PA-824 inhibits porcine epidemic diarrhea virus infection in vivo and in vitro by inhibiting p53 activation

ABSTRACT

Porcine epidemic diarrhea virus (PEDV) is a type A coronavirus that causes severe watery diarrhea in piglets, resulting in severe economic losses worldwide. Therefore, new approaches to control PEDV infection are essential for a robust and sustainable pig industry. We screened 314 small-molecule drug libraries provided by Selleck and found that four drugs had obviously inhibitory effects on PEDV in Vero cells. PA-824, which had the highest SI index and the most reliable clinical safety, was selected for in vivo experiments. Animal attack tests showed that PA-824 effectively alleviated the clinical signs, intestinal pathological changes, and inflammatory responses in lactating piglets after PEDV infection. To further investigate the antiviral mechanism of PA-824, we measured the inhibitory effect of PA-824 on PEDV proliferation in a dose-dependent manner. By exploring the effect of PA-824 on the PEDV life cycle, we found that PA-824 acted directly on viral particles and hindered the adsorption, internalization, and replication phases of the virus, followed by molecular docking analysis to predict the interaction between PA-824 and PEDV non-structural proteins. Finally, we found that PA-824 could inhibit the apoptotic signaling pathway by suppressing PEDV-induced p53 activation. These results suggest that PA-824 could be protective against PEDV infection in piglets and could be developed as a drug or a feed additive to prevent and control PEDV diseases.

IMPORTANCE

PEDV is a highly contagious enteric coronavirus that widely spread worldwide, causing serious economic losses. There is no drug or vaccine to effectively control PEDV. In this study, we found that PA-824, a compound of mycobacteria causing pulmonary diseases, inhibited PEDV proliferation in both in vitro and in vivo. We also found that PA-824 directly acted on viral particles and hindered the adsorption, internalization, and replication stages of the virus. In addition, we found that PA-824 could inhibit the apoptotic signaling pathway by inhibiting PEDV-induced p53 activation. In conclusion, it is expected to be developed as a drug or a feed additive to prevent and control PEDV diseases.

INTRODUCTION

Porcine epidemic diarrhea (PED) is a serious intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV), which can be spread in pigs of all ages and has a pathogenic rate of up to 100% in piglets (1). PEDV infection causes a disease called PED, characterized by vomiting, dehydration, anorexia, watery diarrhea, and weight loss in piglets. Since the 1990s, PED has been a sporadic outbreak in Europe and Asia (2, 3). Since 2010, PED has re-emerged as a highly pathogenic strain in China and other Asian countries (4). In the past decade, PED has seriously threatened the global pig industry, leading to huge economic losses and public health safety risks (5).

PEDV can induce apoptosis in a dose-dependent manner, thus favoring its replication (6). It has been reported that PEDV induces cysteinyl aspartic non-dependent apoptosis mainly through the activation of mitochondrial apoptosis-inducing factors (7). Recent studies have pointed out that PEDV infection activates cysteine-8 and cysteine-3, and apoptosis can be mediated by the activation of cysteine-8 and cysteine-3 (8). Meanwhile, the p53-Puma (a pro-apoptotic factor) signaling pathway plays an important role in mediating PEDV-induced apoptosis (9).

The tumor suppressor protein 53 (p53) is a sequence-specific DNA-binding protein that acts as a transcription factor to regulate cellular processes such as cell cycle arrest, senescence, and apoptosis (10). p53 can mediate apoptosis through transcriptional activation of pro-apoptotic genes (e.g., Bax, p53 AIP1, Apaf-1, and PERP) or transcriptional repression of Bcl2 and IAPs to mediate apoptosis (11). In addition, p53 can induce apoptosis by directly stimulating the release of cytochrome c from mitochondria through mitochondrial translocation (12). Under normal conditions, p53 can be stabilized at low levels, for example, in MDM2, where it acts as a ubiquitin ligase to aid p53 degradation, and these processes change when cells are stressed in response to external stimuli (13).

