Dietary Kluyveromyces marxianus hydrolysate alters humoral immunity, jejunal morphology, cecal microbiota and metabolic pathways in broiler chickens raised under a high stocking density

Abstract

This study investigated the impact of dietary supplementation with hydrolyzed yeast (Kluyveromyces marxianus) on growth performance, humoral immunity, jejunal morphology, cecal microbiota and metabolic pathways in broilers raised at 45 kg/m². A total of 1,176 mixed sex 1-day-old Ross 308 broilers were distributed into 42 pens and randomly assigned to either the control group, the control + 250 g hydrolyzed yeast (HY)/ton, 250HY group, or the control + 500 g HY/ton, 500HY group for 42 d. HY did not affect growth performance. However, HY reduced (P < 0.05) mortality at 25 to 35 d. Dietary HY lowered the heterophil/lymphocyte ratio and enhanced the villus height/crypt depth ratio and Newcastle disease titer (P < 0.05). Compared with HY250 and the control, HY500 upregulated (P < 0.05) IL-10. HY enhanced the α diversity, inferring the richness and evenness of the ceca microbiota. HY500 had greater β diversity than the control (P < 0.05). Six bacterial phyla, namely, Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, Verrucomicrobia, and Cyanobacteria, were found. The relative abundance of Firmicutes was greater in the HY500 treatment group than in the HY250 and control groups. HY decreased the abundance of Actinobacteria. HY supplementation altered (P < 0.05) the abundance of 8 higher-level taxa consisting of 2 classes (Bacilli and Clostridia), 1 order (Lactobacillales), 1 family (Streptococcaceae), and five genera (Streptococcus, Lachnospiraceae_uc, Akkermansiaceae, PACO01270_g, and LLKB_g). HY500 improved (P < 0.05) the abundance of Bacilli, Clostridia, Lactobacillales, Streptococcaceae, Streptococcus, PACO01270_g, and Lachnospiraceae_uc, while HY250 enhanced (P < 0.05) the abundance of Akkermansiaceae and LLKB_g. HY improved the abundance of Lactobacillus and Akkermansia spp. Minimal set of pathway analyses revealed that compared with the control, both HY250 and HY500 regulated 20 metabolic pathways. These findings suggest that dietary K. marxianus hydrolysate, especially HY500, improved humoral immunity and jejunal morphology and beneficially altered the composition and metabolic pathways of the cecal microbiota in broilers raised at 45 kg/m².

INTRODUCTION

In commercial settings, broilers are prone to a myriad of stressors that could compromise welfare, limit performance, and increase susceptibility to diseases. Intensive broiler production often utilizes high stocking density (HSD) to optimize resources, maximize production, and utilize available space efficiently (Bergeron et al., 2020). However, HSD can impair gut health, the immune response and overall well-being and performance (Gomes et al., 2014; Nasr et al., 2021; Hafez et al., 2022; Shynkaruk et al., 2023). Overstocking stress can disrupt the balance of the gut microbiota, and this imbalance can result in reduced nutrient absorption, impaired digestion, and increased susceptibility to infections and diseases (Kridtayopas et al., 2019; Li et al., 2021; Han et al., 2023). These challenges underscore the need to minimize overcrowding stress in broilers.

Among the approaches employed for mitigating overcrowding stress and its deleterious impacts on broilers, nutrition holds a strategic position (Kridtayopas et al., 2019; Hafez et al., 2022; Sugiharto, 2022). In light of this, the potential of various feed additives, such as probiotics (De Souza et al., 2018; Altaf et al., 2019; Ebeid et al., 2019; Khalil et al., 2021), symbiotics (Altaf et al., 2019; Kridtayopas et al., 2019; Rashidi et al., 2019), prebiotics (Hooge et al., 2003; Houshmand et al., 2012; Kridtayopas et al., 2019; Rehman et al., 2022) and phytobiotics (Zhang et al., 2013; Shakeri et al., 2014; Jobe et al., 2019; Rashidi et al., 2019), to ameliorate the impact of HSD in broilers has been explored. However, such research focused on hydrolyzed yeast (HY) is limited. HY contains components of the yeast cell wall (β-glucans, Mannan Oligosaccharides (MOS), and chitin) and yeast extract (nucleotides, amino acids, and B-vitamins) (Araujo et al., 2018; Perricone et al., 2022). Unlike Saccharomyces cerevisiae hydrolysate, Kluyveromyces marxianus hydrolysate is less exploited in poultry nutrition. K. marxianus has several advantages over S. cerevisiae, such as being the fastest growing eukaryote, having the ability to assimilate diverse types of sugars and secrete lytic enzymes, and producing ethanol by fermentation (Fonseca et al., 2008; Lane and Morrissey, 2010; Mo et al., 2019). Moreover, differences in cell wall composition and contents between S. cerevisiae and K. marxianus have been documented (Fleet, 1991; Nguyen et al., 1998; Tang et al., 2022), suggesting possible differences in their bioactivities and applications. This highlights the need for further studies in diverse production systems to determine optimal feeding applications, permit tailored decisions and informed choices in the utilization of K. marxianus hydrolysate in broiler production.

