Abstract
Background
Hypertrophic scars (HS) are dermal diseases characterized by excessive fibroblast proliferation and collagen deposition following burns or trauma. While Tenascin-C (TNC)’s role in promoting visceral fibrosis has been established, its impact on skin tissue fibrosis remains unclear. This study aims to investigate the effects of TNC on HS.
Methods
RNA sequence and IHC techniques were used to examine the upregulation of TNC gene in human hypertrophic scar tissue compared to normal tissues. Knockdown of TNC in Human skin fibroblasts (HFF-1) cells was achieved, and expression of Col1 and Col3 was evaluated using qPCR. Sirius red collagen staining assessed impact on total collagen content and ECM deposition. Effects on cell proliferation and migration were investigated through cck-8 and cell scratch experiments. Lentivirus infection was used to knock out TNC, and resulting samples were injected into ear wound of rabbits. Effects of TNC knockout on ear scar formation were measured using digital morphology, ultrasound, SEI, H&E, and Masson trichrome methods.
Results
Cell experiments: downregulation of TNC decreased Col1 and Col3 expression, leading to reduced collagen production and extracellular matrix deposition. It did not affect HFF-1 cell proliferation and migration. Animal experiments: TNC knockdown promoted wound healing and reduced collagen deposition in rabbit ears.
Conclusion
This study suggests that knocking down TNC inhibits collagen formation and extracellular matrix deposition, thereby inhibiting hypertrophic scar formation. Therefore, TNC can be considered a potential biomarker for HS formation and may offer promising treatment strategies for clinical management of hypertrophic scars.
Keywords: Tenascin-C, hypertrophic scars, rabbit ear scar model, HFF-1
Introduction
Hypertrophic scars (HS) are a prevalent fibroproliferative skin disease that can cause pain, itching, limited joint mobility, and deformities, significantly impacting the mental well-being of patients.1 The characteristics of HS include excessive proliferation of skin fibroblasts, increased collagen generation, and deposition of extracellular matrix (ECM).2 Numerous studies have investigated the underlying causes of HS, including genetics, biomechanics, metabolism, endocrinology, and immunology.3 Type I and type III collagen are the primary components of ECM and play a crucial role in the development and progression of HS, with increased expression in HS tissues. Current treatment options for HS include surgery, radiotherapy, and combination therapy.4,5 However, their effectiveness is still uncertain, highlighting the need for an efficient, convenient, sustainable, low-cost, and minimally side-effect treatment method that inhibits collagen production and ECM deposition.
In recent years, there has been a growing interest in scar formation, particularly in relation to experimental and genomic factors.6 It is widely acknowledged that various biochemical stimuli during wound healing, such as physical tension, the expression of transforming growth factor β genes, and abnormal proliferation of fibroblasts, play a significant role in the development of pathological scars.7,8 In order to gain a better understanding of scar management, we have conducted an analysis of genes and their regulatory factors. The molecular mechanism behind the formation of hypertrophic scars has attracted considerable attention, as it holds potential for gene therapy of HS.9,10 Existing evidence suggests that Tenascin-C (TNC) is expressed during embryogenesis, cancer transformation, and wound healing.11,12 Although TNC expression is relatively low in normal adult skin, it significantly increases during the process of wound healing.13,14 TNC is known to play a crucial role in the development of various fibrosis conditions.15,16 In our study, we observed a significant elevation in TNC expression in hypertrophic scars compared to normal skin tissue. Knocking down TNC effectively inhibited collagen production and ECM deposition in human skin fibroblasts, improving tissue structure and inhibiting hypertrophic scar formation. This effect may be achieved through involvement of the TGF-β signaling pathway, and PI3K-Akt signaling pathway, shedding light on potential mechanisms underlying HS formation and providing a novel strategy for clinical treatment of HS.4,17
Materials and Methods
Organizational Sample Collection
Our research complies with the Declaration of Helsinki. 27 samples of hypertrophic scar (HS) tissues and their corresponding normal tissues were acquired from 27 patients who underwent fracture internal fixation device removal and scar resection surgery at the Orthopedics Department of Shanghai 10th People’s Hospital. It is approved by the Clinical Research Committee of Shanghai Tenth People’s Hospital (IRB No: SHSY-IEC-5.0/22K213/P01). Additionally, the study is registered on Clinical-Trial.gov and the identifier number is ChiCTR2300069087. A routine pathological examination confirmed the diagnosis of hypertrophic scars. The collected skin samples were divided into two sections: one for histological examination, and the other was frozen in liquid nitrogen for total RNA preparation.
Organizational Analysis
The tissue sample was sliced and fixed in a 4% formaldehyde solution. All samples were embedded in paraffin with a slice thickness of 4 μm and placed on glass slides. The slides were dewaxed and stained with standard Hematoxylin eosin (H&E) or Masson trichrome. As mentioned earlier, immunohistochemical staining of TNC (Abcam, ab108930) was performed using the DAKO kit (DAKO Corp., Carpentaria, CA, USA). All slides were examined under an optical microscope (Leica Microsystems, Wetzlar, Germany).
