatments were applied in triplicate, and each experiment was independently repeated at least 3 times. Statistical analysis was performed using the Graphpad Prism Software v 6.0 (Graphpad Software, La Jolla, CA). All results were presented as the mean ± standard deviation (SD). The 2-tailed student unpaired t-test was used to determine statistical significance, as indicated by asterisks in the figures. ns, not significant; *P < 0.05; **P < 0.01; and ***P < 0.001.

RESULTS

Antiviral Activity of Canthin-6-one Analogs Against NDV

The modifying tactics of canthin-6-one analogs are presented in Figure 1A. Structures of all canthin-6-one analogs are concluded in Table S1. To determine the cytotoxicity of these compounds, DF-1 cells were treated with each compound at a concentration of 10 μM. At 72 h post-incubation, cell viability was detected using a CCK-8 kit. All compounds showed no cytotoxic effect at 10 μM (Figure 1B). Thus, the preliminary screening of the antiviral activity of these compounds was evaluated in DF-1 cells at the concentration of 10 μM. DF-1 cells infected with F48E9 (a velogenic strain of NDV) were treated with each compound and incubated for 24 h. Then, cell culture supernatant was harvested and determined by plaque assay. Meanwhile, cells were harvested and the viral mRNA expression was determined by qPCR. The standard of an active compound was one that exhibited ≥ 50 % reduction compared to DMSO-treated cells. As shown in Figures 1C and 1D, 8 compounds (7, 11, 15, 16, 20, 22, 34, 36) met this standard. The IC₅₀ and CC₅₀ values of these effective compounds were determined and selectivity index (SI) values were calculated as the ratio of CC₅₀ to IC₅₀. As shown in Table 2, all IC₅₀ values were lower than 12 μM. Compared to the positive control ribavirin, 16 and 34 exhibited superior activity, with IC₅₀s at 5.26 μM and 6.32 μM, respectively. Among these canthin-6-one derivatives, 16 and 22 exhibited extremely low cytotoxicity with CC₅₀ higher than 200 μM, and 16 showed the highest SI value (> 38). In addition, 3 NDV strains including Blackbird/China/08 (velogenic, genotype IX), PPMV-1/SX-01/Ch/15 (mesogenic, genotype VI), and La Sota (lentogenic, genotype II), were used to evaluate the antiviral activity of 8 derivatives. The results revealed that 8 derivatives displayed antiviral activity against various genotypes of NDV with IC₅₀ values in the range of 4.34 to 11.81 μM (Table 3). Furthermore, we attempted to investigate whether these derivatives might exhibit antiviral activity against other paramyxoviruses beyond that against NDV infection. All these analogs showed no cytotoxic effect on Vero cells at 10 μM (Figure S1). Thus, Vero cells were infected with peste des petits ruminants virus (PPRV, belongs to the Paramyxoviridae family) or canine distemper virus (CDV, belongs to the Paramyxoviridae family) and treated with 8 derivatives at 10 μM. At 24 h post-infection, cells were harvested and viral mRNA was detected by qPCR. As expected, 8 derivatives also exerted antiviral activity against PPRV and CDV with inhibitory rates higher than 50%. Inspiringly, 16 also possessed superior activity with an inhibitory rate higher than 90% (Figure S2). Therefore, we chose compound 16 for further study because of its low cytotoxicity and strong antiviral activity.

Figure 1.

Antiviral activity of canthin-6-one analogs against NDV. (A) The modifying tactics of canthin-6-one analogs. (B) DF-1 cells were incubated with each compound at 10 μM. At 72 h post-incubation, the cell viability was determined using a CCK-8 kit. (C, D) DF-1 cells were infected with F48E9 (0.01 MOI). After 1 h of adsorption, cells were covered with DMEM containing each compound (10 μM). At 24 h post-infection, the virus yield in the supernatant was measured by a plaque assay (C). The relative mRNA expression was measured by qPCR (D). The data represent the mean ± SD of 3 independent experiments. The statistical significance was analyzed using a 2-tailed Student's t-test: ^⁎⁎⁎P < 0.001.