The gut microbiota plays a pivotal role in host nutrient utilization, the immune response and resistance to pathogens (Ding et al., 2017; Shang et al., 2018; Rychlik, 2020). A healthy gut microbiota in broiler chickens is characterized by a diverse and stable microbial community (Ding et al., 2017; Shang et al., 2018). Disruptions in the gut microbiota, such as dysbiosis or an imbalance in microbial populations, can lead to digestive disorders, reduced growth performance, and increased susceptibility to diseases (Mancabelli et al., 2016; Shang et al., 2018; Rychlik, 2020). In addition to microbiota composition, elucidating the pathways of microbial metabolism offers an opportunity to gain more insights into the dynamics of chicken microbiota in response to various production factors and the contributions of each microbe to the overall behavior of the microbiota (Polansky et al., 2016; Shang et al., 2018; Rodrigues et al., 2020). This knowledge can aid in the development of better management strategies to optimize the gut health, performance and overall wellbeing of broilers, especially under stressful conditions. To date, information on the response of the gut microbiota and its metabolic pathways to dietary supplementation with hydrolyzed K. marxianus in broilers raised under a high stocking density is very scarce. Thus, the objective of this study was to determine the influence of dietary supplementation with K. marxianus hydrolysate on growth performance, humoral immunity, jejunal morphology, ceca microbiota and metabolic pathways in broilers raised at 45 kg/m².

MATERIALS AND METHODS

Birds, Husbandry and Dietary Treatments

The study was approved (UI-02551-2559) by the Institutional Animal Care and Use Committee of Kasetsart University. The study was conducted at the Animal Science Research Centre, Kasetsart University, Kamphangsaen, Nakhon Pathom, Thailand. The birds were housed in an environmentally controlled facility. A total of 1,176 one-day-old Ross 308 broilers were randomly assigned to one of three treatment groups, namely, the control group; the control + 250 g of hydrolyzed yeast (HY)/ton group (HY250); and the 500 g of HY/ton group (HY500). The K. marxianus hydrolysate used in this study was I-Care hydrolyzed yeast (batch number: E9.7/100119; produced on 08 October 2019) obtained from Prosol S.p.A., Madone, Italy). The K. marxianus hydrolysate consisted of 54% crude protein, 5% total nucleic acid, 12.5% β-glucans, 7.5% mannans, 4.5% lysine, 2.7% threonine, 7.2% glutamic acid, and 149 ppm zinc. The recommended dosage according to the manufacturer is 0.025-0.05%.

Each dietary treatment had 14 replicate pens, and each pen consisted of 28 birds (14 males and 14 females). New rice hull was used as the bedding material. All birds were raised at a stocking density of 45 kg/m². This stocking density was above the recommended levels (39 kg/m² according to the EU Broiler Welfare Directive (2007/43/EC) (European Union Council Directive, 2007) and 38 kg/m² according to the Thai Agricultural Standards (TAS 6901-2009) (National Bureau of Agricultural Commodity and Food Standards, 2009)) and was adequate for inducing overstocking stress.

All the diets were formulated in accordance with the Ross 308 recommendations. A three-phase feeding program was adopted during the 42-d feeding trial. The feeds were offered as pellets. The birds had ad libitum access to feed and water during the trial. The lighting program included 23 h of light and 1 h of darkness. The birds were vaccinated for Newcastle disease (ND; B1 strain), Infectious bronchitis (IB) on d 7 via nasal drops, for infectious bursa disease (IBD) on d 14 via oral drops and for Newcastle Disease (LaSota strain) + IB on d 21 via nasal drops.

The proximate composition, calcium and phosphorus of the feed samples from each treatment and feeding period were analyzed following the methods of the AOAC (2005). The crude fiber content was determined by the Weende method. The ingredients, calculated analyses and chemical compositions of the dietary treatments are presented in Tables 1, 2, and 3, respectively.

Table 1.

Ingredient composition of basal diets.

Ingredient (%)	Starter	Grower	Finisher
	(0–10 d)	(11–24 d)	(25–38 d)
Corn (8% CP)	54.72	57.17	61.07
SBM (DH) 48% CP	36.68	33.59	29.06
Soybean oil	3.34	4.52	5.49
Monocalcium phosphate	2.257	2.016	1.809
Limestone	1.009	0.906	0.824
Pellet binder	0.30	0.30	0.30
Salt	0.229	0.251	0.251
Broiler vit/min premix	0.2-	0.20	0.20
DL-Methionine	0.327	0.276	0.248
L-Lysine HCl	0.227	0.162	0.156
L-Threonine	0.127	0.081	0.064
L-Isoleucine	0.044	0.015	0.007
Sodium bicarbonate	0.214	0.185	0.189
Choline Chloride 60%	0.08	0.074	0.084
Antimould	0.20	0.20	0.20
Coccidiostat (Salinomycin)	0.05	0.05	0.05
Total	100	100	100

Table 2.

Calculated analysis for the basal diets.

Nutrient	Unit	Starter	Grower	Finisher
		(0–10 d)	(11–24 d)	(25–38 d)
Dry matter	%	87.89	87.94	87.96
ME for poultry	Kcal/kg	3000	3100	3200
Crude protein	%	23.00	21.50	19.50
Crude fat	%	5.88	7.10	8.13
Linoleic acid	%	2.96	3.58	4.11
Crude fiber	%	2.63	2.57	2.48
Dig. Lys (poultry)	%	1.28	1.15	1.03
Dig. Met (poultry)	%	0.51	0.47	0.43
Lysine	%	1.43	1.29	1.15
Arginine	%	1.56	1.46	1.30
Methionine	%	0.67	0.6	0.55
Met + Cys	%	1.05	0.97	0.89
Cystine	%	0.38	0.36	0.33
Threonine	%	1.00	0.90	0.81
Tryptophan	%	0.27	0.25	0.23
Gly + Ser	%	1.86	1.75	1.60
Histidine	%	0.61	0.57	0.52
Isoleucine	%	1.04	0.95	0.85
Leucine	%	1.88	1.79	1.66
Valine	%	1.09	1.03	0.94
Phenylalanine	%	1.01	0.96	0.88
Calcium	%	0.96	0.87	0.79
Phosphorus-total	%	0.86	0.80	0.74
Phosphorus-avail	%	0.48	0.44	0.40
Non phytate P	%	0.52	0.47	0.43
Potassium	%	0.95	0.89	0.81
Choline	mg/kg	1700	1600	1550
Sodium	%	0.16	0.16	0.16
Chloride	%	0.16	0.16	0.23
Salt	%	0.27	0.29	0.29

Table 3.

