Protocol for establishing knockout cell clones by deletion of a large gene fragment using CRISPR-Cas9 with multiple guide RNAs

Summary

Genome editing is a powerful tool for establishing gene knockout or mutant cell lines. Here, we present a protocol for establishing knockout cell clones by deletion of large gene fragments using CRISPR-Cas9 with multiple guide RNAs. We describe steps for designing guide RNAs, cloning them into CRISPR-Cas9 vectors, cell seeding, transfection into cultured cells, clonal selection, and screening assays. This protocol can delete gene regions over 100 kbp, including GC-rich domains, and is applicable to various cell lines.

For complete details on the use and execution of this protocol, please refer to Saito et al.,¹ Saito and Endo et al.,² and Higashi et al.³

Graphical abstract

Highlights

• •Steps for cell seeding and transfection of CRIPSR-Cas9 expression vectors
• •Instructions for selecting cells transfected with PX459 and reseeding them
• •Guidance on isolating cell colonies after reseeding the transfectant
• •Procedures for genomic PCR, immunofluorescence microscopy, and immunoblotting

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Genome editing is a powerful tool for establishing gene knockout or mutant cell lines. Here, we present a protocol for establishing knockout cell clones by deletion of large gene fragments using CRISPR-Cas9 with multiple guide RNAs. We describe steps for designing guide RNAs, cloning them into CRISPR-Cas9 vectors, cell seeding, transfection into cultured cells, clonal selection, and screening assays. This protocol can delete gene regions over 100 kbp, including GC-rich domains, and is applicable to various cell lines.

Before you begin

This protocol delineates the procedure for introducing CRISPR-Cas9 vectors that encode two different guide RNAs (gRNAs) into cells to delete the genomic region between the gRNA recognition sequences. We will use the claudin 4 gene as an example, which is a transmembrane protein that constitutes tight junctions.⁴ In this protocol, two gRNAs induce double-strand breaks before the initiation codon and after the stop codon, effectively eliminating the coding sequence (CDS) region of claudin 4 and establishing claudin 4-knockout (KO) cell clones. The following steps describe the specific processes for using MDCK (Madin-Darby canine kidney) II cells. However, we have also successfully applied this protocol to Huh-7.5.1 cells. It is important to strictly follow good laboratory practices to avoid cellular or microbial cross-contamination.

Designing gRNAs

Before starting the transfection process, design gRNAs to target the genomic sequence of interest and clone them into the plasmid. In our study, we used the gRNAs listed in the key resources table and cloned them into the pSpCas9 (BB)-2A-Puro (PX459) plasmid obtained from Addgene. There are several web-based tools available for gRNA design, such as CRISPR gRNA Design tool-ATUM (https://www.atum.bio/eCommerce/cas9/input), DeepBaseEditor,⁵ BE-Designer,⁶ and CRISPRdirect.⁷ It is important to carefully select gRNAs with fewer off-targets in order to achieve targeted nucleotide excision with higher specificity. The gRNA should be synthesized with appropriate overhangs to facilitate cloning into the PX459 vector, and desalted oligos are sufficient for this purpose. The oligos used in our study are provided in the key resources table. As an example, this protocol will explain the procedure for designing gRNA using CRISPRdirect.

• 1.
  Obtain the target gene sequence.

  • a.
    Search for target gene sequences in genome databases, such as the University of California Santa Cruz (UCSC) Genome Browser, Kyoto Encyclopedia of Genes and Genomes (KEGG) GENES Databese, and National Center for Biotechnology Information (NCBI) among others. It is recommended to obtain sequences ranging from 1–2 kb before the first exon to 1–2 kb after the last exon of the gene of interest.
  • b.
    Assemble the sequence data using tools like SnapGene and GENETYX.

Note: It is recommended to compare across multiple databases in order to obtain a more accurate gene sequence.

CRITICAL: For short genes (up to approximately 100 kbp), it is recommended to choose the cleavage sites before the initiation codon and after the stop codon (Figure 1A). Cleaving at both of these sites simultaneously leads to complete loss of the target gene. It is important to ensure that the cleavage does not affect the expression of genes next to the gene of interest. In the case of longer genes, the efficiency of joining the two deletion sites is expected to be significantly lower. Therefore, it may be necessary to delete only a part of the gene, such as the first exon, or exons that encode essential functional domains. When the first ATG is removed, the translation may start from the second (or later) ATG, resulting in the expression of a fragmented protein. Thus, it is recommended to examine the expression of the fragments by immnoblotting using antibodies against the carboxy terminus of the gene.

• 2.
  Designing gRNA.

  • a.
    Enter the gene sequence information, including 100 bp before and after the targeted cleavage point, to the “Paste a nucleotide sequence” box of the CRISPRdirect tool.
  • b.
    Click “design” after selecting the species of the target genome in the Specificity check.
  • c.
    Select the target gRNA from the displayed sequence.
  • d.
    Determine another truncation region in the same manner as above.
  • e.
    Design a 20-nucleotide gRNA sequence with overhangs. Add CACCG to the 5′ end of the Forward oligo, AAAC and C to the 5′ and 3′ ends of Reverse oligo, respectively (Figure 1B).

