Canadine inhibits epithelial mesenchymal transformation of HPV-negative cervical cancer

ABSTRACT

Although the majority of the population will be protected due to the advent and widespread use of the HPV vaccine, the treatment of cervical cancer for all causes, including HPV-negative cervical cancer, is still worthy of further research. The focal point of this study was Canadine’s inhibition of epithelial-mesenchymal transformation (EMT) in cervical cancer. Immunoblotting, wound healing and tumor invasion experiments showed that low concentration of Canadine could inhibit the EMT process, proliferation and migration of HT-3 cells (HPV-negative cell line). Combined with GEO database, it was found that the expression levels of several genes highly expressed in cervical tumor tissues could be inhibited by Canadine, especially MAGEA3. Further experiments confirmed that the inhibition of Canadine on MAGEA3 protein increased with time. The small interference and overexpression plasmid of MAGEA3 were designed and verified. In HT-3 cells, when MAGEA3 levels were directly decreased, mesenchymal phenotypic markers were decreased and epithelial phenotypic markers were increased. The opposite result was obtained by overexpression of MAGEA3. In addition, the inhibition of EMT due to the reduction of endogenous MAGEA3 by Canadine was also offset by the overexpression of exogenous MAGEA3. The study concludes that Canadine inhibits EMT of cervical cancer by inhibiting MAGEA3.

Introduction

Cervical cancer (CC) is one of the most preventable and curable types of cancer and the third most common malignancies in the world, after breast cancer and colorectal cancer, primarily caused by persistent Human Papilloma Virus (HPV) infections.¹ The most common histopathological subtype of CC is squamous cell carcinoma, which accounts for 75 to 85% of the total. Its pre-cancer stage lasts for decades and remains a health burden for women and an economic burden for society in developing countries. CC has come a long way in the last few decades in terms of prevention, and history has shown that just like other vaccines against diseases like polio or mumps, HPV vaccines will turn CC into a disease that disappears. More and more people will be protected from HPV, but it is worth noting that although HPV-negative cases are rare (3–8%), it has been reported.^2,3 One study found that HPV-negative cases are associated with advanced adenocarcinoma phenotype and poorer disease-free survival, in comparison with HPV-positive cases.⁴ Based on the status quo, a possible mechanism for drug therapy for CC remains necessary.

Canadine (Tetrahydroberberine) is a widely distributed natural alkaloid that has been crystallized into a racemic mixture near the center of reversal.^5,6 In Oriental medicine, Canadine is an ingredient in a variety of Chinese herbs, such as Coptis, Corydalis turtschaninovii (CT). Its molecular monomers have also been suggested to have different roles in various studies, including the properties of D2 receptor antagonist and 5-HT receptor agonist, regulating gastric dynamics and antioxidant protection against oxidative damage.^7,8 However, the effect of Canadine on cervical cancer has not been studied.

The invasion and metastasis of CC is a multi-factor and multi-step cascade reaction process. Epithelial-mesenchymal transformation (EMT), as a key link of the cascade reaction, plays a pivotal role in the invasion and distant metastasis of CC.^9,10 On the contrary, the reverse process of EMT inhibits the invasion and metastasis of cancer cells and the proliferation of tumor stem cells. EMT is the biological process by which epithelial cell transition to mesenchymal cells by a specific procedure characterized by decreased expression of epithelial biomarkers (such as E-cadherin) and increased expression of mesenchymal biomarkers (such as N-cadherin and Vimentin), resulting in enhanced cell migration.^11,12

In our study, it was found that Canadine treated HT-3 cells showed significantly increased expression of epithelial phenotypic biomarkers and decreased expression of mesenchymal phenotypic biomarkers. On this basis, we confirmed the results of RNAseq from database, discovered joint regulatory protein MAGEA3 and explored its molecular mechanism for inducing EMT in CC. Our study highlights the mechanism of Canadine in MAGEA3 by inhibiting cervical cancer EMT and inhibiting invasive and metastasis of CC, providing a promising idea for the prevention and treatment of cervical cancer metastasis.