Nutrient composition of experiment diets.

	Dietary treatment1
Parameter	Control	HY250	HY500
Starter
Dry mater	89.03	89.44	89.57
Protein	24.35	23.93	23.94
Fiber	1.27	1.44	1.18
Fat	5.80	6.25	6.92
Calcium	0.90	0.94	0.96
Phosphorus	0.80	0.81	0.83
Ash	5.51	5.59	5.63
GE (kcal/kg)	4,070.08	4,122.74	4,156.42
Grower
Dry mater	89.98	89.15	89.61
Protein	22.09	22.25	22.24
Fiber	1.31	1.24	1.08
Fat	7.83	7.65	7.37
Calcium	0.84	0.85	0.86
Phosphorus	0.74	0.73	0.73
Ash	5.17	5.18	5.17
GE (kcal/kg)	4,142.27	4,190.53	4,212.89
Finisher
Dry mater	89.35	89.25	89.30
Protein	19.95	19.70	19.34
Fiber	1.35	1.10	1.12
Fat	8.20	8.36	8.49
Calcium	0.77	0.76	0.70
Phosphorus	0.62	0.65	0.64
Ash	4.61	4.60	4.62
GE (kcal/kg)	4,286.81	4,205.83	4,222.25

¹Control, basal diet; HY250, basal diet + 250 g/ton hydrolyzed yeast (Kluyveromyces marxianus).; HY500, basal diet +500 g/ton hydrolyzed yeast (Kluyveromyces marxianus).

Growth Performance

The body weight of each bird in each pen was recorded on d 1, 10, 24, and 42, and body weight gain (BWG) was calculated. Pen feed intake was recorded, and the feed conversion ratio (FCR) was calculated, and corrected for mortality. The number of dead birds was recorded for mortality calculations. Daily records of temperature and humidity were taken.

Jejunal Morphology

On d 35, 2 birds (1 female and 1 male) from each pen were randomly selected and euthanized by CO₂ inhalation (Baker et al., 2019) and then prepared for histological examination. A 2-cm-long sample from the midpoint of the jejunum was collected and fixed in 10% buffered formalin. Subsequently, the sample was coated in paraffin. A 5 µm thick section was cut. The slides were subsequently subjected to staining with hematoxylin and eosin for histological assessment (Abudabos et al., 2016). Villus height (VH) was measured from the base to the top of the villi, and crypt depth (CD) was measured from the base of the villi to the base of the crypt. The villus width (VW) was measured at the base of each villus. The measurements were conducted on stained sections under a microscope with an Olympus DP22 digital camera and a DP2-SAL image analysis system (Olympus Optical Corp., Tokyo, Japan). The villus height/crypt depth (VH:CD) ratio was calculated. The villus surface area (SF) was calculated using the following formula: 2π × villus width/2 × villus height (Sakamoto et al., 2000).

Immune and Stress Indices

On d 28, 2 birds from each pen were randomly selected for blood sampling for the ND titer assay. The ND titer was determined by hemagglutination inhibition (HI) of NDV. NDV-specific IgY titers were determined by ELISA using an ND Antibody Test Kit (Synbiotics Corp., San Diego, CA) following the manufacturer's protocols.

On d 35, 2 birds per pen were randomly selected for blood collection for the heterophil/lymphocyte ratio assay. Serum samples were used for measuring malondialdehyde and interleukins. Interleukin 6 (IL-6) and interleukin 10 (IL-10) levels were determined using chicken IL-6 and IL-10 ELISA kits (Mybiosource Inc., San Diego, CA) in accordance with the manufacturer's protocols. The serum malondialdehyde concentration was determined as described by Adeyemi et al. (2016).

Cecal Microbiome

Sample Collection and Measurements

Cecal content was collected from 2 birds per pen that were previously used for jejunal morphology at d 35. The samples were collected, snap frozen in liquid nitrogen and stored at -80°C for DNA extraction.

Determination of the Gut Microbiota Using a 16S rRNA Sequencing Approach

DNA Extraction

Genomic DNA from the cecum samples was extracted with a ZymoBIOMIC D.N.A. Miniprep Kit (Cat. No. D4300; Zymo Research, CA) following the manufacturer's protocols. DNA/RNA Shield, Cat. No. R1100 (Zymo Research, CA), was used for sample collection to prevent errors or bias resulting from compositional alterations resulting from the degradation of nucleic acid. Subsequently, the DNA content was measured using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, MA), and 16S rRNA paired-end sequencing of the V3-V4 region of 16S rRNA was conducted using an Illumina MiSeq system, as highlighted below.

16S rRNA Amplification of the V3-V4 Region and Illumina Sequencing

The V3-V4 region of the 16S rRNA gene was PCR amplified from the genomic DNA using a forward primer (5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGAGGCAGCAG 3′) and reverse primer (5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATTACCGCGGCTGCTGG 3′). All PCRs were performed in 25 μL reactions with Phusion Hot Start II High-Fidelity PCR master mix, Cat. No. F-565S (Thermo Fisher Scientific, MA), 1X Phusion HS II HF Master Mix, 0.2 μM forward and reverse primers and 10 ng of template DNA. Thermal cycling consisted of an initial denaturation step at 95°C for 3 min, followed by 25 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s, followed by 72°C for 5 min in a thermal cycler (Blue-Ray Biotech, Taipei, Taiwan). PCR products with the desired size of approximately 550 bp were analyzed by 1.5% agarose gel electrophoresis. DNA quality and concentration were checked using a QFX fluorometer (De Novix, Wilmington, DE) and a Bioanalyzer 2100 system (Agilent Technology, CA). AMPure XP beads (Cat. No. A63881; Beckman Coulter, IN) were used to purify the 16S V3 and V4 amplicons from the free primers and primer-dimer species. Then, the Nextera XT Index Kit was used to attach dual indices and Illumina sequencing adapters following the manufacturer's protocol, and AMPure XP beads were used to clean the final library before quantification.