Note: Choose gRNAs with as few off-targets as possible. Keep in mind that GC-rich regions increase off-targets and decrease the probability of DNA amplification in the subsequent genomic PCR process. Synthetic oligos should not contain the Protospacer Adjacent Motif (PAM) sequence.

Figure 1.

Schematic diagram of the large deletion of target gene sequences

(A) Typical example of large deletion using CRISPR-Cas9 with multiple gRNAs. Upper and lower schemes indicate that deletion of multiple exons of a target gene and deletion of multiple genes next to each other, respectively. The length of the genomic sequence between gRNAs is approximately up to 100 kbp.

(B) Schematic image of gRNA oligos to be synthesized and cloned into pSpCas9 (BB)-2A-Puro (PX459). The double strand DNA in the lower right side represents the cloning site of PX459 plasmid, and the bases in blue indicate the bases corresponding to the overhang regions in the synthetic oligo DNA. The red lines green lines indicate the cleavage and recognition sites of BbsI, respectively.

Vector preparation and ligation

Timing: 3–4 h

Here, we outline the process of preparing vectors for gene editing. This procedure includes the annealing of oligos, ligation, and transformation. This protocol will facilitate the construction of CRISPR-Cas9 vector, a fundamental component of CRISPR-based experiments, allowing for targeted genomic modifications.

• 3.
  Preparation of vectors.

  • a.
    Digest the PX459 vector (Addgene, USA; plasmid #62988) using the BbsI-HF enzyme.

    • i.
      Assemble the reaction mixture as follows.

      Reagent	Final concentration	Amount
      PX459 (200 ng)	20 ng/μL	5 μL
      NEB buffer CutSmart (10×)	1×	5 μL
      BbsI-HF enzyme (R3539) 20 U/μL	0.4 U/μL	1 μL
      Nuclease free water	N/A	39 μL
      Total	N/A	50 μL

    • ii.
      Incubate at 37°C for 1 h to ensure complete digestion.
  • b.
    Perform electrophoresis of the digested plasmid on a 1% agarose gel with ethidium bromide (EtBr).

    • i.
      Ensure that the samples are run for at least 20 min at 100 V to achieve sufficient separation.
  • c.
    Excise the band of digested plasmid (∼9000 bp) using a clean razor blade and purify the DNA using the NucleoSpin Gel and PCR Clean-up kit (Takara, Japan) according to the manufacturer’s protocol.
  • d.
    Elute the purified product in 30 μL of nuclease-free water.

    Note: The sample volume scale can be adjusted. However, if the plasmid concentration exceeds 20 ng/μL, the digestion may be insufficient, resulting in an increase of negative clones during the later colony PCR process.

• 4.
  Annealing of gRNA oligos

  • a.
    Dilute the Forward and Reverse oligos with nuclease-free water to 10 μM.
  • b.
    Assemble the oligo annealing reaction as follows in a 0.6 mL tube.

    Reagent	Final concentration	Volume
    Forward Oligo (10 μM)	1 μM	1 μL
    Reverse Oligo (10 μM)	1 μM	1 μL
    Nuclease free water	N/A	18 μL
    Total	N/A	10 μL

  • c.
    Set up the following reaction in a thermal cycler.

    Cycle	Temperature	Time
    1	95°C	5 min
    1	90°C	4 min
    1	85°C	4 min
    1	80°C	4 min
    1	75°C	4 min
    1	70°C	4 min
    1	65°C	4 min
    1	60°C	4 min
    1	55°C	4 min
    1	50°C	4 min
    1	45°C	4 min
    1	40°C	4 min
    1	35°C	4 min
    1	30°C	4 min
    1	25°C	4 min
    1	20°C	4 min
    1	15°C	∞

  • d.
    Dilute 1 μL of the annealed product with nuclease-free water at a 1:100 ratio.
• 5.
  Ligation

  • a.
    Set up the reaction as follows.

    Reagent	Final concentration	Volume
    Vector backbone (50 ng/μL)	5 ng/μL	1 μL
    Annealed product	N/A	1 μL or 0 μL (for negative control)
    T4 ligase buffer 10×	1×	1 μL
    Nuclease free water	N/A	6 μL or 7 μL (for negative control)
    T4 ligase (350 U/μL)	35 U/μL	1 μL
    Total	N/A	10 μL

  • b.
    Mix thoroughly and incubate at 16°C for 1 h, then store at 4°C until transformation.

Transformation and confirmation of clones

Timing: 2 days

This protocol outlines the process for transformation and validating the gRNAs for use in downstream gene editing experiments. The protocol spans two days and includes key procedures such as transformation, colony picking, glycerol stock preparation, colony PCR, and plasmid isolation. These critical steps ensure the generation of plasmids containing accurately cloned gRNAs, which are crucial for successful gene editing.

• 6.
  Transformation and plating

  • a.
    Prepare LB Agar plates with ampicillin (50 μg/mL).
  • b.
    Thaw 50 μL of JM109 (Takara Bio) competent cells on ice.
  • c.
    Add 5 μL of the ligated product to the competent cells and mix by flicking the tubes.
  • d.
    As a control add 50 ng of digested plasmid to another tube of competent cells.
  • e.
    Keep on ice for 30 min. Set up water bath at 42°C.
  • f.
    Heat shock for 45 s at 42°C.
  • g.
    Rapidly transfer the tube onto ice and incubate for 2 min.
  • h.
    Add 200 μL of SOC medium and shake at 200 rpm for 15 min to restore cell damage.
  • i.
    Plate the entire volume on an LB ampicillin plate and incubate at 37°C for 12–14 h.