Materials and methods

Clinical samples

The pathological tissues were collected from a total of 30 cases of healthy and 60 cases of cervical cancer in the First Affiliated Hospital of Soochow University in 2022. Inclusion criteria: (1) Biopsy evidence of squamous cell carcinoma, adenocarcinoma or adeno-squamous cell carcinoma of the uterus; (2) Aged 18 years or older; (3) No immunotherapy chemotherapy or radiotherapy. Exclusion criteria: (1) Patients with a history of other malignancies; (2) Patients with heart, kidney and other organ failure; (3) Patients with immune diseases; (4) Pregnant women or breastfeeding. This experiment was approved by the Ethics Committee of First Affiliated Hospital of Soochow University. Demographic characteristic of CC is in Table 1.

Table 1.

Demographic characteristic of CC.

	Cases
Age
＜45	19
＜55	12
≥55	29
Menopause	30（50%）
Term births
0	1
1	31
2	22
3	3
4	3
Miscarriage	33(55%)
No Miscarriage	27(45%)
Co-morbidity
Hypertension	14（23.3%）
Diabetes	5（8.3%）
Prior abdominal surgery	27（45%）
HPV Type
Negative	2（3.3%）
16	34（56.7%）
18	5（8.3%）
16 and 18	3（5%）
Others	16（26.7%）
Pathological type
Adenocarcinoma	16（26.7%）
Squamous carcinoma	31（51.7%）
Others	13（21.7%）

Cell culture and treatment

The human CC cell lines HEK293, HT-3 cells and Hela cells (purchased from the Cell Bank of the Chinese Academy of Sciences) were cultured in DMEM (Gibco, 4.5 g/L glucose) with a supplementation of 10% FBS (Gibco) and 100 U/mL penicillin plus 100 μg/mL streptomycin. All cells were cultured in 37°C incubators with 5% CO₂. Canadine (Tetrahydroberberine) purchased from Selleck (Shanghai, China) dissolved in DMSO. When the cell fusion degree is 80–90%, Canadine (10 nmol) is added to treat the corresponding time according to previous literature.¹³

Antibodies

MAGEA3 (ab251574, 1:1000 for WB, 1:50 for IHC and IF), E-cadherin (ab40772, 1:1000 for WB) and N-cadherin (ab76011, 1:2500 for WB) were purchased from Abcam, and Vimentin (#46173, 1:1000 for WB), β-Actin (#3700, 1:1000 for WB) and second antibodies were purchased from CST.

Transfection

pcDNA3.1-MAGEA3 and siRNA for MAGEA3 were purchased from Gemma Pharma (Shanghai, China). Lip3000 and cDNA (siRNA) were premixed in serum-free medium for 15 min and then added to six-well plate and replaced with normal medium after 6 h–8 h. The details of the experiment were carried out according to the manufacturer’s instructions.

Immunofluorescence

Precooled PBS solution was used to wash the treated cells for 5 min × 3, which was conducive to antigen and antibody binding. Block solution (5% serum + 1% BSA in PBS) +0.2% triton-100 was added at room temperature for 2 h and incubated overnight at 4°C with primary antibody. Wash with PBS solution for 5 min × 3. The secondary antibody incubated at room temperature for 2 h and then was washed with PBS solution for 5 min × 3. DAPI was applied at room temperature for 15 min and sealed with cover glass. Pictures were gained through laser scanning confocal microscopy (LSM 880; Carl Zeiss, Germany).

Western blot

After cell treatment, the cells were lysed with a RIPA buffer (Beyotime) containing protease inhibitors under the mediation of an ice bath for 30 minutes. The DNA was cut by ultrasound for 10–15 seconds to reduce sample viscosity. The sample was centrifuged, and then 5 × SDS was added to supernatant before boiling 8–10 minutes. 25 µg to 30 µg sample was subjected to SDS-PAGE (10 cm × 8 cm) electrophoresis. After that, the protein was transferred to PVDF membrane at 350 mA current for 90 min. The primary antibody was incubated at 4°C overnight, and the secondary antibody was incubated at room temperature for 2 h, then cleaned before developing with ECL solution.