Table 2.

The CC₅₀, IC₅₀ and SI values of canthin-6-one analogs.

No.	CC501 (μM)	IC502 (μM)	SI3
7	32.72 ± 4.37	9.34 ± 1.51	3.5
11	175.43 ± 9.42	10.58 ± 0.84	16.6
15	65.19 ± 4.71	11.54 ± 1.19	5.6
16	>200	5.26 ± 0.44	>38.0
20	27.59 ± 3.11	11.76 ± 1.73	2.3
22	>200	9.22 ± 0.97	>21.7
34	32.37 ± 2.67	6.32 ± 0.66	5.1
36	62.18 ± 8.24	8.95 ± 0.98	6.9
Ribavirin	-	8.62 ± 1.44	-

¹ DF-1 cells were treated with different concentrations of each compound at 37 °C for 72 h. The cell viability was determined by a CCK-8 kit, and CC₅₀ values were calculated (mean ± SD).

² DF-1 cells, infected with F48E9 (MOI = 0.01), were treated with different concentrations of each compound for 24 h. Supernatants were harvested to determine the virus production by a plaque assay. IC₅₀ values were calculated (mean ± SD).

³ Selectivity index; SI = CC₅₀/IC₅₀.

Table 3.

The IC₅₀ values of canthin-6-one analogs (μM).

No.	Blackbird/China/08(IX)	PPMV-1/SX-01/Ch/15(VI)	La Sota (II)
7	8.57 ± 1.75	10.22 ± 1.24	9.27 ± 1.71
11	8.15 ± 1.18	11.81 ± 1.81	10.63 ± 0.85
15	10.58 ± 1.67	9.56 ± 0.62	8.65 ± 0.74
16	4.78 ± 0.56	4.34 ± 0.93	5.86 ± 0.82
20	9.45 ± 1.90	11.12 ± 1.35	10.13 ± 1.77
22	9.94 ± 1.21	8.71 ± 0.89	9.42 ± 1.59
34	6.17 ± 0.58	6.96 ± 0.47	7.39 ± 1.48
36	7.82 ± 1.05	9.38 ± 1.15	8.49 ± 0.61
Ribavirin	10.41 ± 2.85	11.62 ± 2.13	7.97 ± 1.59

DF-1 cells, infected with different genotypes of NDV (MOI = 0.01), were treated with different concentrations of each compound for 24 h. Supernatants were harvested to determine the virus production by a plaque assay. IC₅₀ values were calculated (mean ± SD)

The structure of 16 is presented in Figure 2A. Several experiments were conducted to characterize the anti-NDV activity of 16. As shown in Figures 2B to 2E, NDV proliferation was inhibited by 16 in a dose-dependent manner. NDV infection-induced cytopathic effect was alleviated upon the treatment of 16 (Figure 2B). In the presence of 100 μM 16, viral mRNA was reduced by 99.75% (Figure 2C). Likewise, the expression level of NP was significantly reduced by 16 (Figure 2D). In the presence of 100 μM 16, the viral titer was reduced by 3.70 Log compared to the cells treated with DMSO (Figure 2E). 16 also exerted the inhibitory effect until 36 h post-infection (Figures 2F and 2G). Besides, in the presence of 16, the viral protein expression of various NDV strains was suppressed, detected by western blot (Figure 2H). Consistent with this observation, 16-treatment reduced the viral titers of La Sota, SX01, and Blackbird08 (reduced by 3.18, 3.74, and 3.97 Log, respectively; Figure 2I). To confirm whether the antiviral effect was cell line specific, Vero, BHK-21, or HeLa cells were infected with F48E9 (MOI = 0.01) and then incubated with 100 μM 16. After 24 h of infection, viral particles in supernatant and viral protein were determined by plaque assay and western blot, respectively. As shown in Figure 2J, 16 could inhibit the viral protein expression in 3 cell lines. This 16 remarkably reduced the viral titer in Vero, BHK-21, and HeLa cells (reduced by 2.62 Log, 3.21 Log, and 3.26 Log, respectively; Figure 2K). Altogether, these results demonstrate the excellent antiviral activity of 16 against NDV.