The livestock industry has made great efforts to control PEDV to prevent PEDV infections, especially with genetic variants in the S gene (14). Prophylactic immunization is one of the most effective means by which viral infections can be effectively controlled. Currently, inactivated and attenuated vaccines based on the PEDV CV777 strain are widely used to prevent PEDV infection. Although this method is effective against PEDV-infected piglets, there are still cases of immune failure due to the diversity of PEDV that can evade vaccines or immune monitoring in specific animal individuals (15). This makes it important to develop and screen novel antiviral drugs against PEDV infection for further prevention and treatment. Small molecule compounds have been shown to inhibit different species of viral pathogens such as coronaviruses, dengue viruses, coxsackieviruses, and influenza viruses (16). Many studies have identified various compounds that can exhibit antiviral activity against PEDV. For example, buddlejasaponin IVb was found to inhibit PEDV proliferation at micromolar concentrations (17), cinchonin inhibited PEDV replication by inducing cellular autophagy (18), ZINC12899676 was shown to inhibit PEDV replication in IPEC-J2 cells by targeting NTPase (19), and levistolide A was directed to inhibit PEDV attachment to cell membranes or penetration of cells (20). However, given the various side effects (e.g., myelosuppression, neuropsychiatric symptoms, etc.) and resistance to these drugs, there is a need to continue the search for new drugs that inhibit PEDV in vitro and in vivo.

Pretomanid (PA-824), a nitroimidazole analog, was reported to show a correlation between PA-824 structure and metronidazole. Currently, this compound has a promising clinical application as a novel drug candidate for tuberculosis control. PA-824 with anti-mycobacterial activity was first reported in 2000 (21). Subsequent in vitro studies showed susceptibility to both rifampicin-resistant and multidrug-resistant strains and no cross-resistance with other anti-tuberculosis drugs (22, 23). In addition, experiments with short- or long-term infection model experiments of mycobacteria in animals also confirmed that PA-824 showed highly antibacterial activity and less toxicity to animal bodies (24). However, there are no reports related to the antiviral effects of PA-824.

In this study, we screened 314 small molecule drugs and found that PA-824 exhibited high anti-PEDV activity in vitro and in vivo and showed significant inhibition of PEDV-induced apoptosis, and these findings are expected to provide insights into the application of PA-824 in anti-PEDV infection.

RESULTS

Library screening

Vero cells were treated with 10 µM of the compound, and PEDV was infected according to the timeline (Fig. 1A). The results showed that 21 compounds (6.69%) were non-significantly cytotoxic, with a 50% reduction in cytopathic effect (CPE) compared with dimethyl sulfoxide (DMSO) alone. These compounds were then subjected to the second round of screening (Fig. 1A). Four of these compounds produced negligible cytotoxicity by indirect immunofluorescence assay (IFA) and inhibited PEDV infection by more than 70% (Fig. 1B and C). In addition, they inhibited PEDV in a dose-dependent manner with a selectivity index (SI) greater than 10 (Fig. 1D). PA-824 was selected for further study due to its highest SI and lowest price.

Fig 1.

Screening protocol for PEDV inhibitors. (A) Flow chart of the screening process. Vero cells were incubated with 10 µM compound for 1 h and then infected with PEDV (0.01 MOI). One hour later, the cells were washed with PBS three times, and the complex medium was added to the corresponding wells and continued to incubate for 19 h. During the first round of screening, natural products that do not cause significant cytotoxicity and reduce CPE by more than 50% compared with the DMSO control will be screened for the next screening. In the second round of screening, cell viability reached more than 80%, and PEDV inhibition reached more than 80%, and finally, semi-effective concentration (IC₅₀) and semi-lethal concentration (CC₅₀) were calculated using GraphPad Prism 9.0. Natural products with a selectivity index (SI = CC₅₀/IC₅₀) greater than 10 and a dose-dependent inhibition of PEDV were further investigated. (B) The effect of the four compounds on PEDV was observed by CPE and IFA in Vero cells. CPE is shown in a bright field of view; the PEDV N protein is green, and the nucleus is blue. (C) CC₅₀ and semi-inhibitory concentration profiles of the four compounds on Vero cells. (D) CC₅₀, IC₅₀, and SI of the four compounds.

