Abstract
Background
Loiasis is one of the significant filarial diseases for people living in West and Central Africa with wide endemic area but is not seen in China. As economy booms and international traveling increase, China faces more and more imported parasitic diseases that are not endemic locally. Loiasis is one of the parasitic diseases that enter China by travelers infected in Africa. The better understanding of the clinical and laboratory features of loa loa infection will facilitate the diagnosis and treatment of loiasis in China.
Methods
The study targeted travelers who were infected with L. loa in endemic Africa regions and returned to Beijing between 2014 and 2023. Epidemiological, clinical, and biological data as well as treatment of these patients were collected.
Results
Total 21 cases were identified as L. loa infection based on their typical clinical manifestations and parasite finding. All cases had a history of travel to Africa for more than 6 months, most of them are the construction workers dispatched to West Africa with outdoor activities. Calabar swelling (n = 19; 90.5%) and pruritus (n = 11; 52.4%) were among the most common clinical symptoms followed by muscle pain (n = 7; 33.3%) and skin rash (n = 2; 9.5%). The adult worms were observed in the eyelid or subconjunctiva (n = 2; 9.5%) and subcutaneous tissues (n = 2; 9.5%). Although all patients presented with a high eosinophil count (> 0.52 × 109/L), only two cases displayed microfilariae in fresh venous blood and positive for filarial antigen. A cut section of adult worm was observed through biopsy on a skin nodule surrounded by lymphocytes, plasma cells and eosinophils. All subjects were positive in PCR targeting L. loa ITS-1. The constructed phylogenetic tree based on the amplified ITS-1 sequences identified their genetical relation to the L. Loa from Africa. All patients treated with albendazole and diethylcarbamazine were recovered without relapse.
Conclusion
This study provides useful information and guideline for physicians and researchers in non-endemic countries to diagnose and treat loiasis and L. loa infections acquired from endemic regions.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12879-024-09620-6.
Keywords: Loiasis, Loa loa, Filariasis, Eosinophilia, Travel, Imported
Introduction
Loa loa, also called African eye worm, is a filarial nematode that causes loiasis in the tropical areas of West and Central Africa including Cameroon, Congo, Gabon and Nigeria [1]. It is estimated that more than 14 million people live in high-risk areas, at least 10 million people are infected with Loa loa filariae and over 6 million cases require treatment by 2025 [2]. This parasitic disease is transmitted via the repeated bites of deerflies (mainly Chrysops silacea and C. dimidiata) [3]. Pathognomonic symptom of loiasis is Calabar swelling which is marked by painful and itchy, migratory, localized angio-oedema around the joints or in the face. The adult worm migration can be visible in the eye or under the thin skin [4]. The complications affecting different organ compartments such as the central nervous system, kidneys, heart and lungs have been reported in some cases [5].
China used to be a country with serious endemic of lymphatic filariasis caused by filarial nematodes Wuchereria bancrofti and Brugia malayi transmitted by the mosquito bite [6]. Over the decade’s efforts with mass treatment and vector control, lymphatic filariasis has been fully controlled and the elimination of this disease nationwide has been announced in 2007 [7]. Loiasis is not endemic in China and the L. loa filaria has never be detected in native residents or vectors, but occasionally detected in the international travelers (e.g., tourists, dispatched workers and migrants) from West Africa [8]. As economy quickly grows in China and globalization advances, more and more people are traveling in and out of China, including tourists, businessmen, immigrants and migrant workers. Statistically, 122 million Chinese people travelled abroad in 2016 [9] including more than 1 million migrant workers working in Africa [10]. Since most of Chinese have not ever been exposed to L. loa filaria, they are highly susceptible to the infection of this nematode when they move or travel to the endemic areas. Loiasis has been considered as one of the most common imported parasitic diseases followed by malaria and schistosomiasis in China from 2008 to 2016 [11]. During the last few years, the imported loiasis cases have been reported in countries including Belgium [12], London [13], France [14], Spain [15], Italy [16], Japan [17] and China [18]. Limited information concerning the epidemiologic characteristics could be observed in mainland China from the National Notifiable Disease Report System (NNDRS). There have been five reported instances of L. Loa infection across China, with the exception of Beijing in the existing literature. These cases were recorded in the Sichuan, Zhejiang, Shanghai, and Guangxi provinces [18–22]. Although China has no native case of loiasis, it is expected that more and more imported loiasis cases will be seen due to the large number of migrant workers who are dispatched to and return from Africa.
Although more imported cases of loiasis have been seen in migrant workers returned from Africa, there is no detail and comprehensive study regarding the clinical features of the imported loiasis reported in China. Herein, to improve the awareness of this rare parasitic disease in China, we collected 21 cases diagnosed with imported loiasis in our hospital in Beijing between 2014 and 2023 and the clinical manifestations, pathologic characterization of L. loa infection in these Chinese migrant workers returned from endemic Africa were analyzed.
Materials and methods
Study design, diagnostic procedures and inclusion criteria
This retrospective study was conducted on the imported loiasis cases admitted to the Beijing Friendship Hospital, Capital Medical University between July 2014 and July 2023.
The definitive diagnosis of loiasis was made based on the combination of clinical manifestations, traveling history in the endemic areas and the parasite identification [23] as below:
Clinical manifestations: Patients present typical Calabar swellings (recurrent painful oedema of the extremities), skin pruritus, arthralgia, myalgia and hypereosinophilia (eosinophilic count > 0.52 × 109/L).
Parasitological identification: Patients with positive microfilaraemia or with documented migration of adult L. loa worm(s) in the eyelid, subconjunctiva or under skin (biopsy).
Molecular methods: PCR positive for L. loa DNA in patients’ blood.
Epidemiological evidence: Patients with history of visiting or living in endemic areas outside China, primarily in Africa.
Parasitological identification was made by the finding of microfilariae in peripheral blood smear or the presence of adult worms in the eyelid, subconjunctiva or under skin by biopsy examination. The load of microfilaraemia was quantified by thick blood film technique using peripheral blood collected around midday (between 10 AM and 2 PM) reflecting the periodicity of the infection [24].