Figure 2.

The antiviral effect of 16 against NDV. (A) The structure of compound 16. (B–E) DF-1 cells were infected with F48E9 (0.01 MOI) and then incubated with the indicated concentrations of 16. At 24 h post-infection, the cytopathic effect was photographed (B). Scale bars, 200 μm. The relative mRNA expression was measured by qPCR (C). Cells were harvested and cell lysates were analyzed for NP and β-actin expression by western blot (D). NDV NP antibody was used at a 1:1,000 dilution. β-Actin antibody was used at a 1:2,000 dilution. The supernatant was harvested and subjected to plaque assay to analyze virus titer (E). (F, G) DF-1 cells infected with F48E9 (0.01 MOI) were incubated with 16 (100 μM). At 12, 24, and 36 h post-infection, cells were harvested and cell lysates were analyzed for NP and β-actin expression by western blot (F). The supernatant was harvested and subjected to plaque assay to analyze virus titer (G). (H, I) DF-1 cells were infected with the indicated NDV strains (0.01 MOI) and then treated with 16 (100 μM). At 24 h post-infection, the viral protein expression was analyzed by western blot (H). The virus titer was determined by plaque assay (I). (J, K) Vero, BHK-21, or HeLa cells were infected with F48E9 (0.01 MOI) and then treated with 16 (100 μM). At 24 h post-infection, the viral protein expression was analyzed by western blot (J). The virus titer was determined by plaque assay (K). The data represent the mean ± SD of 3 independent experiments. The statistical significance was analyzed using a 2-tailed Student's t-test: ^⁎P < 0.05; ^⁎⁎P < 0.01; ^⁎⁎⁎P < 0.001.

Mode of Antiviral Action of 16 Against NDV

To determine which stage of NDV life cycle is targeted by 16, a series of experiments were conducted. First, the time of addition assay was conducted. At different time points post-infection, 16 (100 μM) was added and the supernatant was harvested at 24 h post-infection (Figure 3A, upper). The results showed that when the 16 was added at 0, 2, 4, and 6 h post-infection, virus yield in supernatant was significantly reduced. When 16 was added at 12 h or 18 h post-infection, the viral titer was reduced by 2.48 Log or 0.94 Log, respectively (Figure 3A, lower). Then we determined whether 16 has the virucidal effect or hinders the early stage (including adsorption and entry processes). The treatment and NDV infection schemes are shown in Figure 3B. The virucidal effect of 16 against NDV virions was determined by treating the virus with 16 at indicated concentrations (20, 50, and 100 μM) at 4 °C for 1 h. At these concentrations, no virucidal effect was observed (Figure 3C). Meanwhile, an adsorption assay was conducted. Pre-chilled DF-1 cells were treated with 16 for 1 h and then infected with NDV (100 PFU). After adsorption at 4 °C for 1 h, the unbound viruses were washed away and adsorbed virus particles were calculated. As shown in Figure 3D, 16 showed no effect on virus adsorption. In order to illustrate whether 16 interferes with the entry process, DF-1 cells infected with F48E9 (10 MOI) were incubated with 16. At 4 h post-incubation, the viral protein was detected by western blot and immunofluorescence assay. As shown in Figure 3E, when cells were treated with 16, the expression of NP protein was decreased in a dose-dependent manner (0.83 ± 0.03, 0.49 ± 0.04, 0.33 ± 0.03, 0.25 ± 0.03 for mock and 20, 50, or 100 μM 16-treated samples, respectively). As shown in Figure 3F, green fluorescence was significantly reduced in the presence of 100 μM 16, compared to the cells treated with DMSO. Dynasore was used as a positive control in this assay. These results suggest that 16 inhibits the entry of NDV into DF-1 cells.

Figure 3.