Note: Wrap the plate in plastic wrap to prevent drying during incubation.

• 7.
  Picking colonies and colony PCR

  • a.
    Confirm that there are 20–500 colonies on the plate, with relatively few or no colonies on the control plates.
  • b.
    Prepare the PCR reaction mixture as follows and aliquot it into 8–16 PCR tubes.

    Reagent	Final concentration	Volume
    gRNA oligo F Primer (10 μM)	1 μM	1 μL
    PX459_cPCR_R Primer (10 μM)	1 μM	1 μL
    GoTaq Green Master Mix 2× (Promega)	1×	5 μL
    Nuclease free water	N/A	3 μL
    Total	N/A	10 μL

  • c.
    Pick single colonies from the plate and inoculate them into each PCR reaction tube. Mark the colonies with the tube number.
  • d.
    The plates can be stored at 4°C for approximately 2 weeks as a backup.
  • e.
    Set up the following reaction in a thermal cycler.

    Steps	Temperature	Time	Cycle
    Initial denaturation	94°C	1 min	1
    Denaturation	95°C	10 s	26
    Annealing	60°C	15 s
    Extension	72°C	30 s
    Final extension	72°C	3 min	1
    Hold	16°C	∞

  • f.
    Run 4 μL of the PCR product on a 2% agarose gel.
  • g.
    Positive colonies should show a band at 197 bp.
  • h.
    Inoculate the positive clone into 2 mL of LB medium with ampicillin (50 μg/mL)
  • i.
    Incubate at 37°C for 12–14 h.
  • j.
    Purify the plasmid from 1.5 mL of the culture using the NucleoSpin Plasmid EasyPure kit as per the manufacturer’s protocol.
  • k.
    Elute the purified product in 50 μL of nuclease-free water.