To exclude the possibility of cross-reactivity with other lymphatic filaria, the filarial antigenemia were detected by immunochromatographic card test (BinaxNOW; Alere Scarborough Inc., Scarborough, ME) used for immunological detection of soluble Wuchereria bancrofti antigens in peripheral blood [25].
To exclude the possible infection of other parasitic diseases co-endemic in the same areas, the microscopic and serological tests were also performed for the detection of Plasmodium, trypanosoma, leishmania spp., toxoplasma and Schistosoma parasites. The fecal examination was also performed for all patients and there were no helminthic eggs found (Fig. 1).
Fig. 1.
Flow chart for the diagnosis of loiasis
Information collected
The epidemiological information (age, gender, traveled countries), clinical manifestations including major symptoms and complaints and laboratory or parasitical examination results including blood cells count, antibody detection and microfilariae count, were collected from each patient and input into database.
Histopathology and immunohistochemistry of skin lesion
Biopsy was made on a skin nodule located on the right forearm of a patient returned from Republic of Congo. The skin module tissue was fixed in 4% formalin, embedded in paraffin, cut into tissue sections, and stained with hematoxylin-eosin (H&E). For immunohistochemical staining, the tissue sections were stained with immunohistochemical reagents including anti-CD4, anti-CD8, anti-CD19 and anti-CD56 antibodies (Becton Dickinson, San Jose, California).
PCR amplification and phylogenetic analysis
A regular polymerase chain reaction (PCR) was used to detect L. loa microfilariae DNA in blood [26]. Briefly, DNA was extracted from peripheral blood samples using a DNA extraction kit (TIANGEN, DP705, Beijing, CHN). The primers were designed based on the internal transcribed spacer region 1 (ITS1) sequence of the L. loa ribosomal RNA (Table 1) [27]. The amplification of housekeeping gene GAPDH was used as positive control. The cycling conditions for PCR were 95 °C for 9 min, then 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s followed by 1 cycle of 72 °C for 10 min. The PCR products were analyzed by electrophoresis in 2% agarose gel (Conda, Spain). The purified PCR products were sent to Ruibiotech Company (Beijing, China) for DNA sequencing.
Table 1.
Primer sequences for PCR
| Gene name | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| ITS1 | GGTGAACCTGCGGAAGGATC | CTCAATGCGTCTGCAATTCGC |
| GAPDH | GATTCCACCCATGGCAAATTC | CTGGAAGATGGTGATGGGATT |
The phylogenetic tree was constructed based on ITS1 sequences amplified from patients’ peripheral blood and those known L. loa ITS1 sequences deposited in the NCBI GenBank. The sequences were aligned by the ClustalW method with MEGA software (version 11) [28] and the phylogenetic analysis was done based on neighbor-joining (NJ) method with bootstrap support (1000 replicates).
Treatment regimen and follow-up
Given the risk of serious adverse events after diethylcarbamazine (DEC) or ivermectin (IVM) treatment which are the essential drugs to treat filariasis, the diagnosed patients were given a course of albendazole (ABZ, 400 mg thrice daily for 10 days) to reduce the load of Loa microfilaraemia before starting with DEC treatment (6 mg/kg/d divided in two to three doses for 21d). Repeated DEC therapy is required for patients with severe manifestations, high eosinophilia, or positive for parasite detections as above. The clinical symptoms and laboratory parameters were followed up regularly in these patients before starting additional treatment cycle.
Statistical analysis
Statistical analyses were conducted using SPSS version 21.0 (IBM SPSS Statistics 22; Armonk, NY). Continuous variables were described as mean ± standard deviations while categorical variables were expressed as frequencies and percentages.
Results
Demographic features
During 2014–2023, 78 cases suspected with L. loa infection returned from endemic regions in Africa were admitted in our hospital. Among them, all cases were ruled out for other parasitic infections including plasmodium, trypanosoma, leishmania, toxoplasma and Schistosoma parasites which are co-endemic in the regions with L. loa infection by specific parasite or antibody examination. Subsequently, 57 patients were excluded from analysis due to the lack of positive findings, neither microfilaraemia nor PCR positive in blood. The rest 21 patients with confirmed L. loa infection met the inclusion criteria (Fig. 1). Patients’ epidemiological characteristics are outlined in Table 2. Twenty patients (95.2%) were male with age ranged from 24 to 53 (mean age of 38.19 ± 9.58 years). All patients had explicit travel history to West and Central Africa, including Cameroon, Gabon, Republic of Congo, Democratic Republic of the Congo (DRC), Equatorial Guinea and Sudan, where the L. loa infection is endemic. Most cases (95.2%) had living history in the endemic regions for more than 6 months during the past years. Most cases were involved with outdoor work or activities such as building or infrastructure construction, farming or drivers, that allow them to have chance to be bitten by deerflies. All cases reported to be bitten by mosquito, flies or other insects on exposed areas of the body during their staying in the regions.
Table 2.
Sociodemographic characteristics of patients with loiasis during 2014–2023
| Items | Loiasis (N = 21) | Percent (%) |
|---|---|---|
| Gender | ||
| Male | 20 | 95.2 |
| Female | 1 | 4.8 |
| Age (years) | / | |
| Mean (SD) | 38.19(9.58) | / |
| Median (Min, Max) | 39 (24,53) | / |
| Region of Exposure | ||
| Cameroon | 6 | 28.6 |
| Gabon | 5 | 23.8 |
| Republic of Congo | 5 | 23.8 |
| Democratic Republic of the Congo (DRC) | 2 | 9.5 |
| Equatorial Guinea | 2 | 9.5 |
| Sudan | 1 | 4.8 |
| Type of travel | ||
| Africa short-time traveler ≤ 6 M | 1 | 4.8 |
| Africa long-time traveler > 6 M | 20 | 95.2 |
| Occupation | ||
| Labor workers | 10 | 47.6 |
| Enterprise/business/service personnel | 4 | 19.1 |
| Driver | 4 | 19.1 |
| Translator | 3 | 14.3 |
| History of fly or other insect bite | 21 | 100 |
| Death | 0 | 0 |
Clinical manifestations
In Table 3, the most common symptom that patients complained (19/21) was the Calabar swelling characterized by the angioedema on the limb extremities, especially on ankles (N = 5), wrists (N = 7), or arms and legs (N = 7). More than half of the cases complained itch on their skin all over the body (pruritus) (52.4%), followed by muscle and joint pain (33.3%), and skin rash on the trunk and extremities (9.5%). Worm crawling under the eyelids or subcutaneous tissue was relatively uncommon. A case reported subconjunctival worm moving in right eye and another case reported in binocular eyelids. These cases with eye worms complained ocular discomfort, a noticeable foreign object sensation without conjunctival haemorrhage and diminution of vision. One patient had subcutaneous nodule as a serpiginous cord in right forearm, and another one had worm migration in subcutaneous tissue of the left anterior chest wall.