Cell Culture
Human skin fibroblasts (HFF-1 cells, American Type Culture Collection) were cultured in DMEM medium containing 15% FBS (Invitrogen, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum, 100 μg/mL streptomycin, and 100 U/mL penicillin. The cells were placed in an incubator at 37°C and 5% CO2 with saturated humidity, and the medium was changed every other day. All cells were digested with 0.25% trypsin (containing 0.05% EDTA) and passaged at a 1:3 volume ratio, with each experiment using cells from the same passage.
Small Interfering RNA (siRNA) Synthesis and Cell Transfection
The negative control and positive control were designed and synthesized by Shanghai Jiman Biotechnology Co., Ltd. Additionally, two pairs of TNC siRNA sequences, namely TNC siRNA-1 and TNC siRNA-2, along with the negative control NC siRNA, were designed and synthesized. The primer sequences are as follows: NC siRNA forward primer, 5’-UCUCCGAACGUGUCACGUdTdT3’, reverse primer, 5’-ACGUGACACGUUCGGAGAAdTdT3’; TNC siRNA-1 forward primer, 5’-CAGAGUACCUUGUCGUUAtt3’, reverse primer, 5’-UACACACAAGUACUCUGutt3’; TNC siRNA-2 forward primer, 5’-CUGAAAUUGGAAACUUAAAtt3’, reverse primer, 5’-UUAAGUUCCAAAUUCAGtt3’. Cells were seeded at a density of 2×106 cells/well in a 6-well plate and transfected when they reached a confluence of 40% to 50%. The cells were divided into three groups: negative control+jetPRIME®, TNC siRNA-1+jetPRIME®, and TNC siRNA-2+jetPRIME®. During transfection, the jetPRIME® transfection reagents were used according to the instructions. After 4 hours of transfection, the DMEM culture medium containing 10% FBS was replaced, and the cells were further cultured for 24 hours before being used for subsequent experiments.
RNA Extraction and RT qPCR
Each tissue and corresponding cultured cells were isolated using TRIzol reagents (Invitrogen, Carlsbad, CA, USA) to extract total RNA. The RNA quantity was measured using a NanoDrop ND-1000 spectrophotometer. Then, the RNA was converted into cDNA using a first strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) and a thermal cycler (S1000, Bio Rad, Berkeley, CA, USA). Quantitative reverse transcription PCR was performed using the SYBR Green qPCR mixture (Invitrogen, Carlsbad, CA, USA) on the Applied Biosystems ViiA ™ 7 Dx instrument (American Life Technology Company). The amplification and detection efficiency of all primers were verified by measuring the Ct slope and dilution sequences. The transcription level of TNC was normalized to the GAPDH cDNA level using the standard curve method. The primer sequences were as follows: human TNC forward primer, 5’- AGGGGCAAGTGCGTAAATGGAG3’, reverse primer, 5’- TGGGGCAGATTCACGGTG3’; Human GAPDH forward primer, 5’- CAGGAGGCATTGCTGATGATGAT3’, reverse primer, 5’- GAAGGCTGGGGCATTT3’; Human Collagen Type I forward primer, 5’- GAGGGCCAAGAGAAGACATC3’, reverse primer, 5’- CAGATCACGTCATCGCACAAC3’; Human Collagen Type III forward primer, 5’- GCCAAATATATTGTCTGACTCA3’, reverse primer, 5’- GGGCGAGTAGGAGCAGTTG3’; Rabbit TNC forward primer, 5’- CAAACTACCTGCCGAA3’, reverse primer, 5’- CTGCAAAAGCCGTCATCAC3’; Rabbit GAPDH forward primer, 5’- CATCTTCCAGGAGCGAGAT3’, reverse primer, 5’- TGATGACCTTGGCTCCG3’. The primer specificity of TNC and GAPDH was confirmed using Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). Each value represents the average of three independent experiments using the same sample. The box plot shows the normalized values for each group.
RNA Seq Analysis
For each sample, 1 µg of total RNA was used for RNA sequencing library preparation using the VAHTS chain mRNA sequencing library preparation kit (Vazyme). The mRNA was purified, fragmented, and converted into double stranded cDNA. The cDNA was then ligated to the VAHTS RNA adaptor (Vazyme) after terminal repair and addition of a single deoxygenated Adenine A. The purified ligated products corresponding to 200–500 bps were digested with heat-resistant UDG, amplified, purified, quantified, and stored at −80 °C prior to sequencing. For high-throughput sequencing, a library was prepared according to the protocol requirements and applied to the Illumina HiSeq XTen system for 150 nt paired-end sequencing. The raw data underwent quality evaluation, including base quality, sequence length, and redundancy, to obtain valid data. The valid data was compared to the reference genome to obtain genome alignment results, and the gene expression level was evaluated using FPKM values. Differential gene expression was determined through statistical analysis. Finally, KEGG analysis was performed on differentially expressed genes to identify enriched cellular pathways.