PA-824 had a therapeutic effect on PEDV in piglets

Clinical signs and toxicity

After an attack with high concentrations of PEDV, all piglets in the control group exhibited disheveled coats, depression, loss of appetite, vomiting, and watery diarrhea. Four of the five pigs in this group died between 30 and 72 hpi (Fig. 2A). Infected and mock-infected pigs treated with 50 mg/kg PA-824 showed no signs of diarrhea or vomiting during the experiment. All pigs in these groups survived (Fig. 2B and C). Some of the infected pigs treated with 25 mg/kg PA-824 showed diarrhea symptoms at 20 hpi, and one of them died at 43 hpi. The viral load in feces and intestinal tissues of infected pigs treated with 50 mg/kg PA-824 was significantly lower than that of control pigs (P < 0.05). Feces were collected from pigs at 12, 24, 36, 48, 60, and 72 hpi, respectively. The copy number of PEDV genomic cDNA was detected by quantitative reverse transcription PCR (qRT-PCR) (Fig. 2D and E). The circulating virus levels in the feces of infected pigs treated with 25 and 50 mg/kg PA-824 were significantly lower (P < 0.05) than those of the control group at 12–72 hpi. Similarly, the copy number of PEDV genomic DNA in the intestinal tissues of infected pigs treated with 50 mg/kg PA-824 was significantly lower than that of the control group (P < 0.05).

Fig 2.

Observation of the efficacy of PA-824 on PEDV-infected piglets. (A) Schematic diagram of the animal experimental procedure. (B) Survival of piglets in each group. (C) Mean clinical scores of each group. Piglets were observed and scored daily. (D) Virus content in pig feces. (E) Detection of enteric tissue virus content by RT-qPCR. These results are from one of three independent experiments. Error bars indicate standard deviation (SD). Asterisks in the graph indicate significant differences (**P < 0.01; ***P < 0.001).

Intestinal pathology

Pathological necropsy examination of the small intestine showed signs of dilated small intestine filled with yellowish-white fluid or milky substance, thinning of the intestinal wall, and congestion of the mesentery in infected pigs. In contrast, no pathological lesions were found in the control pigs. The infected pigs treated with PA-824 showed significantly smaller intestinal lesions than the control pigs, and the effect was dose-dependent (Fig. 3A and B). The scores of the PA-824 25 and 50 mg/kg groups were significantly lower than those of the control group. Microscopic intestinal villi of pigs in the positive group were significantly atrophied. Microscopic small intestinal lesions were significantly lower in pigs treated with 50 mg/kg PA-824 than in control pigs. Twenty-five milligrams per kilogram of PA-824-treated pigs showed mild lesions (Fig. 3C and D).

Fig 3.

Gross and microscopic observations of the intestinal tract of piglets. (A) General intestinal condition of mock, PEDV, 25 mg/kg, and 50 mg/kg treatment groups. (B) Microscopic observation of the intestine in the mock, PEDV, 25 mg/kg, and 50 mg/kg treatment groups. (C) General intestinal histological lesion score. (D) Microscopic scoring of intestinal lesions. These results are from one of three independent experiments. Error bars indicate SD. Asterisks in the figure indicate significant differences (**P < 0.01; ***P < 0.001).

Intestinal tissue inflammation

The levels of inflammatory cytokines in intestinal tissues at 72 hpi were measured by qRT-PCR. The expression levels of IL-1β, IL-6, IL-8, and TNF-α were increased in PEDV-infected piglets compared with mock-infected animals. The expression levels of IL-1β, IL-6, IL-8, and TNF-α were dose-dependently attenuated in the intestinal tissues of infected piglets treated with PA-824 in Fig. 4.

Fig 4.

Inflammatory response to PA-824 treatment of PEDV. The expression of IL-1β (A), IL-6 (B), IL-8 (C), and TNF-α (D) mRNAs in the intestinal tissues of each group was measured by RT-qPCR. All analyses were repeated at least three times, with each experiment repeated three times. These results are from one of three independent experiments. Error bars indicate SD. Asterisks in the graph indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001).

PA-824 inhibits PEDV in a dose-dependent manner

To determine the dose range of PA-824 with anti-PEDV activity, Vero cells were treated with 10 µM, 30 µM, and 50 µM PA-824 for 1 h after infection with PEDV. Median tissue culture infectious dose (TCID₅₀), western blot, and qRT-PCR analysis showed a dose-dependent decrease (Fig. 5A through C). At 20 h post-infection (hpi), IFA showed that the number of infected cells in the PA-824-treated group was significantly lower than that in the negative control group (Fig. 5D and E).