Table 3.
Clinical characteristics of patients with loiasis
| Variables | Loiasis (N = 21) | Percent (%) |
|---|---|---|
| Eosinophilia | 21 | 100 |
| Calabar swelling (ankles, wrists, or arms and legs) | 19 | 90.5 |
| Pruritus | 11 | 52.4 |
| Pain | 7 | 33.3 |
| Skin rash | 2 | 9.5 |
| Adult worm migration | ||
| Eyelids or subconjunctival | 2 | 9.5 |
| Subcutaneous | 2 | 9.5 |
| Asymptomatic | 0 | 0 |
| Microfilaraemia | 2 | 9.5 |
| Delay of diagnosis (months) | ||
| Mean (SD) | 13.10 (12.74) | - |
| Median (Min, Max) | 7 (1, 48) | - |
The laboratory microfilaraemia positive rate was such low; only 2 of 21 were microfilaremic. Due to the low rate of parasite finding, most of loiasis diagnosis was delayed from 1 to 48 months with mean delay period of 13.10 months.
Laboratory and parasitological examination
Considering that hypereosinophilia is associated with invasive helminthic infections, every suspected patient returned from the endemic regions received multiple routine blood tests and fecal examination. Significantly, all patients presented eosinophilia in their blood test with an absolute eosinophil count > 0.52 × 109/L, but with normal levels of erythrocyte and platelet (Table 4). The liver enzymes and serum globulin level were within the normal range.
Table 4.
Laboratory findings of patients with loiasis (the positive results are shown in bold)
| Variables | Mean(Max, Min) | Normal range |
|---|---|---|
| Routine blood tests | ||
| Leukocytes (×109/L) | 11.52(6.53, 25.75) | 3.50–9.50 |
| Red blood count(×1012/L) | 4.78(3.91, 5.13) | 4.30–5.80 |
| Hemoglobin (g/L) | 147.68(116, 176) | 130–175 |
| Eosinophils (×109/L) | 6.51(0.54, 40.30) | 0.02–0.52 |
| Platelet (×109/L) | 211.47(129, 325) | 125–350 |
| Liver function tests | ||
| ALT(U/L) | 26.79(7, 68) | 9–50 |
| AST(U/L) | 20.57(9.40, 33.20) | 15–40 |
| Albumin(g/L) | 41.83(36, 69.20) | 40–55 |
| Globulin (g/L) | 29.35(20.40, 35.30) | 20–40 |
| Etiology | ||
| Loa loa microfilariae (mf) densities (mf/mL) | 3.30 × 105(1.80 × 105, 4.68 × 105) | 0 |
| Filarial antigenemia (%) | 9.5 | Neg |
| ITS1 PCR positive (%) | 100 | Neg |
The definitive diagnosis of L. loa infection is based on the presence of microfilariae in blood. However, in this study, only two cases displayed microfilariae in fresh venous blood obtained in daytime (Fig. 2A and B). The filarial antigen test was positive for 2 of 21 patients (9.5%). Significantly, all patients showed positive in PCR test targeting L. loa ITS1 with 457 bp products (Additional file 1: Fig. S1 A and B). The amplified PCR products were DNA sequenced.
Fig. 2.
Morphology of microfilariae in blood smear. (A) Thin blood film smear stained by Wright-Giemsa showing L. loa microfilariae, caudal nuclei extended to the tip of the tail (arrows), (B) The translucid sheath of microfilariae in lightly stained film (arrows). 400 × magnification
Histopathologic features and immunohistochemistry
Biopsy was performed on a patient with obvious skin module located on the right forearm. The histological examination on the biopsy section showed a transection of an adult worm surrounded by the granuloma and inflammatory cells infiltrated including many eosinophils (Fig. 3A and B). The immunohistochemistry staining showed the significant filtration of CD4 lymphocytes followed by the CD8 cells in the granuloma surrounding the parasite section. There were few CD19 and CD56 cells filtration (Fig. 3 C-F).
Fig. 3.
Histopathologic features and immunohistochemistry of skin module infected with L. loa adult worm. Hematoxylin-eosin stained section of skin nodule tissue under microscope exhibited a transection of adult worm (A, arrows, 10 × magnification) surrounded by the granuloma, lymphocytes, plasma cells and eosinophils (B, 100 × magnification). There are many CD4 lymphocyte filtrated around the worm (C, 100 × magnification), less CD8 (D, 100 × magnification) and few CD 19 (E, 100 × magnification) and CD 56 positive cells in the granuloma (F, 100 × magnification)
Phylogenetic analysis
A phylogenetic tree was constructed based on the seven sequences of IST1 PCR products obtained from seven patient blood samples in this study, compared with known 5 sequences of L. Loa ITS1 from NCBI GenBank, represented from Equatorial Guinea and Gabon through the neighbor-joining method, where Dirofilaria repens (AY621479.1) acts as an outgroup. These obtained sequences clustered closely with each other and other previously described L. Loa sequences, but are distinct from Dirofilaria repens sequences, indicating their origin in West and Central Africa (Fig. 4).
Fig. 4.