Cell Count Kit 8 (CCK-8) Analysis
Cell proliferation was analyzed using the CCK-8 Kit (Vazyme Biotech Co., LTD, Nanjing, China). Briefly, HFF-1 cells were seeded at a density of 12×103 cells per well in a 96-well plate and transfected with siRNA using jetPRIME transfection reagent after 12 hours. After 36 hours of transfection, 10 µL of CCK-8 solution was added to each well. After 1.5 hours of incubation, the absorbance was measured at 450 nm using a reader from Molecular Devices, Sunnyvale, CA, USA.
Cell Migration Assay
An in vitro scratch assay was performed to evaluate cell migration. Cells were seeded and allowed to attach to a culture insert containing DMEM in a 35 mm cell culture dish (Ibidi GMBH, Martinsried, Germany). The cells were cultured in DMEM supplemented with 10% FBS until they reached 100% confluency. After 24 hours of serum starvation with DMEM supplemented with 0.5% FBS, a 200 µL pipette tip was used to create a single-layer scratch by scraping the cells. The scratches were then rinsed four times with PBS. Digital photos of the scratch area were captured using an optical microscope (Olympus CKX41, Olympus, Tokyo, Japan). The distance between the scratch edges at four points along the scratch line was measured using Image Pro Plus 6.0 software.
Measurement of Total Collagen Production
HFF-1 cells were seeded onto a 6-well plate and incubated at 37 °C and 5% CO2 for 24 hours. The cells were then transfected with TNC siRNA-1, TNC siRNA-2, or NC siRNA using the aforementioned methods. After 36 hours of transfection, Sirius Red dye was added, and the cells were cultured at 37 °C for 90 minutes. The cells were then washed with tap water and air-dried overnight. The Sirius Red dye was dissolved in sodium hydroxide, and the absorbance was read at 540 nm using a microplate reader (Molecular Devices, Sunnyvale, CA, USA).
Establishment of a Rabbit Ear Hypertrophic Scar Model
Adult New Zealand White Rabbits (3–4 months old, weighing 2.5–3.0 kilograms, no gender restriction) were obtained from Shanghai Jiagan Biotechnology Co., Ltd. All animal experiments in this study were accomplished in accordance with the National Institutes of Health lines for the Care and Use of Laboratory animals and approved by the ethical guidelines of Animal Ethics Committee of Tenth People’s Hospital, Shanghai, China (approval no. SHDSYY-2022-6349). As described above, the rabbits were anesthetized with Pentobarbital sodium (30 mg/kg), and four full-thickness circles with a diameter of 10 mm were created under the perichondrium (excluding perichondrium) on the ventral surface of each ear. Pressure was applied to stop bleeding after the wounds were made. The wounds were then left exposed to air, and daily removal of secretions was performed to observe the wound healing process.
Construction of Plasmids and Lentivirus Production
Three shRNAs were selected based on the rabbit TNC gene sequence (Gene ID: 100301551). A scrambled shRNA was used as a control. The target sequences were as follows: shRNA1: 5’-CATCGACAGTTACCGAATTAA-3’; shRNA2: 5’-GGGCTATGATGCCAGTGAAAT-3’; shRNA3: 5’-CAGACCATCTCACACAATT-3’; scrambled shRNA: 5’-TTCTCCGAACGTCACGT-3’. Oligonucleotides were synthesized (Invitrogen), annealed, and cloned into the pGMLV-SC5 RNAi vector (Jiman Biotechnology (Shanghai) Co., Ltd). All final clones were validated by sequencing. The degree of TNC inhibition by different shRNA plasmids was evaluated by real-time PCR, and the most effective silencing plasmid targeting TNC was selected. The shRNA TNC lentiviral vector containing the most effective shRNA sequence and the pPACK packaging plasmid mixture (Jiman Biotechnology (Shanghai) Co., Ltd). were co-transfected into 293TN cells using Lipofectamine 2000. After 48 hours, the infectious lentivirus was collected, centrifuged to remove cell debris, and filtered through a 0.45 µm PVDF filter (Millipore, USA). 293T cells were infected with the concentrated lentivirus, and the virus titer was determined to be 3.1×104 ifu/µL. TNC knockdown efficiency was detected by qPCR after administering the lentivirus to the animals and collecting tissue samples.
Experimental Design and Administration
A total of 8 rabbits were included in the study. From the 21st to the 25th day after surgery, the scars were divided into four groups (16 scars/group): BC control group, PBS treatment group, NC treatment group, and TNC treatment group. Subcutaneous injections of PBS (40 µL/piece), high titer (1 × 1010 plaque forming units/mL) recombinant lentivirus TNC (infection multiplicity (MOI) = 50/branch), or empty lentivirus NC (MOI = 50/needle) were performed once a day to treat the scars. Prior to subcutaneous injection treatment, the scar elevation index and ultrasonography were performed to determine the scar thickness. On the 21st, 23rd, 25th, 27th, and 35th days post-surgery, the scar elevation index was calculated, and the rabbits were euthanized on the 35th day after the operation. Prior to euthanasia, the extent of scar hyperplasia was assessed using ultrasound. After euthanasia, scar tissue was collected from the rabbit ears under deep anesthesia. The scar was then longitudinally incised, fixed with 4% Paraformaldehyde, and subjected to paraffin embedding and 5 μm thick tissue sectioning. Subsequently, the sections were stained with Hematoxylin and Eosin (H&E) as well as Masson’s trichrome, and examined under a light microscope (Nikon, Tokyo, Japan). The double-blind method used in the establishment of animal models and the injection process of lentivirus is unknown to the modelers and data collection analysts, in order to ensure the reliability of the experimental results to the greatest extent possible.