    Optional: Make a glycerol stock of the E. coli clone. Combine 500 μL of culture with 500 μL of 50% glycerol, and store at −80°C.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse anti-claudin 4 (3E2C1) antibody (1:1,000)	Thermo Fisher Scientific	Cat # 32-9400; RRID: AB_2533096
Rat anti-ZO-1 (alpha+) antibody (1:1,000)	Santa Cruz Biotechnology	Cat # sc-33725; RRID: AB_628459
Mouse anti-β-actin HRP (1:2,000)	Santa Cruz Biotechnology	Cat # sc-47778; RRID: AB_626632
ECL anti-mouse IgG, HRP-conjugated whole antibody	Cytiva	Cat # NA931V
Bacterial and virus strains
E. coli JM109 competent cells	Takara Bio	Cat # SD2865
Chemicals, peptides, and recombinant proteins
GoTaq Green Master Mix	Promega	Cat # M712
T4 DNA ligase	Takara Bio	Cat # 2011A
Puromycin	Sigma-Aldrich	Cat # P7255
Ampicillin	FUJIFILM Wako	Cat # 017-10381
Carbenicillin	Nacalai Tesque	Cat # 07129-01
Dulbecco’s modified Eagle’s medium (DMEM)	FUJIFILM Wako	Cat # 044-29765
Opti-MEM reduced serum media	Gibco	Cat # 31985-062
Fetal bovine serum (FBS)	Nichirei	Cat # 175012
Phosphate-buffered saline (PBS)	Takara	Cat # T9181
Trypsin EDTA (0.25 w/v%)	FUJIFILM Wako	Cat # 209-16941
Polyethylenimine (PEI) Max	Polysciences	Cat # 24765
Agarose ME	FUJIFILM Wako	Cat # 010-13975
Agar	FUJIFILM Wako	Cat # 010-15815
Lysogeny broth (LB), Miller	Formedium	Cat # LMM0102
Bacto Yeast extract	Gibco	Cat # 16279781
Bacto Tryptone	Gibco	Cat # 211705
SOC medium	Takara Bio	Cat # ST0215
Tween 20	KISHIDA	Cat # 020-81565
Methanol	FUJIFILM Wako	Cat # 139-01827
Formaldehyde, 36%–38%	FUJIFILM Wako	Cat # 064-00406
Polyoxyethylene (10) octylphenyl ether (Triton X-100)	FUJIFILM Wako	Cat # 168-11805
Bovine serum albumin (BSA)	Sigma-Aldrich	Cat # A7030
Fluoro-Gel II, with DAPI	Electron Microscopy Sciences	Cat # 17985-51
BbsI-HF	NEB	Cat # R3539
CutSmart buffer	NEB	Cat # B7204
Ethidium bromide	Wako	Cat # 058-04761
CelLytic MT	Sigma-Aldrich	Cat #C3228
cOmplete Mini	Sigma-Aldrich	Cat # 05892791001
PhosSTOP	Sigma-Aldrich	Cat # 04906837001
Tris-HCl (2-amino-2-hydroxymethyl-1,3-propanediol)	KISHIDA	Cat # 000-81045
Sodium dodecyl sulfate (SDS)	FUJIFILM Wako	Cat # 196-08675
Glycerol	FUJIFILM Wako	Cat # 075-00616
β-Mercaptoethanol	KISHIDA	Cat # 010-47775
Bromophenol blue	FUJIFILM Wako	Cat # 021-02911
SuperSep Ace, 5%–20% 17-well gradient gels	FUJIFILM Wako	Cat # 194-15021
Polyvinylidene fluoride (PVDF) membrane	Merck	Cat # IPVH00010
ECL Prime western blotting detection reagent	Cytiva	Cat # RPN2236
Critical commercial assays
NucleoSpin Plasmid EasyPure	Takara Bio	Cat # 740727
NucleoSpin Gel and PCR Clean-up	Takara Bio	Cat # 740609
Experimental models: Cell lines
MDCK (Madin-Darby canine kidney) II (claudin 2-knockout clone #15)	Higashi et al.3
Huh-7.5.1	ATCC	RRID: CVCL_E049
Oligonucleotides
gPCR_Checking (Primer A): cctcccacacagccatataactgc	This paper
gPCR_Checking (Primer B): tctgcgacgtgacgatgttgc	This paper
gPCR_Checking (Primer C): caattcagggctgagccgtc	This paper
gRNA_oligo1_F: caccggcttggatcctacagccctt	This paper
gRNA_oligo1_R: aaacaagggctgtaggatccaagcc	This paper
gRNA_oligo2_F: caccgccaccgtccacccgcggata	This paper
gRNA_oligo2_R: aaactatccgcgggtggacggtggc	This paper
PX459_cPCR_R: ggtacctctagagccatttgtctgca	This paper
gRNA oligos and checking primers for cingulin like 1	This paper	See Table S1
Recombinant DNA
pSpCas9 (BB)-2A-Puro (PX459)	Addgene	Cat # 62988
Software and algorithms
ImageJ: Fiji	National Institutes of Health	https://imagej.net/software/fiji/
SnapGene	MDF	https://www.snapgene.com
CRISPR gRNA design tool-ATUM	ATUM	https://www.atum.bio/eCommerce/cas9/input
DeepBaseEditor	Laboratory of Genome Editing (Yonsei University)	https://deepcrispr.info/DeepBaseEditor/
BE-Designer	BAE Lab, Seoul National University	http://www.rgenome.net/be-designer/
CRISPRdirect	Naito et al.7	https://crispr.dbcls.jp
University of California Santa Cruz (UCSC) Genome Browser	The Regents of the University of California	https://genome.ucsc.edu
Kyoto Encyclopedia of Genes and Genomes (KEGG) GENES Database	Kanehisa Laboratories (Kyoto University)	https://www.genome.jp/kegg/genes.html
National Center for Biotechnology Information (NCBI)	National Library of Medicine	https://www.ncbi.nlm.nih.gov
Other
96-well plate	Falcon	Cat # 353072
12-well plate	Falcon	Cat # 353043
6-well plate	Falcon	Cat # 353046
15-mL centrifuge tube	Violamo	Cat # 1-3500-21
Micro coverslips (24 × 50 mm)	Matsunami	Cat # 31500830
Micro cover glass (Φ12 mm)	Matsunami	Cat #C012001
Micro slide glass	Matsunami	Cat # FF-013
Tissue culture dish (Φ10 cm)	Violamo	Cat # VTC-D100
SuperSep Ace, 5%–20%, 17-well	FUJIFILM Wako	Cat # 194-15021
100-bp DNA ladder	NIPPON Genetics	Cat # MWD100P
Thermal cycler (30-well)	Astec	Cat # 485
T100 Thermal cycler (96-well)	Bio-Rad	Cat # 1861096J1
Ultrasonic Disrupter	Tomy	Cat # UR-21P
Dry bath incubator (heat block)	Major Science	Cat # RA232
Cell counting chamber	EM Techcolor	Cat # 810020241
ImageQuant LAS4000	GE Healthcare	Cat # LAS 4000
Transilluminator	MaestroGen	Cat # MLB-21
Bio Shaker (BR-22UM)	TAITEC	Cat # 0053748-000
Power Pac 3000 Electrophoresis power supply	Bio-Rad	Cat # 165-5056
Upright fluorescence phase contrast microscope (BX61-FL/PC)	Olympus	Cat #T0462
CO2 incubator	Panasonic	Cat # MCO-230AICUV-PJ
Inverted phase contrast microscope (CK2)	Olympus	SKU: OLY-CK2
Inverted phase contrast microscope (TMS)	Nikon	SKU: TMS-2A

Step-by-step method details

Cell seeding and transfection

Timing: 2 days

This protocol outlines the process for cell seeding and transfection of CRISPR-Cas9 expression vectors. The protocol spans two days. These steps ensure the recombination of genomes containing the target genes, crucial for successful large deletion of genomes.

• 1.
  Cell seeding.