Phylogenetic tree of the ITS-1 sequences of L. loa (red font) obtained from 7 Chinese migrant workers returned from endemic Africa. Phylogenetic tree was conducted by MEGA11 software using the neighbor-joining method and 1000 bootstrap values
Treatment and outcomes
All patients received albendazole (ABZ) then diethylcarbamazine (DEC) combination therapy once diagnosis of loiasis was confirmed. The dosage of ABZ was 400 mg 3 times/day for 10 days, and then of DEC 6 mg/kg/day for the following 21 days. One or more courses of DEC were given if the symptoms or eosinophilia remain or the PCR keeps positive. All cases were received anti-allergic therapy (loratadine) alone with the anti-parasite chemotherapy to avoid Mazzotti reaction. Neither encephalitis nor any other adverse reactions were observed in any patients. Consequently, 21 patients were fully recovered and no further persistence or relapse of symptoms or eosinophilia were reported (Table 5).
Table 5.
Posttreatment symptoms following initial treatment of patients with loiasis
| Variables | Loiasis (N = 21) | Percent (%) |
|---|---|---|
| Clinical examination | ||
| Calabar swelling | 0 | 0 |
| Pruritus | 0 | 0 |
| Pain or skin rash | 0 | 0 |
| Adult worm migration | 0 | 0 |
| Adverse reactions | 0 | 0 |
| Laboratory findings | ||
| Eosinophilia | 0 | 0 |
| Filarial antigenemia | ||
| Positive | 0 | 0 |
| Negative | 21 | 100 |
| Microfilaraemia | ||
| Positive | 0 | 0 |
| Negative | 21 | 100 |
| Conventional PCR positive | ||
| Positive | 0 | 0 |
| Negative | 21 | 100 |
Discussion
Loiasis is one of vector-borne diseases which have brought a serious threat to global public health [29]. It threats not only local people living in the endemic areas but the travelers who are infected through the bite by the flies carrying the infective larvae [1]. More than 30 million are exposed and at risk of infection worldwide [1]. The global warming and increased international travelers to the endemic regions increase the infection opportunity and the spread of L. loa infections. As a vector-borne disease, loiasis has been recognized as an imported infection among visitors and migrants returned from endemic regions. Based on the report from international GeoSentinel Surveillance Network, the most acquired infections for travelers and immigrants/refugees from endemic regions were filaria, 25% of them were infections of L. loa [30]. Since free-market reforms and opening up to foreign trade and investment in 1979, China has been among the world’s fastest-growing economies. As increased international economic activities and travelling, China faces more and more threat of imported parasitic infections, especially malaria, filariasis and leishmaniasis. In this study, we described 21 cases of L. loa infection imported from West Africa enrolled in our department during the past 10 years. All of them were Chinese people with a travel history to sub-Saharan Africa for longer than 6 months. While longer stay in endemic area appears more likely to acquire filarial infections, it was found that infection acquisition was high for travelers who had travel durations between 1 and 6 months [30]. It is consistent with our result that 20 out of 21 patients stayed in the endemic countries for more than 6 months. In addition to the travel region and the duration of trip, outdoor exposure is a major factor related to the risk of filarial infection, which increases the chance of insect bites which transmits infections of vector-borne viruses, bacteria, protozoa, or nematodes [31]. In this study, most of cases are engineering technicians and construction workers engaged in the outdoor infrastructure construction in the endemic countries who complained to be frequently bitten by the blood sucking flies. The prolonged exposure to the insect bites outdoor increases the chance to acquire vectored borne parasitic infections [32].
Clinical manifestations of filarial infections are usually subtle, since symptoms are often benign and transient. Infected local residents may remain asymptomatic for days or even years, but for those travelers who have no immunity, loiasis is most often symptomatic [14]. Calabar swellings is a transient subcutaneous swelling tracking the migratory course of the adult L. loa filaria through the tissues caused by the hypersensitivity response in subcutaneous tissues against parasite antigens. The appearance rate of Calabar swellings in local people in Southeast Gabon was 17.98%, however, these swellings were observed in 63% cases of imported loiasis in France [33]. In this study, 19 out of 21 cases appeared with Calabar swellings happened in both upper and lower limbs especially in ankles and wrists, further confirming that travelers have higher rate of Calabar swellings than local people in endemic regions as the common clinical sign of loiasis [34].
Notion of a worm migrating through the eye is another pathognomonic symptom for loiasis, which was shown to occur more frequently in local Africans [32] where more than 40% of the population had the history of the worm migration [35]. Adult worms, 3–7 cm long, are visible in the subconjunctival space and cause the visual disturbances when they moved around the eye. Even though the worms under subconjunctiva could be removed under local anaesthetic with forceps, it is hard to extract them from the deep subconjunctival tissue [36]. In this study, two patients complained the discomfort of eyes with noticeable sensation of foreign objects, however, there was no conjunctival haemorrhage and diminution of vision observed. The worms did not reappear in the eye throughout hospitalization because of the fast migration of worm to the retrobulbar space. Routine ophthalmologic and funduscopic exam was often negative for eye worms.
In addition to eyes, adult worms (filaria) commonly reside in subcutaneous and deep connective tissue, but there is very limited literature describing the surgical removal of the intact L. loa adult worm and relevant pathological changes. In our study, two patients appeared with subcutaneous nodules under arm and chest. One of the nodules was removed in a skin biopsy procedure. A nematode worm section was clearly observed under microscope during the histochemical examination of the skin module. After being treated with ABZ + DEC, the size of the skin module in another patient reduced and disappeared. At present, two main strategies are utilized to manage loiasis: the surgical extraction of adult worms and the use of systemic antiparasitic medications [37]. Surgical intervention is pursued when adult worms are observable, such as during their migration beneath the conjunctiva. This is followed by the administration of antiparasitic drugs to eradicate microfilariae and any residual adult worms [38]. Nonetheless, the surgical removal has a limited effect on reducing the total number of worms in the host since these adult worms represent only a minor portion of the entire worm population. Consequently, irrespective of whether adult worm extraction is successful, systemic antiparasitic therapy is imperative to achieve a full recovery [39].