Fig 5.

Anti-PEDV activity of PA-824 was characterized on Vero and IPEC-J2 cells. Vero cells were pretreated with 10, 30, and 50 μMPA-824 (A–D) for 1 h, and then incubated with PEDV for 1 h, washed with PBS, and then again incubated in a fresh medium containing PA-824 for 20 h. DMSO was used as treatment control. (A) RT-qPCR was used to detect the relative levels of PEDV N mRNA. (B) Culture supernatants were collected for virus titration. The results are expressed as TCID₅₀. (C) Western blot identification. (D and E) IFA images showing viral N protein in green and nuclei in blue; IPEC-J2 cells were pretreated with 10, 30, and 50 µM PA-824 for 1 h. IPEC-J2 cells were incubated with PEDV for 1 h, washed with PBS, and cultured in a fresh medium containing PA-824 for 20 h. DMSO was used as treatment control. (F) Cell viability assay of IPEC-J2 by different concentrations of PA-824. (G) Relative PEDV N mRNA levels were detected by RT-qPCR. (H) Culture supernatants were collected for virus titration. The results are expressed as TCID₅₀. (I and J) Western blot identification. These results are from one of three independent experiments. Error bars indicate SD. Asterisks in the figure indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001).

To understand the antiviral activity of PA-824 in porcine cells, we first tested the cell viability of IPEC-J2 cells (Fig. 5F). Then, it was treated with 10, 30, and 50 µM of PA-824 for 1 h after infection with PEDV (0.1 MOI). TCID₅₀, qRT-PCR, and western blot analyses showed a significant and dose-dependent decrease in the expression level of PEDV N (Fig. 5G through J).

Effect of PA-824 on virus inactivation, attachment, entry, replication, and release

To further explore the mechanism by which PA-824 inhibits PEDV infection, we first tested whether PA-824 directly killed PEDV particles. As shown in Fig. 6A, PA-824 treatment directly inactivated PEDV. Then, the amount of PEDV N mRNA relative to β-actin was measured by qRT-PCR to determine the effect of PA-824 on PEDV attachment, internalization, and replication. The results showed that the use of PA-824 blocked viral attachment to Vero cells before PEDV infection, indicating that PA-824 inhibited PEDV attachment to cells (Fig. 6B). In assessing the effect of PA-824 on PEDV internalization, as shown in Fig. 6C, we determined that PA-824 hindered the internalization of the virus compared with DMSO treatment. This may be related to the inactivating effect of PA-824 on PEDV particles. We then examined the effect of PA-824 on PEDV replication by adding PA-824 to the PEDV replication phase. As shown in Fig. 6D, the addition of PA-824 reduced the transcriptional level of PEDV N mRNA compared with DMSO treatment. In addition, virus release assays showed no significant difference in PEDV RNA levels between PA-824 and DMSO-treated supernatants (Fig. 6E). Taken together, these results suggest that PA-824 inhibits PEDV infection mainly by directly inactivating the virus and affecting viral replication.

Fig 6.

Effect of PA-824 on PEDV. (A) Inactivation, attachment, entry, replication, and release—four groups: A. PEDV (0.01 MOI) + PA-824 (50 µM); B. PEDV (0.01 MOI) + DMSO; C. DMSO, and D. PA-824 (50 µM), incubated at 37°C for 3 h and 5 h. Group A, C, or B, and the mixture of group D into Vero cells cultured in 24-well plates, incubated at 37°C for 1 h, and washed with PBS three times. Replace with fresh Dulbecco’s modified Eagle’s medium (DMEM) and incubate for another 12 h. (B) Viral attachment assay. (C) Viral internalization assay. (D) Virus replication assay. (E) Virus release assay. These results are from one of three independent experiments. Error bars indicate SD. Asterisks in the graph indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001; ns: not significant).