The 16 inhibits the entry of NDV into DF-1 cells. (A) DF-1 cells were infected with F48E9 (0.01 MOI) and then treated with 16 (100 μM) at the indicated time points post-infection. The virus titer in the supernatant was measured by plaque assay at 24 h post-infection. (B) Compound treatment and NDV infection schemes in the virucidal, adsorption, and entry assay. (C) DF-1 cells were infected with pre-treated F48E9 (100 PFU). After 1 h of infection, cells were washed and covered with the medium containing methylcellulose. At 72 h post-infection, the virus yield was analyzed. (D) DF-1 cells were incubated with 16 prior to F48E9 infection (100 PFU). At 1 h post-infection, the cells were washed and covered with the medium containing methylcellulose. At 72 h post-infection, the virus yield was analyzed. (E, F) DF-1 cells were infected with F48E9 (10 MOI) at 4°C for 1 h. Unbound viruses were washed by the low pH buffer. Next, cells were supplemented with the medium containing 16. At 4 h post-infection, the viral protein was measured by western blot (E; NP antibody, 1:1,000 dilution; β-Actin antibody, 1:2,000 dilution) or immunofluorescence (F; NP antibody, 1:400 dilution). The data represent the mean ± SD of 3 independent experiments. The statistical significance was analyzed using a 2-tailed Student's t-test: ns, not significant; ^⁎P < 0.05; ^⁎⁎P < 0.01; ^⁎⁎⁎P < 0.001.

16 Inhibits the Virus Entry by Suppressing the Akt Pathway

Previously we found that inhibition of Akt pathway impairs the NDV entry into DF-1 cells (Wang et al., 2021). To investigate whether 16 inhibits NDV entry through regulating the Akt pathway, DF-1 cells infected with F48E9 were incubated with 50 μM 16 and then cell lysates were harvested following the NDV entry process at 2 h post-infection. As shown in Figure 4A, NDV infection induced the upregulated expression of p-Akt (1.54- or 2.45-fold for 5 MOI or 10 MOI NDV infected samples compared to the mock group, respectively). And 16-treatment significantly suppressed the NDV-activated Akt pathway (Figure 4A). To verify the effect of other canthin-6-one derivatives on the Akt pathway, DF-1 cells infected with F48E9 were incubated with each compound and then cell lysates were harvested following the NDV entry process. To compare the effect of different compounds, DF-1 cells were treated with all analogs at the same concentration of 50 μM for 2 h. There was no cytotoxic effect when DF-1 cells were treated with these compounds at 50 μM for 2 h (Figure S3). As shown in Figure 4B, 8 compounds significantly reduced the expression of p-Akt. Overall, we conclude that 16 inhibits the virus entry by suppressing the Akt pathway.

Figure 4.

The 16 inhibits the Akt pathway activated by NDV entry. (A) DF-1 cells were infected with F48E9 (10 MOI) at 4 °C for 1 h. Unbound viruses were washed with pre-chilled PBS. Next, cells were supplemented with the medium containing 16 (50 μM). At 2 h post-infection, cells were harvested and cell lysates were subjected to western blot (p-Akt antibody, 1:1,000 dilution; Akt antibody, 1:1,000 dilution; β-Actin antibody, 1:2,000 dilution). (B) DF-1 cells were infected with F48E9 (10 MOI) at 4 °C for 1 h. Unbound viruses were washed with pre-chilled PBS. Next, cells were supplemented with the medium containing each compound (50 μM). At 2 h post-infection, cells were harvested and cell lysates were subjected to western blot (p-Akt antibody, 1:1,000 dilution; Akt antibody, 1:1,000 dilution; β-Actin antibody, 1:2,000 dilution). The data represent the mean ± SD of 3 independent experiments. The statistical significance was analyzed using a 2-tailed Student's t-test: ^⁎P < 0.05; ^⁎⁎P < 0.01; ^⁎⁎⁎P < 0.001.