Except for the mild or nonspecific symptoms for those people infected with L. loa [14], the common symptom for people returned from loiasis endemic regions is the allergic type skin itching, which is more commonly reported in travelers or short term visitors than the local residents [40]. Studies demonstrated that pruritus occurred in 43.5% imported loiasis in immigrants in Spain from sub-Saharan Africa [15] and the symptom is persistent and all over the body. Pruritus is also common in this study and more than half of patients complained the skin itching that irritated and affected their sleep. Considering the higher incidence of loiasis in a population in endemic Gabon, the presence of “pruritus” combined with “frequent forest exposure” led to a large and nearly conclusive of disease-likelihood of loiasis [32].
Loa loa infection was associated with the presence of eosinophilia which occurs frequently in individuals returning from the endemic regions. Except for the positive predictive value for parasitic disease, eosinophils also play a crucial part in the fight against invasive helminthic infections. Among 154 returned travelers and migrants who had a total eosinophil count ≥ 500 cells/mL, 71 patients (46%) were diagnosed with helminthic infections [41, 42]. Although loiasis patients present mild or nonspecific symptoms, a significant number of them may reveal eosinophilia [14]. In our study, all of the L. loa infected individuals were significantly associated with absolute blood eosinophilia (0.54–40.30 × 109/L). Recent findings demonstrate that eosinophils hinder parasite burden by initiating the rapid deployment of type 2 immune responses and producing major basic protein (MBP) to kill nematodes in the response to IL-5 [43]. An elevated presence of eosinophils and inflammatory responses were observed in a baboon model of hypermicrofilaremia [44]. Although immunoglobulins and eosinophils or others immune cells may be involved in killing microfilariae, the effector mechanism of eosinophils in controlling loiasis has barely been studied [45].
Apart from the presence of eosinophilia as a marker for helminth infections, microfilaraemia have been commonly observed as evidence of infection in residents of endemic regions [46]. The number of individuals with L. loa microfilaraemia may be expanded due to population growth in endemic areas [2]. The high load and persistent presence of L. loa microfilariae in the blood circulation could induce chronic pathogenic mechanisms which include obstructive or inflammatory processes in the vessels, or pathogenic processes induced by indirect immunologically mediated phenomena in various organs [47]. Consequently, severe disease outcomes were frequently occurred in individuals with high load of microfilariae [48]. Reports in the Republic of Congo suggest that chronic inflammation caused by eosinophilia may be related to excessive mortality [49]. Of note, the eosinophilia was more noticeable in loiasis with high load of microfilariae. A cross-sectional survey from Gabon showed that L. loa infection was associated with presence of eosinophilia and extent of microfilaraemia [50]. A patient from an endemic area, diagnosed with endomyocardial fibrosis, had L. loa microfilaraemia and marked eosinophilia [51]. However, it is still unknown whether L. loa microfilaraemia or eosinophilia is associated with any physiopathological change related to the infection.
Interestingly, some microfilaremic individuals from local residents were reported to get no sign of loiasis or L. loa infection. Possibly it is because these local people acquire immunity, especially Th-2 driven immune response that control the infection at low level and led to a lack of “reactive” symptoms in these individuals. Contrarily, travelers display a wide range of clinical manifestations when they visited the endemic areas and get infected because they lack the acquired immunity against the infection. The difference is more likely due to the distinct immunological profile [52, 53]. In addition, other studies claimed the presence of microfilaraemia may be related to the genetics of host and parasite and the density and fecundity of adult worms [54]. In this study, we found that all positive infective cases were associated with high absolute eosinophil counts and apparent disease manifestation, but only some of them displayed microfilaraemia, which was also observed in recent reports from Japan and China [23].
Although the laboratory identification of microfilaraemia and eosinophilia is important for the diagnosis of L. loa infection, a significant proportion of patients may suffer from occult loiasis with an absence of microfilaraemia and cross detection of antibodies limits the usefulness of serological test [32]. PCR assay plays a decisive important role in the diagnosis of imported loiasis, especially for those with low microfilariae load [55]. In a cross-sectional survey administered in Gabon, the higher detection rate of filarial infections was observed when PCR was applied in contrast to microscopy (48% vs. 20%, respectively) [56]. In our study, all patients were PCR positive regardless of whether they had microfilaraemia examined under microscope. As patients returned from endemic areas without microfilaraemia should be further tested with PCR to exclude L. loa or other filarial infections [55].
Conclusions
As international travel and economic activities are increased, more imported loiasis cases are found in non-endemic countries. Based on the investigation on 21 cases with definitely diagnosed loiasis in Beijing, all of them had travel history to countries in sub-Saharan Africa, endemic regions for loiasis, during the past 6 months. The major clinical manifestations include Calabar swelling and predominant eosinophilia, sometimes accompanied by a variety of non-specific symptoms such as recurrent pruritus, muscle pain and skin rash. All cases showed positive in PCR detection in blood samples even though most infected people are lack of microfilaraemia. Phylogenetic analysis of the ITS1 sequences obtained from imported patients shows a closer relationship to those derived from L. Loa, and a more distant relation to other filariae such as Onchocerca volvulus, Brugia malayi, or Dirofilaria repens. This study provides useful information and guideline for physicians and researchers in non-endemic countries to diagnose and treat loiasis and L. loa infections acquired from endemic regions.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We thank all participants for their generous assistance in the whole process of research.
Author contributions
Conceptualization: Xiaoli Li; Methodology: Minjun Huang and Fei Wang; Formal analysis: Yang Zou, Kuo Bi and Xiaoyan Zheng; Writing—original draft preparation: Xiaoli Li; Writing—review and editing: Xiaoli Li and Lei Wang; Funding acquisition: Lei Wang.
Funding
This work was supported by the National Natural Science Foundation of China (NSFC), grant number 81702018, and the Gold-Bridge Project from the Beijing Association for Science and Technology, grant number ZZ20058.
Data availability
All materials and data supporting these findings are involved within the manuscript and supplementary information files.