PA-824 has a higher binding energy with multiple nonstructural proteins of PEDV, but not with the structural proteins

Considering that PA-824 can directly affect PEDV, molecular simulation of PA-824 was performed using PEDV structural proteins, such as fibrin, nucleocapsid, capsular protein, and membrane protein. Unfortunately, the binding free energy of PA-824 to PEDV structural proteins was higher than −8 KJ/mol (data not shown), indicating that the possibility of PA-824 interacting with PEDV’s fibrin, nucleocapsid, capsid, and membrane proteins was very low. In addition, our data showed that PA-824 inhibited the replication phase of the virus. To further verify this, Autodock was used to analyze the binding free energy between PA-824 and PEDV non-structural proteins, and pymol software was used to visualize the interaction sites between PA-824 and PEDV non-structural proteins (Fig. 7A). The results showed that the binding energy between PA-824 and several non-structural proteins of PEDV was less than −8 KJ/mol (Fig. 7B). These data indicate that PA-824 has a great potential to inhibit PEDV replication.

Fig 7.

PA-824 has high binding energy with several non-structural proteins of PEDV but not structural proteins. (A) Docking conformation of PA-824 and PEDV nsp1, nsp4, nsp5, nsp9, nsp13, nsp14, nsp15, and nsp16. The compounds and proteins were represented by sticks and cartoons. These compounds are grass green. The protein is bean green. Amino acids that the protein binds to the compound are shown in red. (B) The binding energy of PA-824-protein complex calculated using Autodock is listed.

Inhibition of PEDV infection by PA-824 induces apoptosis in Vero cells

PEDV-induced apoptosis facilitates viral replication and CPE. In the present study, we investigated whether PA-824 inhibited PEDV-induced apoptosis by western blot and flow cytometry. PEDV infection increased the expression of pro-apoptotic Bax, promoted the cleavage of the apoptotic executioner caspase-3, and decreased the expression of anti-apoptotic Bcl-2 (Fig. 8A and B). PA-824 treatment reversed these phenomena. Fluorescein isothiocyanate (FITC)-labeled annexin V is typically used for specific targeting and identification of apoptotic cells. Compared with the infected cells without PA-824 treatment, the positive rate of annexin V in the infected cells treated with PA-824 decreased in a dose-dependent manner (Fig. 8C and D). These data confirm the inhibitory effect of PA-824 on PEDV-induced apoptosis.

Fig 8.

PA-824 inhibits PEDV-induced apoptosis in Vero cells. Mock-infected or PEDV-infected cells were treated with different concentrations of PA-824. At 24 hpi, cells were assayed for relevant indices. (A) Western blot detected the expressions of Bax, Bcl-2, and cysteine-3. (B) The results are expressed as the ratio of target protein band intensity to β-actin band intensity, densitometric analysis of Bax relative to Bcl-2, and cleaved caspase three relative to Caspase 3. (C and D) The apoptosis rates were analyzed by flow cytometry. Error bars indicate SD. Asterisks in the graph indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001).

PA-824 reduces PEDV-induced apoptosis by inhibiting p53 activation

Considering that p53 is an important mediator of PEDV-induced apoptosis, we examined the effect of PA-824 on p53 activity during PEDV infection. Immunoblot analysis showed increased expression of p53 and p-p53 in PEDV-infected cells, indicating that p53 was activated by PEDV infection (Fig. 9A and B). PA-824 treatment alleviated this increase (Fig. 9A and B). To further elucidate the mechanism by which PA-824 alleviates PEDV-induced apoptosis from a p53 perspective, we treated cells with varying concentrations of PA-824 and collected samples at 24 and 36 h post-infection (hpi). Immunoblot analysis revealed that PA-824 inhibited the expressions of both p53 and p-p53 in Vero cells (Fig. 9C and D). Additionally, we treated Vero cells with the p53-specific inhibitor PFT-α and then analyzed the expression of apoptosis-related proteins. Flow cytometry analysis revealed that both PA-824 and PFT-α significantly reduced the percentage of apoptotic cells in infected cells (Fig. 10A and B); immunoblot analysis showed that PFT-α decreased the expression of Bax and caspase-3, increased the expression of Bcl-2, and decreased the expression of PEDV N in infected cells (Fig. 10C and D), indicating that p53 plays a key role in PEDV-induced apoptosis and viral replication. PA-824 decreased the expression of p53 and PEDV N (Fig. 10C and D), suggesting that PA-824 inhibits PEDV-induced apoptosis by hindering p53 activation. Cell viability assays demonstrated the PFT-α had no toxic effects on Vero cells (Fig. 10E).