Immunohistochemistry

The tumor tissue was immobilized in 4% paraformaldehyde for a period of time and then rinsed with large amounts of ddH₂O, followed by sequential dehydration in low to high concentrations of ethanol. At room temperature, the dehydrating agent ethanol was replaced with the transparent reagent xylene, and the transparent time was 30–60 minutes. The transparent time of the tissue was adjusted according to the macroscopic observation. After embedding with paraffin, slice with thickness of 5 μm and place in oven at 60–65°C for 20–30 min, so that the water evaporates and the paraffin melts, take out for dyeing. The concentration of the antibody was diluted according to the instruction of the antibody, and the primary antibody was incubated at 4°C overnight. After the second antibody was incubated the next day, DAB color development was performed.

Wound healing

The cells were seeded into the 12-well plate, and when the cell fusion rate reached 100%, a straight line was drawn with the pipette tip perpendicular to the cell plane (the same pipette tip was used between different wells). After the scratch was finished, sterilized PBS was used to wash for 2–3 times. The cells crossed out during the scratch were washed away, so that the gap left was clearly visible. And then the fresh serum-free medium was replaced. Put the plate into the incubator for culture, then take out the plate at the set time (the specific time depends on the needs of the experiment). And take photographs, observe and measure the width of the scratches with the microscope.

Transwell invasion

Six hundred microliters DMEM was added to the lower chamber of the 24-well plate, the chamber was placed into the 24-well plate with sterile tweezers, and appropriate cell suspension was added to the upper chamber. After incubating for 24 h, the chamber was removed, the medium was sucked away, the matrigel and cells in the upper chamber were gently wiped with cotton swabs, and 4% paraformaldehyde 600 μL was added into the hole of the 24-well plate, and the chamber was fixed for 20–30 min after being placed in the chamber. After 5–10 minutes of infiltration with 0.1% crystal violet prepared, wash 3 times with PBS until no obvious purple is visible to the naked eye. The crystal violet that was not bound to cells was removed and observed under microscope and photographed.

RT-PCR

After cell preparation was complete, total RNA was extracted by TRIzol method. One thousand nanograms RNA samples reverse transcribed into cDNA using the commercial PrimeScript RT-PCR kit (Takara). mRNA expression of MAGEA3, N-cadherin, E-cadherin and Vimentin was determined using the 2^−ΔΔCT method. RT-qPCR was performed using the ABI Prism 7500 PCR system (Applied Biosystems). GAPDH was used as a control. The primer sequences were as follows:

MAGEA3ForwardPrimerGAAGCCGCCCCAGGCTCG

ReversePrimerGGAGTCCTCATAGGATTGGCTCC

NDUFA4L2ForwardPrimerGCTGCGCTTTACTTGCGT

ReversePrimerAAGGAACTTGTATTGGTCATTGG

CD70ForwardPrimerTCTGCCTCGTGGTGTGCAT

ReversePrimerGCTGAGGTCCTGTGTGATTCAG

TNFSF9ForwardPrimerGGCTGGAGTCTACTATGTCTTCT

ReversePrimerACCTCGGTGAAGGGAGTCC

WNT2BForwardPrimerGGGGCACGAGTGATCTGTG

ReversePrimerGCATGATGTCTGGGTAACGCT

N-cadherinForwardPrimerTCAGGCGTCTGTAGAGGCTT

ReversePrimerATGCACATCCTTCGATAAGACTG

E-cadherinForwardPrimerCGAGAGCTACACGTTCACGG

ReversePrimerGGGTGTCGAGGGAAAAATAGG

VimentinForwardPrimerGACGCCATCAACACCGAGTT

ReversePrimerCTTTGTCGTTGGTTAGCTGGT

GAPDHForwardPrimer GGAGCGAGATCCCTCCAAAAT

ReversePrimerGGCTGTTGTCATACTTCTCATGG

Tunel

The cells were fixed with 4% paraformaldehyde for 30 min and then incubated with PBS containing 0.3% Triton X-100 at room temperature for 5 min. Fifty microliters TUNEL solution was added to the sample and incubated at 37°C for 60 min away from light. The samples were sealed and observed under fluorescence microscope. Wash gently with PBS after each step.