Declarations
Ethics approval and consent to participate
A written consent letter was signed by patients who participated in this research. The patients’ IDs were never disclosed. The study protocol was approval by the Ethics Committee of Beijing Friendship Hospital, Capital Medical University for Human Research (Beijing, China) with the number 2023-P2-358.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Zoure HG, Wanji S, Noma M, Amazigo UV, Diggle PJ, Tekle AH, Remme JH. The geographic distribution of Loa loa in Africa: results of large-scale implementation of the Rapid Assessment Procedure for Loiasis (RAPLOA). PLoS Negl Trop Dis. 2011;5(6):e1210. 10.1371/journal.pntd.0001210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Vinkeles Melchers NVS, Coffeng LE, Boussinesq M, Pedrique B, Pion SDS, Tekle AH, Zoure HGM, Wanji S, Remme JH, Stolk WA. Projected number of people with onchocerciasis-loiasis coinfection in Africa, 1995 to 2025. Clin Infect Dis. 2020;70(11):2281–9. 10.1093/cid/ciz647 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kelly-Hope L, Paulo R, Thomas B, Brito M, Unnasch TR, Molyneux D. Loa loa vectors Chrysops spp.: perspectives on research, distribution, bionomics, and implications for elimination of lymphatic filariasis and onchocerciasis. Parasit Vectors. 2017;10(1):172. 10.1186/s13071-017-2103-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Akue JP, Eyang-Assengone ER, Dieki R. Loa loa infection detection using biomarkers: current perspectives. Res Rep Trop Med. 2018;9:43–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Buell KG, Whittaker C, Chesnais CB, Jewell PD, Pion SDS, Walker M, Basanez MG, Boussinesq M. Atypical clinical manifestations of Loiasis and their relevance for endemic populations. Open Forum Infect Dis. 2019;6(11):ofz417. 10.1093/ofid/ofz417 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bizhani N, Hashemi Hafshejani S, Mohammadi N, Rezaei M, Rokni MB. Lymphatic filariasis in Asia: a systematic review and meta-analysis. Parasitol Res. 2021;120(2):411–22. 10.1007/s00436-020-06991-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Local Burden of Disease Neglected Tropical Diseases Collaborators. The global distribution of lymphatic filariasis, 2000-18: a geospatial analysis. Lancet Glob Health. 2020;8(9):e1186–94. 10.1016/S2214-109X(20)30286-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang Y, Wang X, Liu X, Ren R, Zhou L, Li C, Tu W, Ni D, Li Q, Feng Z, et al. Epidemiology of Imported Infectious diseases, China, 2005–2016. Emerg Infect Dis. 2018;25(1):33–41. 10.3201/eid2501.180178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gao JM, Qian ZY, Hide G, Lai DH, Lun ZR, Wu ZD. Human African trypanosomiasis: the current situation in endemic regions and the risks for non-endemic regions from imported cases. Parasitology. 2020;147(9):922–31. 10.1017/S0031182020000645 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Burkle FM. Declining Public Health Protections within autocratic regimes: impact on Global Public Health Security, Infectious Disease outbreaks, epidemics, and pandemics. Prehosp Disaster Med. 2020;35(3):237–46. 10.1017/S1049023X20000424 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Song LG, Zeng XD, Li YX, Zhang BB, Wu XY, Yuan DJ, He A, Wu ZD. Imported parasitic diseases in mainland China: current status and perspectives for better control and prevention. Infect Dis Poverty. 2018;7(1):78. 10.1186/s40249-018-0454-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bottieau E, Huits R, Van Den Broucke S, Maniewski U, Declercq S, Brosius I, Theunissen C, Feyens AM, Van Esbroeck M, van Griensven J, et al. Human filariasis in Travelers and migrants: a retrospective 25-year analysis at the Institute of Tropical Medicine, Antwerp, Belgium. Clin Infect Dis. 2022;74(11):1972–8. 10.1093/cid/ciab751 [DOI] [PubMed] [Google Scholar]
- 13.Saito M, Armstrong M, Boadi S, Lowe P, Chiodini PL, Doherty T. Clinical features of Imported Loiasis: a Case Series from the hospital for Tropical diseases, London. Am J Trop Med Hyg. 2015;93(3):607–11. 10.4269/ajtmh.15-0214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bouchaud O, Matheron S, Loarec A, Dupouy Camet J, Bouree P, Godineau N, Poilane I, Cailhol J, Caumes E. Imported loiasis in France: a retrospective analysis of 167 cases with comparison between sub-saharan and non sub-saharan African patients. BMC Infect Dis. 2020;20(1):63. 10.1186/s12879-019-4740-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Puente S, Ramirez-Olivencia G, Lago M, Subirats M, Bru F, Perez-Blazquez E, Arsuaga M, de Guevara CL, de la Calle-Prieto F, Vicente B, et al. Loiasis in sub-saharan migrants living in Spain with emphasis of cases from Equatorial Guinea. Infect Dis Poverty. 2020;9(1):16. 10.1186/s40249-020-0627-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Gobbi F, Postiglione C, Angheben A, Marocco S, Monteiro G, Buonfrate D, Mascarello M, Gobbo M, Boussinesq M, Bisoffi Z. Imported loiasis in Italy: an analysis of 100 cases. Travel Med Infect Dis. 2014;12(6 Pt B):713–7. 10.1016/j.tmaid.2014.07.004 [DOI] [PubMed] [Google Scholar]
- 17.Yoshikawa M, Ouji Y, Hayashi N, Moriya K, Nishiofuku M, Ishizaka S, Itoh M, Kimura E, Nakamura F, Nawa Y. Diagnostic problems in a patient with amicrofilaremic Loa loa. J Travel Med. 2008;15(1):53–7. 10.1111/j.1708-8305.2007.00167.x [DOI] [PubMed] [Google Scholar]