16 Enhances the Expression of Antiviral Genes by Inhibiting the ERK Pathway

Previously we found that 1-formyl-β-carboline derivatives could inhibit the ERK pathway (Wang et al., 2021). To investigate whether 16 affects the ERK pathway, DF-1 cells infected with F48E9 (0.01 MOI) were incubated with 50 μM 16, and then cell lysates were harvested at indicated time points. As shown in Figure 5A, NDV infection upregulated the expression of p-ERK, while 16-treatment significantly reduced the expression of p-ERK. Then we detected the effect of other derivatives on the ERK pathway. As expected, the results showed that 8 derivatives (20 μM) suppressed the activation of the ERK pathway (Figure 5B). Then the mRNA expression level of interferon-related genes was determined by qPCR in 16-treated DF-1 cells. As shown in Figure 5C, treatment with 16 enhanced the expression of IFN-α, IFN-β, MX1, and OASL, in a dose-dependent manner. In the presence of 100 μM 16, the mRNA expression level of IFN-α, IFN-β, MX1, and OASL were increased to 4.06-, 3.03-, 2.79-, and 4.72-fold compared to the DMSO-treated samples, respectively (Figure 5C). Altogether, these results suggest that the canthin-6-one derivatives inhibit NDV proliferation via downregulating the ERK pathway.

Figure 5.

The 16 promotes the expression of antiviral genes through inhibition of the ERK pathway. (A) DF-1 cells infected with F48E9 (0.01 MOI) were incubated with 16 (50 μM). At 6, 12, 18, and 24 h post-infection, cells were harvested and cell lysates were subjected to western blot (p-ERK1/2 antibody, 1:1,000 dilution; ERK1/2 antibody, 1:2,000 dilution; β-Actin antibody, 1:2,000 dilution). (B) DF-1 cells infected with F48E9 (0.01 MOI) were incubated with each compound (20 μM). At 24 h post-infection, cells were harvested and cell lysates were subjected to western blot (p-ERK1/2 antibody, 1:1,000 dilution; ERK1/2 antibody, 1:2,000 dilution; β-Actin antibody, 1:2,000 dilution). (C) DF-1 cells infected with F48E9 (0.01 MOI) were incubated with 16 at the indicated concentrations. At 24 h post-infection, cells were harvested and relative mRNA expression was analyzed by qPCR. The data represent the mean ± SD of 3 independent experiments. The statistical significance was analyzed using a 2-tailed Student's t-test: ns, not significant; ^⁎P < 0.05; ^⁎⁎P < 0.01; ^⁎⁎⁎P < 0.001.

Overall, our findings reveal the antiviral mechanism of 16 against NDV (Figure 6).

Figure 6.

Illustration of the mechanism underlying the antiviral effect of 16 against NDV.

DISCUSSION

The canthin-6-one alkaloids extracted from plants possess various beneficial properties including antiviral activities (Hsieh et al., 2004). In the present study, 36 canthin-6-one analogs were screened to identify NDV inhibitors. Results showed that 8 compounds exhibit significant antiviral effects. Among the effective compounds, 16 showed no cytotoxicity even at 200 μM and the strongest anti-NDV effect with IC₅₀ at 5.26 μM, which indicated that 16 may serve as a candidate agent for anti-NDV drugs. Besides, 16 also inhibited other NDV strains which suggested that its effect had no virus strain specificity. Meanwhile, 16 can act as an excellent antiviral agent in different cell lines. The structure-activity relationships were discussed based on the antiviral activities. Compared to 22, 16 exhibited better antiviral activity which indicated that the introduction of benzyl group at the N-3 position is beneficial to antiviral activity. Compared to 17, 16 has a similar structure with an additional carbonyl group at the C-6 position. However, 17 has no antiviral effect, suggesting that the C-6 carbonyl group is crucial to the activity of 16. Taken together, our results suggest that N-3 and C-6 modifications are important to its antiviral effect. Among these compounds, 16 and 22 treatment lead to fewer side effects on the viability of DF-1 cells, indicating that the hydrogenated canthin-6-ones have more potential use for antiviral agents because of their low cytotoxicity.