For the normalization of PCR amplicons, sequencing libraries were generated using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, MA) in accordance with the manufacturer's protocol. The samples (5 μL of each sample) from each well were pooled together. The dsDNA fluorescent dye QFX Fluorometer (DeNovix, DE) was used to quantify the DNA in the pools. The length of the amplicon fragments was evaluated using a Bioanalyzer 2100 system (Agilent Technology, CA). Prior to analysis, amplicons were diluted to the appropriate loading volume and concentration according to the manufacturer's recommendations. Briefly, amplicons were diluted to 2 nM with resuspension buffer combined with prepared PhiX Control (2%), and final concentrations of both the reagent and the library were 1.5 pM. The indexing primer read one and read two sequencing primers, and the sequencing library was subsequently loaded into an Illumina NextSeq reagent cartridge. The amplicons were sequenced on an Illumina MiSeq sequencer (2 × 250 bp paired-end run).

Microbial Diversity

All paired-end sequences from the Illumina Nexseq system were identified, and the abundance of operational taxonomic units (OTUs) and alpha and beta diversity were quantified using Quantitative Insights Into Microbial Ecology (QIIME 1.9.1). Sequences were assigned to OTUs with QIIME's UCLUST-based open-reference OTU picking protocol, and the Greengenes 13_8 reference sequence was set at 99% similarity. α-Diversity was calculated by using Chao1 and Shannon indices and compared between treatments with a nonparametric test with 999 permutations. β-Diversity calculations were conducted with QIIME's implementations of weighted and unweighted UniFrac by using 36146 randomly selected sequences per sample. Furthermore, principal component analysis (PCoA) was conducted to compare treatments on the basis of UniFrac distance. Linear discriminant analysis (LDA) scores resulting from the LDA effect size (LEfSe, https://huttenhower.sph.harvard.edu/galaxy/) were calculated to identify the specific bacteria (P < 0.05 and LDA score >2.0) (Segata et al., 2011). Prediction of functional metabolic pathways in the cecal microbiome at the OTU level was carried out using the minimal set of pathways (MinPath) based on 16S rRNA sequencing (Ye and Doak, 2009).

Statistical Analysis

Data for growth, gut morphology and immune indices were analyzed by the generalized linear model procedure of SAS (SAS Institute Inc., Cary, NC). The level of significance was set at P < 0.05. Variables with significant F tests were compared using Duncan's multiple range test. Statistical differences in microbial α diversity between treatment groups were determined using the Kruskal‒Wallis test. β-Diversity results were subjected to principal component analysis (PCoA) followed by permutational multivariate analysis of variance (PERMANOVA). Two-sided Welch's t test was utilized for pairwise comparisons of microbial metabolic pathways.

RESULTS

Growth Performance

Dietary K. marxianus hydrolysate did not influence (P > 0.05) the overall (1–42 d) feed intake, BWG or FCR (Table 4). During d 25 to 35, control birds had greater (P < 0.05) mortality than the HY-supplemented birds.

Table 4.

Growth performance of broiler chickens supplemented with K. marxianus hydrolysate.

	Dietary treatment1
	Control	HY250	HY500	SEM	P-value
Initial weight (g)	41.87	41.88	41.87	0.0646	0.9977
1–10 d
Final weight (g)	347.04	347.54	350.69	1.9140	0.7156
Body weight gain (g)	305.17	305.66	308.82	1.5932	0.7286
Feed intake (g)	321.46	319.22	319.91	1.3776	0.8055
Feed Conversion Ratio	1.053	1.044	1.036	0.0031	0.2886
11-24 d
Final weight (g)	1373.70	1374.76	1381.71	14.3536	0.9719
Body weight gain (g)	1026.66	1027.22	1031.02	12.7983	0.9894
Feed intake (g)	1329.07	1326.55	1329.26	13.7814	0.9963
Feed Conversion Ratio	1.295	1.291	1.289	0.0045	0.9110
Mortality %	0.513	0.275	0.238	0.1631	0.7704
25–35 d
Final weight (g)	2280.84	2305.37	2307.15	31.2390	0.9336
Body weight gain (g)	907.14	930.61	933.96	18.6527	0.8262
Feed intake (g)	1580.80	1619.99	1616.08	25.2280	0.7962
Feed Conversion Ratio	1.743	1.741	1.730	0.0138	0.9247
Mortality %	2.040a	0.550b	0.275b	0.2738	0.0161
36–42 d
Final weight (g)	2787.51	2817.89	2833.50	40.3884	0.9012
Body weight gain (g)	506.67	512.51	517.83	14.3716	0.9543
Feed intake (g)	1055.88	1064.94	1064.19	14.4100	0.9630
Feed Conversion Ratio	2.084	2.078	2.055	0.0501	0.9203
Mortality %	1.401	2.306	0.906	0.4237	0.4108
1–42 d
Final weight (g)	2787.51	2817.89	2833.50	40.3884	0.9012
Body weight gain (g)	2745.63	2776.00	2791.62	40.2694	0.9006
Feed intake (g)	4287.21	4330.70	4329.44	51.4664	0.9308
Feed Conversion Ratio	1.561	1.560	1.551	0.0081	0.8407
Mortality %	3.954	3.131	1.419	0.5750	0.1957
Culling %	1.538	2.161	2.858	0.3595	0.3420

^a,bMeans within the same row with different superscripts differ significantly (P < 0.05).