Evaluation of Scar Enhancement Index
To quantify the extent of scar proliferation, the Scar Enhancement Index (SEI) was calculated using H&E-stained sections of the wounds. SEI is defined as the ratio of the length of a line perpendicular to the surface, extending from the scar/skin epithelium to the opposite side of the scar, to the length of the same line on normal skin. A blinded examiner utilized Image Pro Plus 6.0 software (Media Cybernetics in Rockville, Maryland) to measure the SEI for each wound.
Results
In our study, participants were selected based on the following inclusion criteria: 1. Age ≥ 18 years old; 2. More than 1 year post-fracture internal fixation surgery; 3. Clinically diagnosed with hypertrophic scars, or confirmed to have hypertrophic scars through postoperative pathological diagnosis in cases where clinical diagnosis was unclear; 4. No previous treatment for hypertrophic scars, including surgery, radiotherapy, local injection of botulinum toxin, hormone therapy, laser therapy, etc.; 5. No oral antibiotic usage or systemic treatment with intravenous antibiotics within the past 3 months; 6. Willingness to participate in the survey voluntarily. Exclusion criteria were as follows: 1. Patients under 18 years old; 2. Clinical diagnosis of keloid; 3. Antibiotic usage or systemic treatment with intravenous antibiotics in the past three months; 4. Resistance and unwillingness to participate in the investigation; 5. Lack of legal capacity or limited legal capacity. A total of 27 patients were enrolled, and the experimental procedure is illustrated in Figure 1.
Figure 1.
The experimental process.
Elevated TNC Expression in Hypertrophic Scar Tissue
Clinical samples were collected and divided into two groups: hypertrophic scar group (HS) and surrounding normal skin (NS), as depicted in Figure 2A. RNA sequencing technology was employed to detect gene expression profiles in human hypertrophic scar and surrounding normal tissues, aiming to identify differentially expressed genes and related signaling pathways. The Results revealed significant expression differences among three sample pairs, as shown in Figure 2B. Numerous genes exhibited upregulation or downregulation in hypertrophic scar tissue compared to the surrounding normal skin, with 971 genes upregulated and 941 genes downregulated, including a significant increase in TNC expression (Figure 2C and D). Differential gene clustering analysis was performed on the combined set of significantly differentially expressed genes, generating a differential gene clustering map, as shown in Figure 2E. To further validate the biological role of differentially expressed genes in hypertrophic scar development, KEGG enrichment analysis was conducted. The analysis of upregulated gene pathways revealed that the P13K-Akt signaling pathway promotes inflammation and endothelial cell proliferation while inhibiting hypertrophic scar formation, as depicted in Figure 2F.
Figure 2.
Gene expression profiles of human HS and NC differential genes and related signaling pathways. (A) Clinical scar samples and sampling schematic diagram. (B) Composition analysis of two sets of samples. (C) Volcanic maps show genes that express differences. (D) Differential gene clustering heat map is shown, and compared to non-hypertrophic scars, there are 25 genes upregulated and 288 genes downregulated in the skin hypertrophic scar. (E) KEGG enrichment analysis of differentially expressed genes in HS. (F) It was found that the P13K-Akt signaling pathway promotes inflammation and endothelial cell proliferation, while also inhibiting the formation of HS.
Histopathology
H&E and Masson staining were performed on hypertrophic scar and surrounding normal tissues from the patients (Figure 3a and b). The histopathological examination of hypertrophic scar tissue revealed thickened and irregularly arranged collagen fibers, with collagen nodules and increased fibroblast infiltration. The number and volume of fibroblasts were also elevated, accompanied by abundant cytoplasm. In contrast, the surrounding normal skin tissue exhibited rich skin accessory organs such as sweat glands, hair follicles, and sebaceous glands, as well as numerous capillaries and other skin tissue structures. Immunohistochemical analysis using anti-TNC antibodies and DAB staining was performed to evaluate the relative expression level and subcellular localization of TNC proteins in paraffin-embedded NS and HS tissue samples. A strong TNC immune response was observed in the cytoplasm of DAB-stained cells in HS tissue, resembling the morphological characteristics of epithelial cells and dermal fibroblasts. In comparison, a weak TNC immune response was detected in the corresponding cells of NS tissue, confirming the significantly higher TNC expression in the HS group than in the NS group (Figure 3c and dii).
Figure 3.