  • a.
    Pre-culture 1 × 10⁷ or more MDCK II cells in a 10 cm dish.
  • b.
    Wash the cells with 1× phosphate-buffered saline (PBS) twice.
  • c.
    Treat with trypsin-EDTA and incubate at 37°C for 5 min.
  • d.
    Add medium to the dish, pipette gently, transfer to a 15 mL tube, and centrifuge at 160 × g for 5 min.
  • e.
    After removing the supernatant, add 1 mL of medium and mix gently.
  • f.
    Count the number of cells per unit volume using a cell counting chamber (Corning).
  • g.
    Adjust the cell density to 7 × 10⁴ cells/mL and seed 7 × 10⁴ cells each to two wells of the 12-well plate (one well is for negative control).
  • h.
    Incubate the cells in a CO₂ incubator for 3–4 h.

Note: Cell confluency is important to achieve efficient transfection. After removing the supernatant, add as little medium as possible and pipette the cells slowly.

• 2.
  Transfection.

  • a.
    Confirm that the cells are attached to the bottom of the wells, prepare 100 μL Opti-MEM (Thermo) in a 1.5 mL tube.
  • b.
    Add a pair of PX459 plasmids (1.5 μg each) encoding gRNAs (gRNA1 and gRNA2) into the Opti-mem and mix by flicking the tube.
  • c.
    Add 3 μL of Polyethylenimine (PEI)-max (6 μg/mL) to the tube and mix gently by flicking the tubes. Do not vortex.
  • d.
    Incubate the DNA-PEI-max solution at 15°C–25°C in a clean bench for 15 min. During this time, change the medium of the cells seeded in the 12-well plate.
  • e.
    Add the solution to the well of 12-well plate and incubate for 14–16 h in a CO₂ incubator.

Selection and reseeding

Timing: 4–5 days

This protocol outlines the process for selecting cells transfected with PX459 and reseeding them. The protocol takes 4–5 days. These critical steps ensure the acquisition of cells that transiently express CRISPR-Cas9.

• 3.
  Selection of the transiently transfected cells.

  • a.
    Prepare 3 μg/mL puromycin (Sigma-Aldrich)-containing DMEM.
  • b.
    Add the medium to both control and transfected samples and incubate for 1 day in a CO₂ incubator.
  • c.
    After 1 day, check the cells under an optical phase-contrast microscope.
  • d.
    All cells in the control well must be dead and there should be 70%–90% cell death in the transfected well.
• 4.
  Cell reseeding.

  • a.
    Wash the cells with PBS twice.
  • b.
    Treat the cells with trypsin-EDTA and incubate for several minutes.
  • c.
    Add medium to the cell, pipette gently, and reseed 50–500 cells onto new 10-cm dishes.
  • d.
    Incubate the cells for 4–5 days in a CO₂ incubator.
  • e.
    Check to see if the cells are starting to form single-cell originated colonies after 1–2 days.

Optional: To check the approximate cleavage efficiency of target genes by CRISPR-Cas9, genomic PCR of bulk transfectant can be performed. Take 100 μL of the cell suspension from step 4c, and perform the processes after 6b in the Screening of KO cell clones section. Figure 2C shows an example of genomic PCR analysis of bulk cells transfected with claudin 4-PX459.

Figure 2.

Representative data from screening of large deletion-type alleles using genomic PCR

(A) Genomic structure of canine claudin 4 gene and schema of knockout strategy. The adjacent green and red lines in the KO allele indicate that the respective cleavage sites of the two Cas9/gRNAs are connected by non-homologous end-joining. The blue box in the exon indicates the coding sequence (CDS) region.

(B) Genomic PCR of parental claudin 2-KO MDCK II cell (as “Ctrl cell”) and 45 clones transfected with claudin 4-PX459. Genomic PCR using Primer A-C gives 1208 bp and approximately 289 bp in WT and KO alleles, respectively. Genomic PCR using Primer A-B exhibits 393 bp band in WT allele, while DNA is not amplified in KO allele due to the absence of the Primer B recognition sequence.

(C) Genomic PCR of bulk Ctrl cells transfected with claudin 4-PX459 with the untransfected negative control (−).

Picking colonies

Timing: 3–4 days

This protocol outlines the process for isolating cell colonies after reseeding the transfectant. The protocol takes 3–4 days and includes critical steps for acquiring of cell clones.

• 5.
  Picking cell colonies.

  • a.
    Ensure that the number of cells in a single colony at least more than one hundred.
  • b.
    Place a small-sized optical phase-contrast microscope (Olympus (OLY-CK2), Nikon (TMS-2A)) inside a clean bench to prevent bacterial contamination (Figure S1A).
  • c.
    Check the location of target colonies in the dish under the microscope in a clean bench.
  • d.
    Attach a tip to a 200 μL-micropipette and gently scrape off the cells (Figure S1B).
  • e.
    Aspirate the colony with ∼100 μL of medium into the tip once it leaves the bottom of the dish (Figure S1B) and transfer it to 48-well or 96-well plates.
  • f.
    Repeat steps 5c-e and pick 48–96 colonies.
  • g.
    Incubate the plates in a CO₂ incubator for 3–4 days until the cell number reaches 1000.

Note: Colonies with fewer than one hundred cells are more likely to die if scraped off. Avoid picking colonies that are not circular in shape, as they are likely to be made up of multiple clones. If nearby colonies are likely to come into contact during incubation, use a pipette tip to eliminate one of the colonies in advance. Steps 5b-f are performed with an optical phase-contrast microscope set up inside the clean bench.