¹Control, basal diet; HY250, basal diet + 250 g/ton hydrolyzed yeast (Kluyveromyces marxianus).; HY500, basal diet +500 g/ton hydrolyzed yeast (Kluyveromyces marxianus). SEM, standard error of means

Jejunal Morphology

Jejunal villus width, height and surface area were not affected by K. marxianus hydrolysate supplementation (Table 5). Dietary HY lowered (P < 0.05) jejunal crypt depth and enhanced (P < 0.05) the VH/CD ratio.

Table 5.

Jejunal morphology of 35 d broiler chickens supplemented with K. marxianus hydrolysate.

	Dietary treatment1
	Control	HY250	HY500	SEM	P value
Villus height (µm)	1108.28	1100.32	1066.64	20.9299	0.6922
Villus width (µm)	122.17	117.30	109.18	4.4495	0.5041
Surface area1 (µm2, 10−3)	425.13	405.18	365.68	17.8820	0.3895
Crypt depth (µm)	132.88a	115.06b	106.31b	2.1226	<0.0001
Villus height/crypt depth ratio	8.64b	9.69a	10.14a	0.1510	0.0009

^a,bMeans within the same row with different superscripts differ significantly (P < 0.05).

¹Control, basal diet; HY250, basal diet + 250 g/ton hydrolyzed yeast (Kluyveromyces marxianus).; HY500, basal diet +500 g/ton hydrolyzed yeast (Kluyveromyces marxianus). SEM, standard error of means.

Immune Indices

Dietary K. marxianus hydrolysate increased (P < 0.05) the ND titer and lymphocyte (L) count and decreased (P < 0.05) the heterophil (H) count and H/L ratio (Table 6). Compared with HY250 and the control, HY500 upregulated (P < 0.05) IL-10. K. marxianus hydrolysate supplementation did not affect the IL-6 and MDA concentration.

Table 6.

Immune indices in 28 d broiler chickens supplemented with K. marxianus hydrolysate.

	Dietary treatment1
Parameters	Control	HY250	HY500	Pool SE	P-value
Newcastle Disease titer	2.453b	2.801a	2.842a	0.0134	<0.0001
Lymphocytes (%)	67.29b	72.18a	72.18a	0.7053	0.0083
Heterophils (%)	24.39a	19.86b	19.04b	0.7265	0.0067
H/L ratio	0.34a	0.24b	0.26b	0.1662	0.0129
Malondialdehyde (uM/100 uL serum)	0.0601	0.0595	0.0585	0.0004	0.3291
Interleukin 6 (pg/mL)	543.54	447.66	524.94	21.2164	0.1646
Interleukin 10 (pg/mL)	2.050b	2.053b	2.316a	0.0554	0.0443

^a,bMeans within the same row with different superscripts differ significantly (P < 0.05).

¹Control, basal diet; HY250, basal diet + 250 g/ton hydrolyzed yeast (Kluyveromyces marxianus).; HY500, basal diet +500 g/ton hydrolyzed yeast (Kluyveromyces marxianus). SEM, standard error of means

Diversity and abundance of the cecal microbiota

To evaluate the influence of dietary K. marxianus hydrolysate on cecal microbial populations, the 16S rRNA-derived microbiota were analyzed at the phylum and order levels. Alpha-diversity analysis using the OTUs and Chao1 methods was used to determine taxa richness modified by HY supplementation. The α diversity of the cecal microbiota in the HY250 and HY500 groups was greater (P < 0.05) than that in the control group, as indicated by the OTU and Chao1 data (Figures 1A and 1B). In addition, changes in microbiota diversity were evaluated via β-diversity analysis (UniFrac), in which PCoA of UniFrac distance matrices was performed, and the results were statistically confirmed via PERMANOVA (Figures 1C and 1D). The results indicated that HY supplementation significantly changed the cecal microbial community [beta diversity analysis (Unifrac); (P < 0.001)]. A significant difference was found between the control and HY500 birds (P < 0.001).

Figure 1.

Alpha diversity (OTUs and Chao 1) and Beta-diversity (PCoA plot) of caecal microbiota of 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate.

Cecal Microbiota Composition

Six phyla, namely, Firmicutes (50–60%), Bacteroidetes (40–45%), Proteobacteria (0.50–1%), Actinobacteria (0.13–0.37%), Verrucomicrobia (1.7–6%), and Cyanobacteria (0.5–0.6%), were found (Figure 2). The abundance of Firmicutes increased (P < 0.05) in the HY500 treatment group compared to the control group. The abundance of Firmicutes in the HY250 treatment group was the same as that in the HY500 and control groups. The abundance of Actinobacteria in HY500 and HY250 was lower (P < 0.05) than that in the control. The abundances of Proteobacteria, Bacteroidetes, Verrucomicrobia, and Cyanobacteria were not influenced by HY supplementation.

Figure 2.

Phyla-level taxonomic distribution of cecal microbiota of 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate. Scatter plots represent the mean relative percentage of each bacteria population within samples. * (P < 0.05), ** (P < 0.01).

The abundance of five orders including Acidaminococcales, Bacteriodales, Clostridiales, Bacillales, and Verrucomicrobiales was not affected by HY supplementation (Figure 3). However, the HY500 birds had greater (P < 0.05) abundance of Lactobacillales than the control birds (Figure 3). The abundance of Lactobacillales in the HY250 birds did not differ from those of HY500 and control birds.

Figure 3.

Order-level taxonomic distribution of cecal microbiota of 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate. Scatter plots represent the mean relative percentage of each bacteria population within samples. * (P < 0.05), ** (P < 0.01).