Up to now, there have been few reports about the antiviral mechanisms of canthin-6-one analogs. Canthin-6-one 9-O-beta-glucopyranoside, extracted from Eurycoma harmandiana, was predicted to interact with conserved nonstructural DENV protein NS1, NS3/NS2B, and NS5. However, this result was only a theoretical assumption (Tahir Ul Qamar et al., 2019). As a subclass of β-carbolines, canthin-6-one alkaloids have the same skeletal structure compared to β-carbolines. Therefore, the mechanism of β-carboline's biological activities is of important reference significance. Harmine, a well-studied β-carboline alkaloid, was reported to be a potent inhibitor of HSV-2 with IC₅₀ at 1.47 μM, and it inhibited HSV-2 replication through suppression of cellular NF-κB and MAPK pathways (Chen et al., 2015). Harmine also induced cell cycle arrest and apoptosis through inhibition of the Akt and ERK signaling pathways in SW620 cells (Liu et al., 2016). Previously, we found that three 1-formyl-β-carbolines inhibit the Akt and ERK pathway (Wang et al., 2021). Given all this, do canthin-6-one analogs exert their antiviral activity through the Akt and ERK pathways? We here demonstrated that 8 canthin-6-one analogs reduced the NDV-induced expression of p-Akt and p-ERK1/2. 16 exhibited the strongest activity to reduce the expression level of p-Akt and p-ERK1/2, which was consistent with the antiviral effect. On one hand, the Akt pathway is reported to regulate the viral entry process. Inhibition of the Akt pathway significantly reduced the yield of rotavirus by interfering with the entry process (Soliman et al., 2018). During bovine ephemeral fever virus (BEFV) infection, inhibition of the Akt pathway hindered the viral entry process by blocking BEFV-induced expressions of clathrin and dynamin 2 (Cheng et al., 2015). For NDV, the entry process relied on multiple strategies including clathrin-mediated endocytosis (Tan et al., 2016). We found that suppression of the Akt pathway inhibits the entry of NDV into DF-1 cells (Wang et al., 2021). Here, 16 inhibits the entry process of NDV through suppression of the Akt pathway, which reveals a novel mechanism underlying the antiviral activity of canthin-6-one analogs. On the other hand, the ERK pathway is a central component that plays an important role in the regulation of various intracellular biological processes (Maik-Rachline and Seger, 2016). ERK1/2 is activated by direct phosphorylation on threonine-183 and tyrosine-185 in the activation loop. The activation of the ERK pathway is beneficial to the replication of many viruses, including vaccinia virus (VACV), hepatitis B virus (HBV), human adenovirus (HAdV), and so on (DuShane and Maginnis, 2019). Zhang et al. found that activation of the Ras/Raf/MEK pathway facilitated hepatitis C virus (HCV) replication through downregulating of IFN-stimulated genes (ISGs) and phosphorylation of STAT1/2, leading to the inhibition of interferon receptors 1 and 2 (Zhang et al., 2012). Meanwhile, the ERK pathway was beneficial to influenza A virus (IAV) replication because it was needed in the nuclear export of newly assembled viral ribonucleoproteins (Schräder et al., 2018). Likewise, inhibition of ERK1/2 by selective inhibitor was able to reduce the NDV yield in DF-1 cells (Chu et al., 2018). In 2019, Wang et al. found that NDV infection dramatically reduced the expression of ISGs through activation of the ERK pathway (Wang et al., 2019). In this study. 16 could inhibit the NDV-activated ERK pathway and enhance the expression of IFN-related genes. These results expanded the antiviral mechanism of canthin-6-one analogs. However, the direct target of 16 remains to be investigated.

In conclusion, we identify 8 canthin-6-one analogs that exhibit antiviral activity against NDV. Among them, 16 is able to be a potential candidate for treatment due to the low cytotoxicity and strong antiviral effect. Our data show that 16 blocks viral entry through inhibiting the Akt pathway, and enhances the expression of IFN-related genes by suppressing the ERK pathway. Taken together, our results suggest that canthin-6-one analogs can serve as potential antiviral agents against NDV.

DISCLOSURES

The authors declare no conflicts of interest.