Screening of KO cell clones

Timing: 2–5 h

This protocol outlines the process for screening cell clones. The protocol takes 2–5 h and includes key procedures such as genome PCR, immunofluorescence microscopy, and immunoblotting. These steps are essential to determine if the target gene in the acquired clones have been successfully deleted, which is crucial for establishing KO cell clones.

• 6.
  Genomic PCR.

  • a.
    Trypsinize the cells with trypsin-EDTA.
  • b.
    Aliquot 50% of the cells into a 0.6-mL tube for genome PCR and continue to culture the rest of the cells in the culture plate.
  • c.
    Centrifuge the tube at 1,000 × g for 5 min.
  • d.
    Remove the supernatant and add 20 μL of 200 μg/mL Proteinase K (Promega, USA).
  • e.
    Set up the following reaction in a thermal cycler.

    Steps	Temperature	Time	Cycle
    Proteinase reaction	55°C	20 min	1
    Inactivation	95°C	5 min	1
    Hold	16°C	∞

  • f.
    Prepare PCR reaction mixture as follows.

    Reagent	Final concentration	Volume
    Primer A (10 μM)	1 μM	1 μL
    Primer B or Primer C (10 μM)	1 μM	1 μL
    Template (genome)	N/A	1 μL
    GoTaq Green Master Mix 2× (Promega)	1×	5 μL
    Nuclease free water	N/A	2 μL
    Total	N/A	10 μL

  • g.
    Set up the following reaction in a thermal cycler.

    • i.
      The primers used are listed in the key resources table.

      Steps	Temperature	Time	Cycle
      Initial denaturation	94°C	1 min	1
      Denaturation	95°C	10 s	36
      Annealing	60°C	15 s
      Extension	72°C	30 s (for Primer B) / 75 s (for Primer C)
      Final extension	72°C	3 min	1
      Hold	16°C	∞

  • h.
    Run 4 μL of the PCR product on a 2% agarose gel.
  • i.
    Expose the gel with a transilluminator (MaestroGen) and detect the bands.

    CRITICAL: In Primer A-C, the bands of the wild type (WT) and KO allele are expected to appear at 1208 bp and ∼289 bp, respectively (Figures 2A and 2B). In Primer A-B, the WT allele is expected to appear at 393 bp, while the KO allele is theoretically undetectable because of the loss of the recognition sequence (Figures 2A and 2B). Primer A-C can distinguish WT alleles (Figure 2B: claudin 2-KO cells (designated “Ctrl” cells in this paper), clone 1, 10, 21, 34, 39, 43, 44), homozygous KO alleles (Figure 2B: clone 9, 17, 20, 33), and heterozygous WT/KO alleles (Figure 2B: clone 8, 11, 12, 26, 28) by the position of the bands, while Primer A-B can more sensitively detect WT alleles not detected by Primer A-C due to the shorter distance between the primers. In cases where both the KO and a band outside the KO position were detected by Primer A-C and not by Primer A-B, the clone is most likely a homozygous KO clone rather than a heterozygous clone (Figure 2B: clone 3, 4, 5, 13, 16, 23, 31, 32, 35, 42). It is possible that an inverted fragment or foreign DNA was inserted in one of the alleles. The cause of this could be clarified by cutting out the band, performing TA-cloning, and DNA sequencing. If no bands are detected with either primer combination, it means that the amount of template DNA is below the detection sensitivity (Figure 2B: 2, 6, 7, 14, 15, 18, 19, 22, 24, 25, 27, 29, 30, 36, 37, 38, 40, 41, 45).

    Optional: Although the methods for deleting short span of DNA (< 1000 bp) using two different gRNAs have been shown in the previous studies,^8,9,10 this approach can be applied to much larger genome regions. We show an example of a large gene region exceeding 100 kbp truncated (cingulin like 1 (CGNL1)) by the same technique shown in Figure S2. In the PCR with Primer SA-SC, the KO allele is expected to appear at ∼520 bp, while the WT allele is theoretically undetectable because of large distance between primers (101,570 bp). Using Primer SB-SC, the WT allele is expected to appear at 562 bp, while the KO allele is theoretically undetectable because of the loss of the Primer SB sequence (Figures S2A and S2B). The genomic PCR using Primer SA-SC and Primer SB-SC could distinguish between homozygous KO alleles (Figure S2B: clone 3, 10, 18, 20), heterozygous WT/KO alleles (Figure S2B: clone 5, 17, 19, 25, 44), WT alleles (Figure S2B: Ctrl, clone 1, 2, 4, 7, 11, 12, 13, 15, 16, 21, 23, 24, 26, 31, 32, 35, 36, 38, 41, 45), and those below detection sensitivity (Figure S2B: clone 8, 9, 14, 22, 27, 28, 29, 30, 33, 34, 37, 39, 40, 42, 43). Clone 6 may have experienced partial loss of one allele (Figure S2B).