Dietary K. marxianus hydrolysate altered (P < 0.05) the abundance of 8 higher-level taxa, including 2 classes (Bacilli and Clostridia), one order (Lactobacillales), one family (Streptococcaceae), and five genera (Streptococcus, Lachnospiraceae_uc, Akkermansiaceae, PACO01270_g, and LLKB_g), based on the LDA score (>2.0) and the Kruskal‒Wallis test (P < 0.05) (Figure 4A). The supplementation of HY500 increased the abundances of Bacilli, Clostridia, Lactobacillales, Streptococcaceae, Streptococcus, PACO01270_g, and Lachnospiraceae_uc while the HY250 supplementation increased (P < 0.05) the abundances of Akkermansiaceae and LLKB_g (Figure 4B).

Figure 4.

Characterization of cecal microbiome in 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate by linear discriminant analysis effect size (LEfSe) and linear discriminant analysis (LDA) score. (A) the histograms show the linear LDA score with the taxonomic representation of statistically and biologically consistent differences. (B) the cladograms representation of the taxa enriched with significantly different abundance of caecum microbial community. The statistical significance cutoff: absolute linear discriminant analysis (LDA) score log10 ≥ 2.0.

K. marxianus hydrolysate supplementation enhanced (P < 0.05) the abundance of Lactobacillus salivarious (0.20–1.24%) in a dose-dependent manner (Figure 5A). The abundance of Lactobacillus helveticus (0.91–10.19%) was greater (P < 0.05) in the HY500 group than in the control group (Figure 5B). The abundance of Lactobacillus helveticus in HY250 was similar to that of HY500 and the control.

Figure 5.

Lactobacillus salivarious and Lactobacillus helveticus in caeca of 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate. Scatter plots represent the mean relative percentage of each bacteria population within samples. * (P < 0.05), ** (P < 0.01).

Microbial Metabolic Pathways

MinPath is a parsimony method for reconstructing biological pathways using protein family predictions (Ye and Doak, 2009). Functional profiling of 16S rRNA sequences was performed to determine the metabolic potential of the cecal microbiota associated with HY supplementation. There were significant differences (2-sided Welch's t test) between the predicted cecal microbial metabolic pathways in the HY birds and those of the control birds (Figures 6A–6D). Both HY250 and HY500 regulated (P < 0.05) 20 metabolic pathways.

Figure 6.

Abundance of metabolic pathways. Predicted MinPath pathways in caeca microbial communities in 35 d old broilers supplemented with Kluyveromyces marxianus hydrolysate.

HY250 upregulated (P < 0.05) the sulfur metabolism, glycan degradation, C5-branched dibasic acid metabolism, basal transcription factor, synaptic vesicle cycle, caprolactam degradation, metabolism of xenobiotics by cytochrome P450, the AMPK signaling pathway, and cytokine‒cytokine receptor pathways and downregulated (P < 0.05) the nitrogen metabolism, cell cycle-yeast, mismatch repair, nucleotide excision repair, nucleotide sugar metabolism, and amino sugar metabolism pathways (Figures 6A–6B). HY500 downregulated (P < 0.05) lysosome, ascorbate and adorate metabolism, steroid hormone biosynthesis, the NF-kappa B signaling pathway, and meiosis yeast and (P < 0.05) upregulated ABC transporters, quorum sensing, 2-compartment systems, pyrimidine metabolism, peptidoglycan biosynthesis, seleno-compound metabolism, terpenoid backbone biosynthesis, and sulfur metabolism (Figures 6C and 6D). Furthermore, HY500 upregulated (P < 0.05) the pathways involved in amino acid (AA) metabolism, including the methionine, cysteine, thiamine, and phenylalanine metabolism pathways.

DISCUSSION

Overall, K. marxianus hydrolysate supplementation did not affect the growth performance of broilers raised at a stocking density of 45 kg/m². It appears that the HSD employed in this study masked the growth-promoting potential of K. marxianus hydrolysate. It seems that under stressful conditions, the bioactivities of K. marxianus hydrolysate are mainly oriented toward attenuating HSD-induced immunosuppression, with little or no stimulatory impact on production performance. To affirm this assertion, nevertheless, a comparison of the growth response of HY-supplemented broilers raised at HSD with broilers raised at normal stocking density is necessary. Our findings align with those of earlier studies in which dietary supplementation of S. cerevisiae in broilers subjected to HSD, heat stress and feed deprivation did not affect production performance (Nelson et al., 2018; Sobotik et al., 2022). Additionally, supplementation with probiotics (Vargas-Rodriguez et al., 2013) or prebiotics (Altaf et al., 2019) had no effect on growth performance in birds raised under a high stocking density.

An important finding in this study was the 73% and 87% reductions in broiler mortality in HY250 and HY500, respectively, from 25-35 d. Furthermore, the overall mortality decreased by 21% and 64% in HY250 and HY500, respectively, although these values were not significantly different from those in the control. Nonetheless, such reductions could assume commercial importance. The potential of K. marxianus hydrolysate to reduce mortality may be ascribed to its role in enhancing gut health and modulating the immune response, thereby reducing susceptibility to overstocking stress, which could have culminated in the death of the birds. Similarly, MOS supplementation reduced mortality in birds raised under HSD (Hooge et al., 2003). Furthermore, dietary yeast cell walls reduced mortality in immunocompromised broilers (Zhang et al., 2012) and in broilers challenged with necrotic enteritis and aflatoxin B1 (Liu et al., 2018). Nonetheless, other workers reported no impact of HY on the mortality of unstressed broilers (Sampath et al., 2021; Wang et al., 2022). Regardless of diet, the overall mortality in this study was < 5%.