Pathological Histogram (a and b): HS patients have a large amount of thickened and irregularly arranged collagen fibers, which are thick and some can form collagen nodules. In NS patients, the subcutaneous collagen fibers are arranged regularly, and the skin tissue structure is present and normal. (c and dii) Immunohistochemistry showed a strong TNC immune response in HS tissue, which was significantly different from the NS group (****p<0.001).
Knocking Down TNC Inhibits Fibrosis-Promoting Markers in HFF-1
To assess the impact of TNC knockdown on inhibiting hypertrophic scar fibrosis, qPCR was conducted to measure TNC expression levels after transfecting HFF-1 cells with TNC siRNA. The results demonstrated significantly reduced TNC expression in the TNC siRNA-1 and TNC siRNA-2 groups compared to the control group (p<0.001), as depicted in Figure 4. A. Knocking down TNC led to a significant downregulation of type I and type III collagen expression in HFF-1 cells (p<0.001) (Figure 4B and C). Additionally, Sirius red staining of total collagen followed by quantitative analysis revealed that TNC knockdown significantly inhibited extracellular matrix synthesis and total collagen production (p<0.01), as depicted in Figure 4D. These findings indicate that knocking down TNC suppresses the biological function of HFF-1 cells, thereby alleviating fibrosis.
Figure 4.
Cell level validation (A) Significant decrease in TNC expression level after HFF-1 transfection with TNC siRNA. (B and C) Knocking down TNC can significantly downregulate the expression of type I and type III collagen in HFF-1 (****p<0.001). (D) Sirius red staining showed that knocking down TNC could significantly inhibit the synthesis of extracellular matrix and the production of total collagen (**p<0.01). (E) Cell scratch test confirmed that knocking down TNC had no significant effect on Cell migration (p>0.05). (F) Statistical analysis chart of cell scratch experiment. (G) CCK-8 validation showed that knocking down TNC had no significant effect on cell proliferation ability (p>0.05).
Knocking Down TNC Does Not Significantly Affect HFF-1 Proliferation and Migration
To further evaluate the effect of TNC knockdown on cell migration, a cell scratch test was conducted. The results demonstrated that knocking down TNC inhibited HFF-1 migration, as observed in the wound scratch assay (Figure 4E). However, there was no statistically significant difference in the migration distance between the TNC siRNA-1 and TNC siRNA-2 groups compared to the control group (Figure 4F). Regarding cell proliferation, CCK-8 results indicated that knocking down TNC did not significantly affect HFF-1 cell proliferation (Figure 4G). These results suggest that knocking down TNC inhibits fibrosis occurrence and development without affecting HFF-1 cell proliferation and migration.
Knocking Down TNC Inhibits Wound Healing and Reduces Collagen Deposition in a New Zealand White Rabbit Ear Scar Model
The animal model of hypertrophic scar differs from humans in terms of skin and subcutaneous tissue structure. In this study, to investigate the effect of TNC knockdown in animal models, a full-layer defect was created on the dorsal ventral surface of New Zealand white rabbits. A pGMLV-SC5 RNAi sequence vector was constructed (Figure 5A), and an shTNC plasmid was synthesized. Lentivirus-mediated delivery of NC, TNC, and PBS was subcutaneously injected. qPCR analysis confirmed a significant decrease in TNC expression in the Ad-TNC group compared to the control group (***p<0.001), as shown in Figure 5B. Subcutaneous administration of the corresponding medication was performed daily from the 21st to the 25th day of wound healing. The scar thickness was measured on the 0th, 14th, 21st, 23rd, 25th, and 35th day of wound healing, and the appearance of hypertrophic scars was documented using digital photographs (Figure 5C). The photos revealed that knocking down TNC significantly promoted wound healing (Figure 5D). Scar thickness was measured on the 35th day using LOGIC E9 (GE, America). The TNC group exhibited significantly reduced wound area, scar thickness, and collagen deposition compared to the NC and PBS groups (Figure 5E). Samples were collected on the 35th day, and qPCR analysis confirmed a significant decrease in TNC expression in the Ad-TNC group compared to the control group (p<0.001), as shown in Figure 5F. H&E and Masson’s trichrome staining were performed to evaluate re-epithelialization and collagen deposition. The thickness of scar hyperplasia in the TNC group was significantly reduced compared to the NC and PBS groups (*p<0.05), and extremely significantly reduced compared to the BC group (p<0.001) (Figure 5G and H). The knockdown TNC group had faster wound healing, less collagen deposition, thinner collagen structure, and orderly arrangement. In vivo research further confirms the anti-fibrotic properties of knocking down TNC and potential strategies for clinical treatment.
Figure 5.
Animal level validation. (A) Construction of pGMLV-SC5 RNAi sequence vector. (B) shTNC can significantly reduce the gene expression of TNC in rabbit ear scars. (C) Animal Experiment Flow Chart. (D) Digital photos showing the process of wound healing. (E) Scar ultrasound on the 35th day. (F) Dynamic monitoring and analysis chart of scar thickness. (G and H) The degree of collagen deposition was evaluated by H&E and Masson’s trichrome staining. The thickness of scar hyperplasia in the Ad-TNC group was significantly reduced compared to the Ad-NC and PBS groups (p<**0.05) and extremely significantly reduced compared to the BC group (p<***0.001).