- 18.Luo X, Li S, Li Q, Zhang P, Tao Z, Shi Y, Huang X, Fang F, Shao H, Luo X. Atypical imported loiasis characterised by recurrent anaemia in a patient from China. Lancet Infect Dis. 2022;22(2):295. 10.1016/S1473-3099(21)00584-3 [DOI] [PubMed] [Google Scholar]
- 19.Zhang FN, Zhu SF, He LJ. A case in Sichuan Province was infected with the microfilariae morphology of Loa loa. Sichuan J Zoonlogy. 1994;13(02):78. (in Chinese) [Google Scholar]
- 20.Xu X, Yao YL, Zhang JY, Xia SR, Chen HL, Ruan W. One imported case of loiasis. J Pathogen Bio. 2008;3(12):926. (in Chinese) [Google Scholar]
- 21.Weng YF, Zhang XQ. Investigation and analysis of the first imported loiasis in Dinghai District in Zhoushan City. Chin Prev Med. 2010;11(02):205. (in Chinese) [Google Scholar]
- 22.Cai Q, Ye NF, Ai L, Chen JX, Wang JB. Clinical features and diagnosis of an imported Loiasis patient in Shanghai. Chin J Parasitol Parasit Dis. 2018;36(04):370–4. (in Chinese) [Google Scholar]
- 23.Gerber V, Greigert V, Pfaff A, Jaennel J, Marteau A, Argy N, Candolfi E, Abou-Bacar A, Brunet J. Imported occult loiasis: diagnostic algorithm proposal for a difficult diagnosis. J Travel Med 2022, 29(7). [DOI] [PubMed]
- 24.Ekoka Mbassi FA, Mombo-Ngoma G, Ndoumba WN, Yovo EK, Eberhardt KA, Ekoka Mbassi D, Adegnika AA, Agnandji ST, Bouyou-Akotet MK, Ramharter M, et al. Performance of Field’s Stain compared with conventional Giemsa Stain for the Rapid Detection of Blood Microfilariae in Gabon. Am J Trop Med Hyg. 2022;107(2):383–7. 10.4269/ajtmh.22-0061 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wanji S, Amvongo-Adjia N, Njouendou AJ, Kengne-Ouafo JA, Ndongmo WP, Fombad FF, et al. Further evidence of the cross-reactivity of the Binax NOW® Filariasis ICT cards to non-wuchereria bancrofti filariae: experimental studies with Loa loa and Onchocerca ochengi. Parasit Vectors. 2016;9:267. 10.1186/s13071-016-1556-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gobbi F, Buonfrate D, Boussinesq M, Chesnais CB, Pion SD, Silva R, Moro L, Rodari P, Tamarozzi F, Biamonte M, et al. Performance of two serodiagnostic tests for loiasis in a non-endemic area. PLoS Negl Trop Dis. 2020;14(5):e0008187. 10.1371/journal.pntd.0008187 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Jimenez M, Gonzalez LM, Carranza C, Bailo B, Perez-Ayala A, Muro A, Perez-Arellano JL, Garate T. Detection and discrimination of Loa loa, Mansonella perstans and Wuchereria bancrofti by PCR-RFLP and nested-PCR of ribosomal DNA ITS1 region. Exp Parasitol. 2011;127(1):282–6. 10.1016/j.exppara.2010.06.019 [DOI] [PubMed] [Google Scholar]
- 28.Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38(7):3022–7. 10.1093/molbev/msab120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Pion SD, Chesnais CB. Uncovering the burden of loiasis: first estimates from Gabon. Lancet Infect Dis. 2020;20(11):1226–7. 10.1016/S1473-3099(20)30324-8 [DOI] [PubMed] [Google Scholar]
- 30.Lipner EM, Law MA, Barnett E, Keystone JS, von Sonnenburg F, Loutan L, Prevots DR, Klion AD, Nutman TB. GeoSentinel Surveillance N: Filariasis in travelers presenting to the GeoSentinel Surveillance Network. PLoS Negl Trop Dis. 2007;1(3):e88. 10.1371/journal.pntd.0000088 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Barillas-Mury C, Ribeiro JMC, Valenzuela JG. Understanding pathogen survival and transmission by arthropod vectors to prevent human disease. Science. 2022;377(6614):eabc2757. 10.1126/science.abc2757 [DOI] [PubMed] [Google Scholar]
- 32.Mischlinger J, Veletzky L, Tazemda-Kuitsouc GB, Pitzinger P, Matsegui PB, Gmeiner M, Lagler H, Gebru T, Held J, Mordmuller B, et al. Behavioural and clinical predictors for Loiasis. J Glob Health. 2018;8(1):010413. 10.7189/jogh.08.010413 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Gantois N, Rapp C, Gautret P, Ficko C, Savini H, Larreche S, Saidi R, Crevon L, Simon F. Imported loiasis in France: a retrospective analysis of 47 cases. Travel Med Infect Dis. 2013;11(6):366–73. 10.1016/j.tmaid.2013.08.005 [DOI] [PubMed] [Google Scholar]
- 34.Arrey-Agbor DB, Nana-Djeunga HC, Mogoung-Wafo AE, Mafo M, Danwe C, Kamgno J. Case Report: probable case of spontaneous Encephalopathy due to Loiasis and dramatic reduction of Loa loa Microfilariaemia with prolonged repeated courses of Albendazole. Am J Trop Med Hyg. 2018;99(1):112–5. 10.4269/ajtmh.17-0664 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Hemilembolo MC, Niama AC, Campillo JT, Pion SD, Missamou F, Whittaker C, Kankou JM, Ndziessi G, Bileckot RR, Boussinesq M, et al. Excess mortality Associated with Loiasis: confirmation by a New Retrospective Cohort Study conducted in the Republic of Congo. Open Forum Infect Dis. 2023;10(3):ofad103. 10.1093/ofid/ofad103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Hicks SR, O’Dempsey T, Khoyratty F, Gupta A, Stockdale A, Beadsworth M, Jones J, Slack I. Cause of hypereosinophilia shows itself after 6 years: Loa loa. Lancet. 2022;399(10323):e2. 10.1016/S0140-6736(21)02723-9 [DOI] [PubMed] [Google Scholar]