    Note: Random integration of CRISPR-Cas9 vectors into the genome can be detected by genomic PCR using primers that recognize the DNA sequence of PX-459 as described in step 6f-i. To distinguish and detect the two types of CRISPR-Cas9 vectors introduced into cells, the corresponding single-strand oligo DNA for gRNA can be used as a primer together with the primer on the vector backbone. An example of checking random integration of each claudin 4-KO clone using gRNA oligos as forward primers (gRNA_oligo1_F or gRNA_oligo2_F) and reverse primer complementary to CRISPR-Cas9 vector (PX459_cPCR_R) is shown in Figure S3. Among the 12 claudin 4-KO clones, random integration was detected in clones 15 and 20 with both two CRISPR-Cas9 vectors (Figure S3).

• 7.
  Immunoblotting.

  • a.
    Expand the cell clones identified as KO in genomic PCR. Duplicate the cells into 6-well plates (2 × 10⁵ cells), one for stock and another for immunoblotting. Also prepare control cells in a well at the same cell density.
  • b.
    Incubate the cells for 2 days in a CO₂ incubator. Change the culture medium daily.
  • c.
    Wash one of the KO wells and control well with PBS three times on ice.
  • d.
    Lyse the cells with CelLytic MT (Sigma-Aldrich) supplemented with cOmplete Mini protease inhibitor cocktail (Sigma-Aldrich) and PhosSTOP phosphatase inhibitor cocktail (Sigma-Aldrich).
  • e.
    Dilute the sample in SDS sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 5% β-mercaptoethanol, 0.005% bromophenol blue).
  • f.
    Incubate the samples in a heat block for 5 min at 95°C.
  • g.
    Perform ultrasonic treatment on the samples using ultrasonification equipment for a brief moment (approximately 0.5 s).
  • h.
    Separate the proteins by SDS-PAGE using a 5%–20% gradient gel (Fujifilm Wako).
  • i.
    Transfer the proteins to a polyvinylidene fluoride (PVDF) membrane (Immobilon) at 200 mA for 3 h.
  • j.
    Block the membrane with 5% nonfat dried milk in Tris-buffered saline (TBS) with 0.1% Tween-20 (TBS-T) for 30 min at 15°C–25°C.
  • k.
    Incubate the membrane with a primary antibody diluted in 1% nonfat dried milk in TBS-T 12–16 h at 4°C.
  • l.
    Wash the membrane three times with TBS-T, and incubate it with HRP-conjugated secondary antibody in 1% nonfat dried milk in TBS-T for 1 h at 15°C–25°C.
  • m.
    Wash the membrane three times with TBS-T, and incubate it with ECL prime (GE Healthcare).
  • n.
    Detect the bands using ImageQuant LAS4000 (GE Healthcare) (As an example, immunoblotting images comparing claudin 4-KO cells and Ctrl cells are shown in Figure 3A).
  • o.
    For immunoblotting of β-actin, either reblot the same membrane as a loading control or repeat step 7 h or blot with a new membrane as a sample control (Figure 3A).
• 8.
  Immunofluorescence microscopy.

  • a.
    Culture control cells and KO cells identified by genomic PCR and immunoblotting.
  • b.
    Put sterile φ12-coverslips into the wells of 24-well plate.
  • c.
    Put 1 × 10⁵ cells into a well with a coverslip for immunofluorescence analysis.
  • d.
    Incubate the cells for 3 days in CO₂ incubator. Change the culture medium daily.
  • e.
    Fix the cells with 99.9% methanol (Fujifilm Wako) for 15 min at −20°C or 1% formaldehyde (Fujifilm Wako) for 30 min at 15°C–25°C. When fixed with formaldehyde, permeabilize with 0.2% Triton X-100 in PBS for 5 min at 15°C–25°C.
  • f.
    Wash with PBS three times.
  • g.
    Block with 2% bovine serum albumin (BSA) in PBS.
  • h.
    Incubate the coverslips with primary antibodies diluted in PBS for 2 h at 15°C–25°C or 12–16 h at 4°C. Choose antibodies that recognize the target proteins (mouse anti-claudin 4) and another antibody used for counterstaining (rat anti-ZO-1). Be careful not to use antibodies from the same animal species.
  • i.
    Wash the samples with PBS three times.
  • j.
    Incubate the coverslips with secondary antibodies diluted in PBS for 45 min at 15°C–25°C.
  • k.
    Embed the cells with FLUORO-GEL II with DAPI (Electron Microscopy Sciences).
  • l.
    Observe the samples with fluorescence microscopy or laser scanning confocal microscopy.
  • m.
    Check if the fluorescent signal of the target protein is visible in control cells and lost in KO cells (For example, immunostaining images comparing claudin 4-KO cells and Ctrl cells are shown in Figure 3B).

Figure 3.

Immunoblotting and Immunofluorescence of MDCK II cells with large deletions of target genes

(A) Immunoblotting of the total cell lysates of MDCK II cell clones with large deletion-type alleles with mouse anti-claudin 4 mAb. The clone number corresponds to Figure 2B. Asterisks indicate nonspecific bands. β-Actin served as a sample control.

(B) Fluorescent microscopic images of representative claudin 4-KO cell clone #9 in (A). Cells were stained with mouse anti-claudin 4 mAb (green), rat anti-ZO-1 mAb (red), and DAPI (blue). Scale bar, 20 μm.