Discussion and Conclusion
The formation of hypertrophic scars is an aberrant wound healing response following trauma.18 Histologically and clinically, hypertrophic scars are distinguished by the proliferation of fibroblasts and excessive deposition of extracellular matrix.19 Nevertheless, the existing conservative treatment options for hypertrophic scars, including radiotherapy, laser therapy, and interferon therapy, have limitations and are unable to fully prevent scar formation by inhibiting fibroblast proliferation and extracellular matrix deposition.20 Fibroblasts promote the deposition of extracellular matrix by secreting ECM components such as collagen. Secondly, receptors such as integrins on the cell surface participate in the deposition of extracellular matrix by binding to ECM molecules.21 In addition, the degradation enzymes of the extracellular matrix also participate in the dynamic regulation of the extracellular matrix, maintaining its homeostasis by degrading and rebuilding the ECM. These mechanisms collectively regulate the deposition and dynamic changes of extracellular matrix.22 Consequently, researchers have undertaken investigations into other potential unidentified factors that may contribute to hypertrophic scar formation, in order to develop novel strategies for managing scar formation.
Transcriptome sequencing analysis in our study revealed a significant upregulation of TNC in hypertrophic scar tissue. TNC, a large hexameric extracellular matrix glycoprotein, is expressed during embryogenesis, cancer development, and wound healing.23 Although its expression level is relatively low in normal adult skin, it is significantly increased during wound healing.24 Previous studies have reported the upregulation of TNC through TGF-β1, promoting the deposition of extracellular matrix proteins and leading to pulmonary fibrosis.25 Additionally, TNC upregulation has been associated with renal fibrosis through the activation of the STAT3 pathway and angiogenesis in proliferative diabetic retinopathy.26 However, there is a lack of research on the proliferative effect of TNC on human skin fibroblasts and its role in promoting the formation of hypertrophic scars. This suggests that TNC expression may be related to the formation of hypertrophic scars. TNC can activate signaling pathways by binding to cell surface receptors, promote the expression of collagen synthesis genes, and also bind to cell surface receptors to promote cell adhesion to the matrix, thereby affecting cell function and metabolic activity, thereby affecting collagen production.27 In addition, TNC can affect the synthesis of collagen by regulating the activity of fibroblasts. Research has shown that TNC may directly or indirectly affect the transcription of collagen synthesis genes by regulating the activity or expression level of transcription factors, thereby regulating collagen production. TNC can also activate specific signaling pathways, such as the MAPK signaling pathway The PI3K/AKT signaling pathway affects the expression of intracellular related genes, thereby regulating collagen production.28
To further investigate the biological function of TNC in reducing fibrosis and its impact on hypertrophic scars, our study employed cell experiments and a rabbit ear hypertrophic scar model. The findings revealed that the downregulation of TNC significantly enhanced the normal healing process of wounds, suppressed the cell-mediated production of type I and type III collagen, decreased excessive deposition of extracellular matrix, and enhanced the overall appearance of hypertrophic scars, resulting in a smoother texture. Scar evaluation using the scar elevation index (SEI) analysis demonstrated notable differences in scar thickness reduction among the groups. Additionally, pathological histology indicated improved collagen fiber arrangement and reduced collagen content in the TNC knockdown group.
In terms of safety, none of the New Zealand white rabbits receiving local subcutaneous injection of TNC showed significant side effects or death, indicating that local knockdown of TNC currently does not exhibit toxic side effects.29 Further research on the function of TNC may provide new avenues for controlling the formation of hypertrophic scars. At present, the treatment methods for hypertrophic scars include laser therapy, radiofrequency therapy, and radiofrequency microneedle therapy. However, these treatment methods have problems such as long treatment cycles, unstable treatment effects, and high recurrence rates.30 However, hypertrophic scars are often accompanied by symptoms such as itching, pain, and pigmentation, which pose significant challenges to the patient’s life and mental health. Therefore, we urgently need to find a more effective intervention method. Future studies should explore ways to improve the local administration of TNC inhibitors, such as surface spraying or application, to enhance patient comfort and compliance with treatment. Additionally, further research is needed to elucidate the molecular mechanisms involved.31 Our findings suggest that TNC is involved in multiple signaling pathways related to inflammatory response, positive regulation of cell proliferation, and regulation of angiogenesis. Further exploration is necessary to determine the extent of TNC’s involvement in these pathways and its role in the occurrence and development of hypertrophic scars.
Our study confirms that knocking down TNC has minimal effect on the proliferation and migration ability of human skin fibroblasts, but it significantly inhibits collagen production and extracellular matrix deposition, thereby inhibiting the formation of hypertrophic scars. The involvement of the PI3K-Akt signaling pathway suggests its potential mechanism in hypertrophic scar formation, providing a new strategy for the clinical treatment of hypertrophic scars.