- 37.Emukah E, Rakers LJ, Kahansim B, Miri ES, Nwoke BEB, Griswold E, Saka Y, Anagbogu I, Davies E, Ityonzughul C, et al. In Southern Nigeria Loa loa blood Microfilaria Density is very low even in Areas with High Prevalence of Loiasis: results of a Survey using the New LoaScope Technology. Am J Trop Med Hyg. 2018;99(1):116–23. 10.4269/ajtmh.18-0163 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Okonkwo ON, Hassan AO, Alarape T, Akanbi T, Oderinlo O, Akinye A, Oyekunle I. Removal of adult subconjunctival Loa loa amongst urban dwellers in Nigeria. PLoS Negl Trop Dis. 2018;12(11):e0006920. 10.1371/journal.pntd.0006920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Padidam S, Trinh H, Lin X, Boss JD. Nonsurgical management of photoaversive ocular and systemic loiasis in Michigan. GMS Ophthalmol Cases. 2020;10:Doc22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Churchill DR, Morris C, Fakoya A, Wright SG, Davidson RN. Clinical and laboratory features of patients with loiasis (Loa loa filariasis) in the U.K. J Infect. 1996;33(2):103–9. 10.1016/S0163-4453(96)93005-4 [DOI] [PubMed] [Google Scholar]
- 41.Salzer HJF, Rolling T, Vinnemeier CD, Tannich E, Schmiedel S, Addo MM, Cramer JP. Helminthic infections in returning travelers and migrants with eosinophilia: diagnostic value of medical history, eosinophil count and IgE. Travel Med Infect Dis. 2017;20:49–55. 10.1016/j.tmaid.2017.09.001 [DOI] [PubMed] [Google Scholar]
- 42.Schulte C, Krebs B, Jelinek T, Nothdurft HD, von Sonnenburg F, Loscher T. Diagnostic significance of blood eosinophilia in returning travelers. Clin Infect Dis. 2002;34(3):407–11. 10.1086/338026 [DOI] [PubMed] [Google Scholar]
- 43.Obata-Ninomiya K, Domeier PP, Ziegler SF. Basophils and eosinophils in Nematode infections. Front Immunol. 2020;11:583824. 10.3389/fimmu.2020.583824 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Dieki R, Nsi-Emvo E, Akue JP. The human Filaria Loa loa: Update on Diagnostics and Immune Response. Res Rep Trop Med. 2022;13:41–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Herrick JA, Makiya MA, Holland-Thomas N, Klion AD, Nutman TB. Infection-associated Immune perturbations resolve 1 year following treatment for Loa loa. Clin Infect Dis. 2021;72(5):789–96. 10.1093/cid/ciaa137 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Whittaker C, Walker M, Pion SDS, Chesnais CB, Boussinesq M, Basanez MG. The Population Biology and Transmission dynamics of Loa loa. Trends Parasitol. 2018;34(4):335–50. 10.1016/j.pt.2017.12.003 [DOI] [PubMed] [Google Scholar]
- 47.Pinder M, Leclerc A, Everaere S. Antibody-dependent cell-mediated immune reactions to Loa loa microfilariae in amicrofilaraemic subjects. Parasite Immunol. 1992;14(5):541–56. 10.1111/j.1365-3024.1992.tb00027.x [DOI] [PubMed] [Google Scholar]
- 48.Veletzky L, Hergeth J, Stelzl DR, Mischlinger J, Manego RZ, Mombo-Ngoma G, McCall MBB, Adegnika AA, Agnandji ST, Metzger WG, et al. Burden of disease in Gabon caused by loiasis: a cross-sectional survey. Lancet Infect Dis. 2020;20(11):1339–46. 10.1016/S1473-3099(20)30256-5 [DOI] [PubMed] [Google Scholar]
- 49.Chesnais CB, Takougang I, Paguele M, Pion SD, Boussinesq M. Excess mortality associated with loiasis: a retrospective population-based cohort study. Lancet Infect Dis. 2017;17(1):108–16. 10.1016/S1473-3099(16)30405-4 [DOI] [PubMed] [Google Scholar]
- 50.Veletzky L, Eberhardt KA, Hergeth J, Stelzl DR, Zoleko Manego R, Mombo-Ngoma G, Kreuzmair R, Burger G, Adegnika AA, Agnandji ST, et al. Distinct loiasis infection states and associated clinical and hematological manifestations in patients from Gabon. PLoS Negl Trop Dis. 2022;16(9):e0010793. 10.1371/journal.pntd.0010793 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Leon D, Martin M, Corros C, Santamarta E, Costilla S, Lambert JL. Usefulness of cardiac MRI in the early diagnosis of endomyocardial fibrosis. Rev Port Cardiol. 2012;31(5):401–2. 10.1016/j.repc.2011.12.016 [DOI] [PubMed] [Google Scholar]
- 52.Winkler S, Willheim M, Baier K, Aichelburg A, Kremsner PG, Graninger W. Increased frequency of Th2-type cytokine-producing T cells in microfilaremic loiasis. Am J Trop Med Hyg. 1999;60(4):680–6. 10.4269/ajtmh.1999.60.680 [DOI] [PubMed] [Google Scholar]
- 53.Metenou S, Babu S, Nutman TB. Impact of filarial infections on coincident intracellular pathogens: Mycobacterium tuberculosis and Plasmodium Falciparum. Curr Opin HIV AIDS. 2012;7(3):231–8. 10.1097/COH.0b013e3283522c3d [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Eyebe S, Sabbagh A, Pion SD, Nana-Djeunga HC, Kamgno J, Boussinesq M, Chesnais CB. Familial aggregation and heritability of Loa loa Microfilaremia. Clin Infect Dis. 2018;66(5):751–7. 10.1093/cid/cix877 [DOI] [PubMed] [Google Scholar]
- 55.Fink DL, Kamgno J, Nutman TB. Rapid molecular assays for specific detection and quantitation of Loa loa microfilaremia. PLoS Negl Trop Dis. 2011;5(8):e1299. 10.1371/journal.pntd.0001299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Sandri TL, Kreidenweiss A, Cavallo S, Weber D, Juhas S, Rodi M, Woldearegai TG, Gmeiner M, Veletzky L, Ramharter M, et al. Molecular Epidemiology of Mansonella Species in Gabon. J Infect Dis. 2021;223(2):287–96. 10.1093/infdis/jiaa670 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All materials and data supporting these findings are involved within the manuscript and supplementary information files.