Cell viability assay

After the cell suspension was prepared, it was gently mixed and implanted into the 96-well plate, with about 5000 cells suspended in each well. The cells are cultured to the appropriate cell density, and the Canadine (10 nmol) is added at different times as needed. Add 10–20 μL MTT solution (5 mg/ml) to each well and continue to culture for 4 h. The supernatant was absorbed, and 150 μL DMSO was added to each hole to fully dissolve the crystals. The light absorption value of each hole was measured by a microplate reader at 570 nm. The cell viability rate is expressed as: viability rate = (OD treatment group/OD control group) × 100%.

Statistical analysis

All experiments were repeated three or more times. The image was drawn with GraphPad Prism 8.0. The numerical data are expressed as mean ± standard deviation. SPSS20.0 was used for data analysis, and T-test was used for two independent samples (defined as p < 0.05). One-way ANOVA was used for multiple comparisons.

Results

Canadine inhibited EMT, migration and invasion of HT-3 cells

In order to clarify whether Canadine inhibits CC, HT-3 cells and Hela cells were treated with commercial Canadine alkaloids. The solvent DMSO was added to the control group, and 10 nmol Canadine was added to the experimental group. After 24 h of treatment, proteins were extracted and verified by western blotting. In HT-3, the results showed that the expression level of epithelial cell phenotypic marker, E-Cadherin was increased, while the expression level of mesenchymal cell phenotypic markers, N-Cadherin and Vimentin were decreased, with statistical significance (Figure 1a). In Hela, the proteins had the same change, but it was not statistically significant (Figure 1b). On this basis, we detected the mRNA level of Canadine to E-Cadherin, N-Cadherin and Vimentin in two cell lines, and the results were consistent with the protein level, implying that Canadine is more effective against HT-3 (HPV-negative cell line) at the current dose (Figure 1c). Another major factor in the pathogenesis of tumor cells is their aggressive tendencies. In the tumor invasion experiment, we also observed that Canadine had a good inhibitory effect (Figure 1d). In Hela cells, the results of wound healing and transwell tests were not significant. MTT experiment showed that 10 nmol of Canadine could significantly inhibit the activity of HT-3 cells, while 100 nmol was required for Hela cells (Figure 1e). In order to explore whether Canadine has an inhibitory effect on tumor migration, we conducted a wound healing test. At 12 h, there was no significant difference between DMSO and Canadine treated cells. However, when the time reached 24 h, compared with DMSO group, the cell healing area of Canadine group was significantly reduced (Figure 1f). HT-3 cells were treated with Canadine for 24 h, and TUNEL positive cells increased significantly (Figure 1g).

Figure 1.

Canadine inhibited EMT, migration and invasion of HT-3 cells HT-3 and Hela cells were treated with DMSO or Canadine (10 nmol). (a and b) The protein level of E-cadherin, N-cadherin, Vimentin, GAPDH and β-actin; (c) RT-PCR; (d) Tumour invasion assay and histogram of tumor invasion assay. (e) The cell viability of HT-3 and Hela cells treated with Canadine was detected by MTT assay. (f) Wound healing test and histogram of wound healing test. G. HT-3 cells treated with Canadine for 24 h were detected by TUNEL assay data are presented as the mean ± SD. *P < .05, **P < .01. NS: no significance.