Funding Statement
This work was supported by the Science and Technology Commission of Shanghai Municipality (STCSM) under Grant [No.19411950102].
Data Sharing Statement
The data that support the findings of this study are openly available in Figshare at https://doi.org/10.6084/m9.figshare.26065447.v1.
Statement of Ethics
This study is approved by the Clinical Research Committee of Shanghai 10th People’s Hospital and the Ethics Committee of Shanghai 10th People’s Hospital (IRB No: SHSY-IEC-5.0/22K213/P01). Additionally, the study is registered on Clinical-Trial.gov and the identifier number is ChiCTR2300069087. And obtained written informed consent from each participant.
Disclosure
The authors have no conflicts of interest to declare in this work.
References
- 1.Luo QF. The combined application of bleomycin and triamcinolone for the treatment of keloids and hypertrophic scars: an effective therapy for treating refractory keloids and hypertrophic scars. Skin Res Technol. 2023;29(6):e13389. doi: 10.1111/srt.13389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sidgwick GP, Bayat A. Extracellular matrix molecules implicated in hypertrophic and keloid scarring. J Eur Acad Dermatol. 2012;26(2):141–152. doi: 10.1111/j.1468-3083.2011.04200.x [DOI] [PubMed] [Google Scholar]
- 3.Eremenko E, Ding J, Kwan P, Tredget EE. The biology of extracellular matrix proteins in hypertrophic scarring. Adv Wound Care. 2022;11(5):234–254. doi: 10.1089/wound.2020.1257 [DOI] [PubMed] [Google Scholar]
- 4.Yang F, Chen E, Yang Y, et al. The Akt/FoxO/p27Kip1 axis contributes to the anti-proliferation of pentoxifylline in hypertrophic scars. J Cell Mol Med. 2019;23(9):6164–6172. doi: 10.1111/jcmm.14498 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ji X, Tang Z, Shuai W, et al. Endogenous peptide LYENRL prevents the activation of hypertrophic scar-derived fibroblasts by inhibiting the TGF-β1/smad pathway. Life Sci. 2019;231:116674. doi: 10.1016/j.lfs.2019.116674 [DOI] [PubMed] [Google Scholar]
- 6.Dabiri G, Tumbarello DA, Turner CE, Van de Water L. Hic-5 promotes the hypertrophic scar myofibroblast phenotype by regulating the TGF-beta1 autocrine loop. J Invest Dermatol. 2008;128(10):2518–2525. doi: 10.1038/jid.2008.90 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Liu B, Liu Y, Wang L, Hou C, An M. RNA-seq-based analysis of the hypertrophic scarring with and without pressure therapy in a bama minipig model. Sci Rep. 2018;8(1):11831. doi: 10.1038/s41598-018-29840-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Raktoe RS, Rietveld MH, Out-Luiting JJ, et al. Exon skipping of TGFβRI affects signalling and ECM expression in hypertrophic scar-derived fibroblasts. Scars Burn Heal. 2020;6:2059513120908857. doi: 10.1177/2059513120908857 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bi S, Cao C, Chai LL, Li SR, Yang DY. Regulatory mechanism of miR-29 over TGF-β1 and COL1 in scar cells. Eur Rev Med Pharmaco. 2017;21(10):2512–2517. [PubMed] [Google Scholar]
- 10.Zhou R, Zhang Q, Zhang Y, Fu S, Wang C. Aberrant miR-21 and miR-200b expression and its pro-fibrotic potential in hypertrophic scars. Exp Cell Res. 2015;339(2):360–366. doi: 10.1016/j.yexcr.2015.10.018 [DOI] [PubMed] [Google Scholar]
- 11.Ming X, Qiu S, Liu X, et al. Prognostic role of Tenascin-c for cancer outcome: a meta-analysis. Technol Cancer Res T. 2019;18:1533033818821106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Spenlé C, Saupe F, Midwood K, Burckel H, Noel G, Orend G. Tenascin-C: exploitation and collateral damage in cancer management. Cell Adhes Migr. 2015;9(1–2):141–153. doi: 10.1080/19336918.2014.1000074 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Rupp T, Langlois B, Koczorowska MM, et al. Tenascin-C orchestrates glioblastoma angiogenesis by modulation of pro- and anti-angiogenic signaling. Cell Rep. 2016;17(10):2607–2619. doi: 10.1016/j.celrep.2016.11.012 [DOI] [PubMed] [Google Scholar]
- 14.Ogawa K, Ito M, Takeuchi K, et al. Tenascin-C is upregulated in the skin lesions of patients with atopic dermatitis. J Dermatol Sci. 2005;40(1):35–41. doi: 10.1016/j.jdermsci.2005.06.001 [DOI] [PubMed] [Google Scholar]
- 15.Han CM, He XJ, Ma Q. 瘢痕疙瘩和增生性瘢痕中生腱蛋白-C mRNA的表达 [The expression of Tenascin-C mRNA in keloids and hypertrophic scars]. Zhonghua Zheng Xing Wai Ke Za Zhi. 2005;21(1):40–43. Chinese. [PubMed] [Google Scholar]