Expected outcomes

The successful completion of this protocol will enable the deletion of target gene sequences in a large region. In our study, we have demonstrated the complete loss of one target gene (claudin4, cingulin like 1), as well as gene deletions spanning tens of kbp to create KO cells for adjacent genes.¹ We have also successfully deleted GC-rich regions that are challenging to edit.¹¹ The common method using a single type of gRNA relies on codon misalignment due to deletions or insertions of a few bases, which may result in the expression of fragmented proteins with initiation codons appearing later than their mutated sites. However, if the large deletions in this method are successful, complete loss of protein expression can be achieved, eliminating these concerns. Additionally, genomic PCR can distinguish the presence of KO alleles, allowing for easy screening. Therefore, the method is expected to provide a more efficient establishment of KO cells. With this approach, any genomic site can be deleted, allowing for the creation and evaluation of endogenous deletion mutants. However, it is essential to ensure that the target region meets the specific requirements of genome editors, such as the presence of target sequences within the editing region and the availability of PAM sequences. The editing efficiency of gRNAs in editing a genomic locus varies depending on factors such as the chromatin status of the target region, off-target effects, and GC ratio. Recently, Cas9/sgRNA ribonucleoprotein (RNP) complexes have been used, which allow genome editing in a shorter time with minimal off-targets than conventional vector-based methods.^12,13 Application of Cas9/sgRNA RNP complexes to large-scale gene deletion by the two gRNAs may enable more efficient genome editing for cell types that are difficult to edit genomes. Although the maximum gene deletion length presented so far is 100 kbp, it is expected that even longer regions can be edited.

Limitations

The cleavage and end-joining processes are not precisely determined at the single-nucleotide resolution. As a result, the resulting sequence may differ between alleles and clones. In gene regions with extremely high GC content, the efficiency of gene cleavage may be reduced. Using this protocol, unintended mutations may be induced at gRNA off-target sites. To minimize off-target cleavage, it is necessary to select gRNA sequences with as few off-targets as possible. It is also important to screen out cell clones without random integration of PX459 plasmid to avoid excessive genome editing by prolonged expression of Cas9 and gRNAs. To eliminate the possibility of unintended mutation, PCR amplification and direct sequencing of potential off-target sites, whole genome sequencing, or RNA sequencing of isolated clones can be additionally performed.^14,15 Alternatively, assessing independent multiple clones would reduce the possibility of off-target effects.

Troubleshooting

Problem 1

After reseeding, the cell colony does not grow (related to Step 4e).

Potential solution

Optimize the concentration of the antibiotic and incubation time period. Adjust the seeding density of cells after the selection process. If the cell type is less tolerant to low density, increase the serum concentration or seed the cells in a dish coated with an extracellular matrix such as gelatin or fibronectin. Note that in the latter case, ensure that the phenotype of the cells does not change. Alternatively, transfer each colony with trypsin-soaked pieces of filter paper may improve cell viability.¹⁶ Another option is to use cloning cylinders.¹⁷

Problem 2

There are no KO cell clones in the genomic PCR process (related to Step 6i).

Potential solution

First, check the bulk cells with genomic PCR to see if the intended deletion takes place. If KO allele is detected, retry the cell cloning process. If KO cell clones are not isolated repeatedly, consider the possibility that a gene knockout is lethal. If only the WT allele is detected, redesign and try gRNAs that recognize other sites. Carefully check that the annotation of the gene sequence examined is correct.

Problem 3

No bands other than primer dimers are detected in genomic PCR (related to Step 6i).

Potential solution

Check the GC content of the expected amplicon. If the GC ratio exceeds 70%, add 5%–10% dimethyl sulfoxide (DMSO) in the PCR reaction, which may improve the efficiency of PCR reaction. Alternatively, design another primers.

Problem 4

No band is detected when PCR is performed with the combination of a primer between the cleavage sites and a primer outside of cleaved region, but a band corresponding to the WT allele is detected with the outer-outer primer combinations (related to Step 6i).

Potential solution

It is possible that an inverted fragment of the cleaved region or unexpected foreign DNA is inserted into the cleaved allele. In this case, the gene is successfully knocked out. Confirm the knockout by sequencing of the amplicon, immunoblot analysis, and immunofluorescence microscopy.

Problem 5

No PCR product is detected with inner-outer primers, and PCR with the outer-outer primers detected bands at positions corresponding to WT and KO, however, immunoblotting and immunostaining analysis exhibited loss of protein (related to Step 6i).

Potential solution

Although large deletions of genes did not occur, it is possible that the knockout is achieved because a few nucleotides are deleted and/or inserted at the sites of cleavage without a large deletion, resulting in the appearance of a stop codon. The DNA sequence should be carefully examined.

Problem 6

Only the first exon is eliminated because the target gene is too long, however, a truncated protein is expressed by the later initiation codon (related to Step 7 n).

Potential solution

This protocol of large-scale deletion of genes can be applied repeatedly. Therefore, it is possible to eliminate the additional region of the gene by repeating this protocol.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Tomohito Higashi (tohigash@fmu.ac.jp).

Technical contact

Further technical information on the experiment should be directed to and will be fulfilled by the technical contact, Akira C. Saito (akira@fmu.ac.jp).

Materials availability

Plasmids of claudin 4-PX459 and cingulin like 1-PX459 will be provided upon request.

Data and code availability

Raw data will be provided upon request. This study did not generate any code.