Fig 9.

PA-824 inhibits PEDV activation of p53 induced by Vero. Mock-infected or PEDV-infected cells were treated with 30 µM or 50 µM PA-824. At 24 hpi, cells were assayed for relevant indicators. (A) Western blotting analysis of the expression of PEDV, p53, and p-p53. (B) Results are expressed as the ratio of target protein band intensity to β-actin band intensity. (C) Healthy Vero cells were treated with 10, 30, and 50 µM PA-824. At 24 hpi or 36 hpi, cells were assayed for relevant indicators. Western blot detected the expressions of p53 and p-p53. (D) Results are expressed as the ratio of target protein band intensity to β-actin band intensity (*P < 0.05; **P < 0.01; ***P < 0.001).

Fig 10.

PA-824 reduces PEDV-induced apoptosis by inhibiting the activation of p53. Mock-infected or PEDV-infected cells were treated with 50 µM PA-824 or 10 µM PEDV-α (PFT-α). At 24 hpi, cells were assayed for relevant indicators. (A and B) The apoptosis rates were analyzed by flow cytometry. (C) The expression of PEDV N, p-p53, p53, cleaved caspase3, Bax, and Bcl-2 was detected by immunoblotting. (D) Results are expressed as the ratio of target protein band intensity to β-actin band intensity. (E) Determination of cytotoxicity of PA-824 by CCK-8 assay (*P < 0.05; **P < 0.01; ***P < 0.001).

DISCUSSION

Porcine epidemic diarrhea is an important porcine intestinal disease that causes vomiting and diarrhea in pigs and can be spread among pigs of all ages but mainly affects piglets up to 6 days of age, causing significant economic damage to the global pig industry. Current vaccination strategies have some effect against this infectious disease, but they are not optimal in terms of safety and efficacy, and mass infections often occur. Therefore, the search for effective anti-PEDV drugs is necessary. Currently, several anti-PEDV drugs have been identified by the available research reports, for example, PD 404, 182 (25), epigallocatechin-3-gallate (26), tomatidine (27), etc. In this study, PA-824, which was screened from a library of 314 small molecule drugs, showed significant inhibition of PEDV both in vitro and in vivo. In addition, PA-824 reduced the activation of apoptotic pathways induced by PEDV infection.

It is well known that the function of a drug in vitro is not equal to its function in vivo. Clinical manifestations of PEDV infection are diarrhea, vomiting, dehydration, depression, and weight loss. Infection and mortality rates are high for newborn piglets. In order to study and observe the inhibitory effect and pathogenicity of PA-824 on PEDV replication in vivo, the highest SI index of PA-824 was selected for this study, and the fact that PA-824 can be administered orally is a good way to avoid the situation that frequent intramuscular injections cause stress and hinder piglet growth. Pharmacokinetic experiments in rats showed that after a single oral administration of PA-82 440 mg/kg, the concentration of PA-824 in the liver, spleen, small intestine, and lungs was higher than that in plasma (28). In addition, Stover CK et al. conducted a toxicological evaluation of PA-824 by using mice. Acute toxicity tests have shown that a single dose of 1,000 mg/kg can produce toxicity, whereas long-term toxicity tests have shown that toxicity only occurs when the dose is 500 mg/kg (21). The treatment concentrations for piglets were calculated based on the therapeutic drugs in the mouse test, and then, 25 mg/kg and 50 mg/kg were selected for the treatment experiments. The results of the animal experiments showed that piglets in the oral PA-824 25 mg/kg group exhibited only mild clinical signs, mild injury, low viral load, and intestinal inflammatory response compared with the PEDV challenge control group. In addition, pigs treated with 50 mg/kg showed very mild clinical signs, almost the same intestinal lesions and viral load as the mock-infected group, and lower levels of intestinal inflammatory factors. The above results indicate that PA-824 can effectively reduce the pathogenic effect of PEDV infection on piglets, which is important for the development of PEDV therapeutic drugs or feed additives.