Canadine inhibited MAGEA3 both in mRNA and protein level

Next, our experimental group began to explore the potential mechanism of the inhibitory effect of Canadine on CC. We obtained public sequencing results from the GEO database. One gene expression dataset [GSE192897] was downloaded from the GEO database. The database included 14 normal tissues and 44 CC tissues. Seven hundred and fifty differential genes were obtained after RNAseq, among which the TOP5 were MAGEA3, NDUFA4L2, CD70, TNFSF9 and WNT2B. HT-3 cells and Hela cells were treated with 10 nmol Canadine for 48 h or not, and total RNA was extracted for RT-PCR. The results showed that Canadine significantly inhibited the mRNA level of MAGEA3 but had a slight inhibitory effect on TNFSF9 and WNT2B (Figure 2a). We also found that MAGEA3 changes were more pronounced in HT-3 cells than in Hela cells. Immunohistochemical staining was performed on tissue slices from patients with cervicitis and CC. As seen in Figure 2b, the expression of MAGEA3 increased in the CC group. Then, cells were treated with Canadine for 0, 12, 24, 36 and 48 h, and protein was extracted for WB. The protein level of MAGEA3 presented a time-dependent reduction, with a significant difference at 36 h in HT-3 and at 48 in Hela (Figure 2c). Cells also were treated with Canadine at 0, 1, 10 and 100 nmol, and WB showed HT-3 with a better sensitivity to Canadine (Figure 2d). Finally, the immunofluorescence results showed that MAGEA3 was mainly distributed in the cytoplasm and a small amount in the nucleus. After Canadine treatment for 36 h, MAGEA3 in cytoplasm decreased, but no significant change in the nucleus (Figure 2e).

Figure 2.

Canadine inhibited MAGEA3 both in mRNA and protein level. (a) HT-3 and Hela cells were treated with DMSO or Canadine (10 nmol) for 24 h. mRNA levels MAGEA3, NDUFA4L2, CD70, TNFSF9 and WNT2B; (b) Immunohistochemical for MAGEA3 level of normal and CC paraffin sections. Scale bar: 100 μm. The quantization diagram is on the right; (c) HT-3 and Hela cells were treated with Canadine (10 nmol) for 0, 12, 24, 36, 48 h. The protein level of MAGEA3 and GAPDH were detected; (d) HT-3 and Hela cells were treated with Canadine for 24 at 0, 1, 10, 100 nmol. The protein level of MAGEA3 and GAPDH were detected. (e) HT-3 cells were treated with DMSO or Canadine (10 nmol) for 36 h. Immunofluorescence for MAGEA3 level. Scale bar: 50 μm. Data are presented as mean ± SD. *P <.05, **P < .01, *P < .001. NS: no significance.

Downregulation of MAGEA3 inhibited the EMT process

The above results showed that Canadine inhibits CC and also inhibits the transcription and translation process of MAGEA3, but whether MAGEA3 plays a role in CC process is still unclear. Commercial small interfering RNA sequences of MAGEA3 were purchased, and the efficiency of the sequence was tested by WB transfected in HEK293. Sequence 2 had the most significant efficiency, reducing protein expression by more than 60% (Figure 3a). So, sequence 2 was used in subsequent experiments. The results showed that epithelial cell phenotypic biomarker, E-Cadherin, was increased, while mesenchymal cell phenotypic biomarkers, N-Cadherin and Vimentin, were decreased, with statistical significance in both two cell lines (Figure 3(b,c)). In the wound healing test, when the treatment time reached 24 h, the result of the MAGEA3si group was similar to that of the Canadine treatment, and the area of healing was significantly reduced compared with that of the NC group. In the tumor invasion experiment, we also observed that MAGEA3si had a good inhibitory effect Figure 3(d,e). These results suggest that direct downregulation of MAGEA3 has a similar inhibitory effect on CC.

Figure 3.

Downregulation of MAGEA3 inhibited the EMT process. (a) HEK293 cells were transfection with negative control and three different small interference sequences. The protein level of MAGEA3 were detected; (b and c) in HT-3 and Hela, after MAGEA3 was knocked down, E-cadherin, N-cadherin, Vimentin and GAPDH were examined; (d) Wound healing test and histogram of wound healing test; (e) Tumour invasion assay and histogram of tumor invasion assay. Data are presented as mean ± SD. *P <.05, **P < .01.

MAGEA3 promoted the EMT process

To further verify the above results, we constructed an overexpressed plasmid of MAGEA3. Forty-eight hours after transfection, the transfection efficiency was verified by WB experiment. Figure 4(a,b) demonstrates that plasmid construction was successful, cell transfection was effective and MAGEA3 expression was significantly increased. The further increase of MAGEA3 expression also accelerated the process of EMT. E-Cadherin expression decreased, N-cadherin and Vimentin increased significantly Figure 4(c,d). These results were also confirmed by PCR (Figure 4e).