- 16.Indumathi A, Senthilkumar GP, Jayashree K, Ramesh Babu K. Assessment of circulating fibrotic proteins (periostin and Tenascin -C) in type 2 diabetes mellitus patients with and without retinopathy. Endocrine. 2022;76(3):570–577. doi: 10.1007/s12020-022-03027-6 [DOI] [PubMed] [Google Scholar]
- 17.Yang JH, Yoon JY, Moon J, Min S, Kwon HH, Suh DH. Expression of inflammatory and fibrogenetic markers in acne hypertrophic scar formation: focusing on role of TGF-β and IGF-1R. Arch Dermatol Res. 2018;310(8):665–673. doi: 10.1007/s00403-018-1856-2 [DOI] [PubMed] [Google Scholar]
- 18.Lian N, Li T. Growth factor pathways in hypertrophic scars: molecular pathogenesis and therapeutic implications. Biomed Pharmacother. 2016;84:42–50. doi: 10.1016/j.biopha.2016.09.010 [DOI] [PubMed] [Google Scholar]
- 19.Oliveira GV, Alvarenga LRMG, Ramos-e-Silva M. Keloids and hypertrophic scars. Skinmed. 2022;20(6):432–443. [PubMed] [Google Scholar]
- 20.Salem SAM, Abdel Hameed SM, Mostafa AE. Intense pulsed light versus cryotherapy in the treatment of hypertrophic scars: a clinical and histopathological study. J Cosmet Dermatol. 2021;20(9):2775–2784. doi: 10.1111/jocd.13971 [DOI] [PubMed] [Google Scholar]
- 21.Tawfic SO, Hassan AS, El‐Zahraa SH Aly F, Elbendary A, Shaker OG, AlOrbani AM. Fractional microneedle radiofrequency versus fractional carbon dioxide laser in the treatment of postburn hypertrophic scars. Laser Surg Med. 2022;54(8):1089–1098. doi: 10.1002/lsm.23589 [DOI] [PubMed] [Google Scholar]
- 22.Lee HJ, Jang YJ. Recent understandings of biology, prophylaxis and treatment strategies for hypertrophic scars and keloids. Int J Mol Sci. 2018;19(3):711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Imanaka-Yoshida K, Hiroe M, Yasutomi Y, et al. Tenascin-C is a useful marker for disease activity in myocarditis. J Pathol. 2002;197(3):388–394. doi: 10.1002/path.1131 [DOI] [PubMed] [Google Scholar]
- 24.Hagiwara K, Harimoto N, Yokobori T, et al. High co-expression of large Tenascin C splice variants in stromal tissue and annexin a2 in cancer cell membranes is associated with poor prognosis in pancreatic cancer. Ann Surg Oncol. 2020;27(3):924–930. doi: 10.1245/s10434-019-07708-x [DOI] [PubMed] [Google Scholar]
- 25.Wang Y, Wang G, Liu H. Tenascin-C: a key regulator in angiogenesis during wound healing. Biomolecules. 2022;12(11):1689. doi: 10.3390/biom12111689 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sylakowski K, Hwang P, Justin A, et al. Matricellular protein Tenascin-C enhances mesenchymal stem cell angiogenic and wound healing efficacy under ischemic conditions. J Tissue Eng Regen M. 2022;16(12):1249–1260. doi: 10.1002/term.3367 [DOI] [PubMed] [Google Scholar]
- 27.Estany S, Vicens-Zygmunt V, Llatjós R, et al. Lung fibrotic Tenascin-C upregulation is associated with other extracellular matrix proteins and induced by TGFβ1. BMC Pulm Med. 2014;14(1):120. doi: 10.1186/1471-2466-14-120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Pang X, Hou X, Hu C, et al. Tenascin-C promotes the proliferation and fibrosis of mesangial cells in diabetic nephropathy through the β-catenin pathway. Int Urol Nephrol. 2023;55(10):2507–2516. doi: 10.1007/s11255-023-03547-8 [DOI] [PubMed] [Google Scholar]
- 29.Zhang Z, Liu Y, Chen Y, et al. Transdermal delivery of 5-aminolevulinic acid by nanoethosome gels for photodynamic therapy of hypertrophic scars. Acs Appl Mater Inter. 2019;11(4):3704–3714. doi: 10.1021/acsami.8b17498 [DOI] [PubMed] [Google Scholar]
- 30.Dai Z, Lou X, Shen T, et al. Combination of ablative fractional carbon dioxide laser and platelet-rich plasma treatment to improve hypertrophic scars: a retrospective clinical observational study. Burns Trauma. 2021;9:tkab016. doi: 10.1093/burnst/tkab016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.de Oliveira GV, Gold MH. Hydrocolloid dressings can be used to treat hypertrophic scars: an outpatient dermatology service devoted to treat keloids and challenging scars. J Cosmet Dermatol. 2020;19(12):3344–3348. doi: 10.1111/jocd.13792 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are openly available in Figshare at https://doi.org/10.6084/m9.figshare.26065447.v1.