Dietary K. marxianus hydrolysate reduced crypt depth and increased the jejunal VH/CD ratio. A decrease in crypt depth in broilers generally denotes improved gut health and reduced cell turnover in the intestinal lining (Nguyen et al., 2021). Shallower crypts indicate that there is less need for rapid regeneration of the intestinal epithelium (Wang et al., 2022; Lin et al., 2023). Lower crypt depth often correlates with taller villi. Since the crypts produce the cells that migrate to the villi, a decrease in crypt depth suggests a more mature and functional villus structure (Kyoung et al., 2023). The VH/CD ratio is a reliable indicator of intestinal functionality and development, and an increase in VH:CD signifies an increase in the surface area available for nutrient digestion and absorption (Yang et al., 2019). The improvement in jejunal architecture may be due to the ability of the K. marxianus hydrolysate components, MOS and β-glucan to bind pathogens and their receptors, thereby preventing them from colonizing the villi (Gao et al., 2008; Muthusamy et al., 2011). Moreover, K. marxianus hydrolysate contains nucleotides that are capable of enhancing intestinal development by promoting intestinal cell proliferation and maturation (Ortega et al., 2011). β-glucans and MOS can interact with the immune system to counteract inflammation-induced villi atrophy in the intestine (Han et al., 2017; Kim et al., 2019). Similar to our findings, HY reduced crypt depth and increased VH:CD in broilers (Wang et al., 2022; Lin et al., 2023). Furthermore, dietary MOS (Altaf et al., 2019) and S. cerevisiae (Awaad et al., 2019) improved VH:CD in broilers raised at HSD, while the yeast cell wall improved VH:CD in broilers (Kyoung et al., 2023).

Depending on the virulence of the virus strain involved, ND is a lethal and highly contagious infection whose outbreak can result in severe morbidity and mortality, especially in intensive broiler production, thereby causing considerable economic loss in high-throughput commercial broiler farms (Kapczynski et al., 2013; Ganar et al., 2014). Vaccination against NDs is highly necessary because maternal antibodies protect chicks only during the first week of life (Kapczynski et al., 2013). Overstocking stress could compromise the immune status of birds, thereby increasing their susceptibility to ND (Tuerkyilmaz, 2008; Houshmand et al., 2012). Dietary supplements may alleviate excessive stress-induced immunosuppression in broilers (Kridtayopas et al., 2019; Hafez et al., 2022; Sugiharto, 2022). Dietary K. marxianus hydrolysate increased the ND titer in broilers. Likewise, an increase in the ND titer in stressed broilers supplemented with HY (Wang et al., 2021) has been reported. Moreover, HY (Sampath et al., 2021; Muthusamy et al., 2011) and yeast-based products (Bi et al., 2020) enhanced the ND titer in unstressed broilers. Both MOS and β-glucan can modulate specific and nonspecific immune responses (Cheng et al., 2004; Cox et al., 2010; Khalaji et al., 2011). β-Glucans can activate phagocytes, which can stop or prevent bacterial infections and increase the antibody titer after vaccination (Cheng et al., 2004).

The H/L ratio is a reliable stress indicator in birds, with a lower H/L ratio indicating stress reduction (Gross and Siegel, 1983; Campo and Davila, 2002). Dietary K. marxianus hydrolysate reduced H/L, indicating decreased stress susceptibility. Consistently, yeast-based products reduced H/L in stressed (Nelson et al., 2020; Price et al., 2018; Sobotik et al., 2022) and unstressed (Paryad and Mahmoudi, 2008) broilers.

Cytokines can modulate cellular defense systems against stress-induced inflammatory responses (Shini et al., 2010; Kang et al., 2011). HY500 upregulated IL-10, suggesting a reduction in local and systemic inflammatory responses. The components of HY, β-glucan and MOS can modulate the expression of pattern recognition receptors by innate immune cells (Ferket et al., 2002; Mogensen, 2009). This finding concurs with that of Alizadeh et al. (2016), in which supplementation with yeast-derived products upregulated IL-10 in lipopolysaccharide-challenged broilers.

Changes in the gut microbiota can affect nutrient utilization, the immune response, health and productivity in birds (Mancabelli et al., 2016; Shang et al., 2018; Rychlik, 2020). It is well established that the cecum consists of a diverse and complex microbiota because of the longer transit time, which permits extensive fermentation processes (Qu et al., 2008). Our results provide an in-depth characterization of the ceca microbiota in broilers raised at 45 kg/m² in response to K. marxianus hydrolysate supplementation. The increase in α- and β-diversity in the HY birds suggested that K. marxianus hydrolysate can modulate the richness, evenness, and diversity of the ceca microbiota. Similar improvements in α- and β-diversity were found in the ceca of birds supplemented with yeast products (Chuang et al., 2021; Lin et al., 2023). An increase in microbial diversity in the gut has been associated with improvements in broiler health and productivity (Janczyk et al., 2009). The current results suggested improvements in gut health with no concomitant increase in productivity. While a healthy microbiota is generally beneficial, the specific composition of microbial communities might be more suited to maintaining health rather than enhancing growth (Yegani and Korver, 2008; Bae et al., 2017). Some beneficial microbes might prioritize immune modulation or pathogen resistance over promoting growth. Moreover, the interplay of diet, genetics, management practices, health status, environmental conditions, and the specific composition of the microbiota all contribute to the overall growth performance of broilers (Yegani and Korver, 2008; Janczyk et al., 2009).