Figure 4.

MAGEA3 promoted the EMT process. Overexpressed plasmid of MAGEA3 was transfected for 48 h. (a and b) The protein level of MAGEA3 and GAPDH and the quantization diagram in HT-3 and Hela; (c and d) After MAGEA3 was overexpressed, E-cadherin, N-cadherin, Vimentin and GAPDH were examined in HT-3 and Hela; (e) The mRNA level of E-cadherin, N-cadherin, Vimentin and MAGEA3 were detected. Data are presented as mean ± SD. *P <.05, **P < .01, *P < .001.

Canadine inhibited EMT by reducing MAGEA3

Next, MAGEA3 plasmid was transfected in HT-3 before Canadine treatment to observe changes in EMT markers. Put simply, we artificially intervened HT-3 cells to express exogenous MAGEA3 when endogenous MAGEA3 was inhibited. Interestingly, we found that E-Cadherin, N-cadherin and Vimentin whose protein levels were greatly altered after Canadine treatment recovered to varying degrees when MAGEA3 over expression (Figure 5(a,b)). However, it did not completely recover or even exceed, which indicates that the effect of Canadine on CC is not only through MAGEA3, but there must be other signal pathways inhibited. The same result also appeared in the wound healing test and tumor invasion experiment. When the time reached 24 h, the value of Canadine + MAGEA3OE group was higher than that of the Canadine group. However, it was lower than DMSO group (Figure 5(c,d)). The above results indicate that the inhibition effect of Canadine was partly reversed by MAGEA3 overexpression.

Figure 5.

Canadine inhibited EMT by reducing MAGEA3. MAGEA3 plasmid was transfected in HT-3 before Canadine treatment. (a) The protein level of E-cadherin, N-cadherin, Vimentin and GAPDH; (b) Histogram of relative protein quantification of E-cadherin, N-cadherin, Vimentin; (c) Wound healing test and histogram of wound healing test; (d) Tumour invasion assay and histogram of tumor invasion assay. (e) Mechanism diagram. Canadine inhibits EMT of HPV-negative cervical cancer cells by decreasing MAGEA3 mRNA level. The data are presented as the mean ± SD. *P <.05, **P < .01, *P < .001, VS. DMSO; **P <.05, ***P < .01, VS. Canadine.

Discussion

CC is the most common gynecological malignancy. The most common age of carcinoma in situ is 30–35 years old, and invasive carcinoma is 45–55 years old. CC is mainly caused by persistent HPV infection, with HPV-16 and HPV-18 accounting for 50% and 10% of CC cases, respectively.^14,15 HPV infection is detectable in the vast majority of patients with CC worldwide. HPV is primarily transmitted through sex, and about 80% of women will be infected at some point in their lifetimes.¹⁶ Typically, many people are infected by HPV before the age of 45.4, with a greater concentration during adolescence and early adulthood.^15,16 The initial infection is asymptomatic, and it can take more than 10 years for the cervix to show changes, so the diagnosis of CC is greatly delayed. In recent decades, owe to the popularization and application of cervical cytological screening, the early detection of CC and precancerous lesions has become easier. The invention of the HPV vaccine has also given most people an additional line of defense against cervical cancer. But HPV-negative cervical cancer still exists, and as HPV is eliminated over time, there may be more cases rising.

In our experiment, we found that Canadine had a significant inhibitory effect on the EMT process of HPV-negative cell-line HT-3, and the same concentration of C had no significant effect on the EMT phenotype molecules of HPV-positive cell Hela. In addition, in the MTT test under the action of concentration and time gradient, there is a clear contrast with HeLa cells to achieve similar effects, only one-tenth of the concentration is required. In China, Traditional Chinese Medicine (TCM) can be used in combination with chemotherapy to reduce the toxic side effects of radiotherapy and chemotherapy, improve the effect and prolong the survival of patients. In the process of TCM treatment of malignant tumor, it can improve the biased constitution of patients with malignant tumor, so that the balanced constitution of Yin and Yang can be improved. However, there is a lack of evidence-based medical evidence for the efficacy of TCM. The complex composition of TCM makes it almost impossible to identify the key monomer molecules. Therefore, it is very important to extract the ingredients of traditional Chinese medicine and clarify its mechanism of action. Here we found the effective effect of Canadine, one of TCM monomers, on HPV-negative tumor cells, and found the key molecule MAGEA3.

Cancer testicular antigen (CTA) is usually expressed only in the testes and placenta and in various tumor types but not in any other somatic cells.^17,18 In CTAs, there are 12 members of the MAGEA family (MAGEA1 to MAGEA12).^17,19 Since 2003, after the high expression of MAGEA3 was found in CC cell line HT-3 cells,²⁰ the research on mageA3 and CC has been successful in a certain sense. The regulatory mechanism of MAGEA3 on CC includes inhibition of KAP1/p53 signaling pathway and promotion of Wnt signaling pathway.²¹ In a clinical trial of 17 patients with metastatic cancer treated with the targeted cancer antigen MAGEA3, an objective complete response was observed in a patient with metastatic CC receiving low-dose therapy, and no serious complications occurred during the treatment.²² However, the two largest Phase III trials of immunotherapy MAGEA3 as an adjunctive therapy for Stage III melanoma and non-small cell lung cancer both ended in failure, halting immunotherapy progress.^23,24 But MAGEA3 remains promising as a therapeutic target for cancer, and worth the effort to make it happen.

Rhizome of Coptis Coptidis is a common prescription for treating various inflammatory diseases in TCM. The main component of this rhizome is berberine (BER), an alkaloid with a variety of pharmacological properties, including anti-cancer and anti-inflammatory activities. The fully reduced form of BER, known as Canadine, is a quinoline alkaloid that is repeated in some Chinese herbal medicines.²⁵ Existing literature has reported the potential value of Canadine in tumor therapy, such as medullary thyroid cancer,²⁶ gastric cancer,²⁷ and colorectal cancer²⁸. However, the therapy effect on CC was discovered for the first time, and initial exploration was carried out. More importantly, we found that Canadine has a better significant effect on HPV-negative cell-line HT-3. Moreover, it was verified that Canadine affected EMT of tumor cells by inhibiting MAGEA3 transcription. However, our experiment has certain limitations. For various reasons, we have not conducted animal experiments and have not made it clear whether the same effect is in vivo. In addition, traditional Chinese medicine is used in plant compounds, and the targets are numerous. The monomer molecules we found are not necessarily the most effective molecules. Perhaps comparing or combining many single-drug ingredients one by one can obtain more significant and effective results.

We revealed the therapeutic effect of Canadine on CC, and then found the inhibitory effect of CC on MAGEA3, which created a certain theoretical basis for further exploration of drug therapy for MAGEA3. Future research should aim to evaluate efficacy and side effects at the animal.

Conclusions

The genes highly expressed in tumor tissues in the database were screened for verification. IHC showed highly elevated MAGEA3 levels in CC tissue. We demonstrated that Canadine inhibits the phenotypic transformation process of EMT in HT-3 cells. Functional studies have shown that when MAGEA3 expression is reduced by Canadine or MAGEA siRNA, it can inhibit cell proliferation and migration, thus exhibiting tumor suppressive effects (Figure 5e). Additionally, tumor inhibition induced by Canadine intervention is reversed by exogenous overexpression of MAGEA3. Although our study lacks validation at the animal level, it still provides ideas for the treatment of CC and the application of natural alkaloids.

Funding Statement

This work was supported by grants from the National Natural Science Foundation of China (No. 82101215).

Abbreviations

Cervical cancer

CC

Human Papilloma Virus

HPV

Canadine Tetrahydroberberine

Corydalis turtschaninovii

CT

Epithelial-mesenchymal transformation

EMT

Melanoma-associated antigen A

MAGEA

Berberine

BER

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author’s contribution

Yan Ma performed the majority of experiments, analyzed the data, and drafted the manuscript. Qian-Qian Yang, Dong-Mei Gu and Xiao Yuan revised the manuscript. Yu-Hong Wang and Ling-Chuan Guo designed and oversaw the study. All authors read and approved the final manuscript.