The phyla Firmicutes, Verrucomicrobia, Proteobacteria, Actinobacteria, Bacteroidetes, and Cyanobacteria were present in the cecum of broilers raised at 45 kg/m². Consistent with these findings, previous studies have shown that the normal ceca microbiota fall within the aforementioned phyla (Xiao et al., 2017; Massacci et al., 2019; Bi et al., 2020; Rodrigues et al., 2020; Rama et al., 2023). Firmicutes and Bacteroidetes were the dominant phyla regardless of diet. Similar findings were found in broilers supplemented with HY (Lin et al., 2023) and yeast cell wall (Kyoung et al., 2023). Dietary K. marxianus hydrolysate enhanced and decreased the relative abundance of Firmicutes and Actinobacteria, respectively. Similarly, yeast (Chuang et al., 2021) and HY (Lin et al., 2023) supplementation improved the abundance of Firmicutes. An increased abundance of Firmicutes has been associated with improved nutrient and energy utilization (Turnbaugh et al., 2006). It appears that Firmicutes and Actinobacteria have an inverse relationship. Interactions between gut microflora in broilers can arise from competition for nutrients, ecological niches, and health status (Bae et al., 2017; Xiao et al., 2017; Farkas et al., 2022). Firmicutes are significant producers of short-chain fatty acids, which can lower gut pH. While this environment supports Firmicutes, it might not be as favorable for some Actinobacteria, leading to their reduced abundance (Bae et al., 2017; Xiao et al., 2017). Firmicutes and Actinobacteria might occupy different ecological niches within the gut. If environmental conditions change to favor one niche over another, the population of the favored group could increase while the other decreases (Bae et al., 2017; Xiao et al., 2017). An inverse relationship between Firmicutes-Bacteroidetes and Actinobacteria has been established (Li and Ma, 2020).

HY250 and HY500 differ in their impact on bacterial class, order, family and genera. While HY500 increased the abundance of two classes (Bacilli and Clostridia), one order (Lactobacillales), one family (Streptococcaceae), and five genera (Streptococcus, Lachnospiraceae_uc, and PACO01270_g), HY250 increased the abundance of only Akkermansiaceae and LLKB_g. This observation suggested that the response of the bacterial class, order, family and genera to K. marxianus hydrolysate supplementation was dose dependent. Moreover, dietary K. marxianus hydrolysate enhanced the abundance of Lactobacillus salivarious, Lactobacillus helveticus and Akkermansia spp. This could be attributed to the potential of K. marxianus hydrolysate as a prebiotic, which serves as a substrate or nutrient source for probiotics, thereby selectively enhancing their growth and proliferation (Markowiak and Śliżewska, 2018). In line with our findings, S. cerevisiae supplementation increased ceca Lactobacillus counts in chickens raised at HSD (Awaad et al., 2019), while Lin et al. (2023) reported that HY enhanced Lactobacillus in the ilea of broilers. Akkermansia spp. are present mainly in the intestinal mucosa, which serves as an interface between gut microbes and host tissues and thus enhances gut integrity (Solar et al., 2019). Moreover, the abundance of Akkermansia spp. is inversely associated with host metabolic diseases, suggesting that Akkermansia spp. have protective and anti-inflammatory potential (Hänninen et al., 2018). Lactobacillus spp. is among the major genera in the chicken cecum and produce short-chain fatty acids (SCFAs) that can antagonize pathogens and promote gut morphology (Servin, 2004). An increase in the abundance of Lactobacillus salivarious, Lactobacillus helveticus and Akkermansia spp. is highly important because of their ability to alleviate stress-induced immunosuppression and impair gut health and integrity (Liang et al., 2015; Hänninen et al., 2018).

The pattern of alterations in microbial metabolism pathways induced by K. marxianus hydrolysate supplementation suggested that most of the upregulated pathways were associated with improvements in energy and nutrient metabolism, while the downregulated pathways were related to decreases in inflammatory responses. The upregulation of energy metabolism pathways is consistent with the increase in the abundance of Lactobacillus and Akkermansia spp., both of which can synthesize SCFAs to promote their colonization and provide energy to the host (LeBlanc et al., 2017; Liu et al., 2022). Similar to the current findings, dietary probiotics enhanced energy metabolism pathways in broilers (Rodrigues et al., 2020). Interestingly, HY500 upregulated AA metabolism pathways. Recent evidence has indicated that aromatic AA can be fermented by microbes to form phenylpropanoid metabolites, including 4-hydroxyphenyl-acetic acid and phenylacetic acid, which are abundant in feces (Russell et al., 2013). In addition, Dai et al. (2010) reported that the bacterial conversion of free AA into polypeptides contributed immensely to AA metabolism and bioavailability. Given the improvements in the energy and nutrient metabolism pathways in the HY birds, a concomitant improvement in growth performance would be expected. The current findings suggest that the improvements in energy and nutrient metabolism pathways by K. marxianus hydrolysate supplementation are directed toward ameliorating the negative impacts of HSD on immunity, gut health and integrity. Nonetheless, to affirm this finding, a comparison of the ceca microbiome of HY-supplemented broilers raised at HSD with broilers raised at normal stocking density is necessary.

CONCLUSIONS

The results of this study showed that dietary K. marxianus hydrolysate had no effect on the overall growth performance of broilers but reduced mortality at 25 to 35 d. Dietary K. marxianus hydrolysate improved jejunal morphology, suggesting an improvement in gut integrity. K. marxianus hydrolysate supplementation improved the ND titer and H/L ratio and upregulated IL-10, indicating improvements in immunity and reductions in inflammatory responses. K. marxianus hydrolysate supplementation enhanced bacterial diversity and distribution, enhanced the abundance of Lactobacillus and Akkermansia spp. and altered cecal microbial metabolic pathways, especially energy and AA, indicating improvements in gut health. Thus, dietary supplementation with K. marxianus hydrolysate at 500 g/ton can improve humoral immunity, jejunal morphology, ceca microbiota and metabolic pathways in broiler chickens raised at 45 kg/m².

DISCLOSURES

The authors declare no conflicts of interest.