The antiviral mechanisms of antiviral drugs can be divided into two main categories: targeting the virus itself and targeting the host factors involved in viral infection. Viral attachment, internalization, replication, and release are important components of the coronavirus life cycle. Interfering with any of these processes inhibits viral infection. Our results show that PA-824 can directly inactivate PEDV, suggesting that PA-824 can inhibit PEDV proliferation by directly interacting with viral particle proteins. In recent years, molecular docking has been applied on a large scale in the field of antiviral drug screening, and virtual screening of the Selleck natural compound library using SARS-CoV-2 3CLpro as a target identified five compounds capable of inhibiting viral replication in vitro (29). Zhang H et al. used SARS-CoV-2 RdRp as a target and performed a virtual screening of 1,906 A virtual screening of 1,906 FDA-approved drugs using SARS-CoV-2 RdRp as a target and revealed that pralatrexate was able to inhibit viral replication in vitro at an EC₅₀ of 0.008 µM (30). However, our molecular docking results show that the binding energy between PA-824 and the structural protein of PEDV is low, which means that the inactivation of PEDV by PA-824 is most likely not caused by interaction with the PEDV structural proteins spike protein, membrane protein, envelope protein, and nucleocapsid protein. In addition, PA-824 can interfere with multiple steps of the PEDV life cycle, including adsorption, internalization, and replication. Some non-structural proteins are critical for viral replication; hence, we speculate that PA-824 can inhibit viral replication, possibly by targeting certain non-structural proteins. Our molecular docking results showed that the binding energy of PA-824 to multiple PEDV nonstructural proteins was less than −8 KJ, which predicts that PA-824 may inhibit viral replication by interacting with PEDV nonstructural proteins. Zhang et al. cloned and expressed the gene sequences of all structural and nonstructural proteins of PEDV and found that among the 16 nonstructural proteins of PEDV (nsps), nsp1, nsp3, nsp7, nsp14, nsp15, and nsp16 all inhibit IFN-β and IRF3 promoter activity (31). Among them, PEDV nsp1 does not interfere with IRF3 phosphorylation and nuclear translocation but regulates the host’s innate immune response by inhibiting the expression of ISGs. In addition, PEDV nsp1 acts as an NF-κB antagonist protein that inhibits the production of interferon and early inflammatory factors (32). As we all know, the interactions between macromolecular substances can be intuitively demonstrated through labeling methods such Co-IP or immunoprecipitation experiments. Unfortunately, the experimental drug we are dealing with is a small molecule substance, which cannot directly prove the interaction relationship with lower binding energy of nonstructural proteins above experiments. On the other hand, it is also beyond the range of this study. Herein, we only predict the potential relationship between PA-824 and PEDV nonstructural proteins, which will also be helpful for us to detect deeply in our future research.

Apoptosis, necrosis, and pyrophosphorylation are the three main pathways of programmed cell death (PCD) following viral infection (33, 34). Of these, apoptosis is the most widely studied PCD during viral infection. viruses use the induction of apoptosis as a way to release and spread progeny viruses (35). Previous data have shown that coronaviruses, including severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), can effectively induce apoptosis (36). PEDV has been shown to induce apoptosis in vitro and in vivo (9). This may lead to disruption of the intestinal barrier, which may impair nutrient and water absorption and lead to diarrhea. Here, we observed that PA-824 treatment attenuated PEDV-induced apoptosis. Considering that some viruses promote the spread of virus progeny by triggering apoptosis, we speculate that its inhibitory effect on PEDV-induced apoptosis may be one of the partial mechanisms by which PA-824 inhibits PEDV proliferation. Subsequently, we explored the mechanism by which PA-824 alleviates PEDV-induced apoptosis from the perspective of p53.

As an important apoptosis-related gene, the p53 protein is involved in initiating the apoptotic program when cells are damaged and completes the apoptotic regulation of cells through multiple pathways (37). In their study of the pathogenic mechanism of PEDV, Lin Yang et al. found that PEDV infection significantly increased the expression of p53, Bax, and Puma apoptosis-related proteins (9). Ming jun Su et al showed that the PEDV N protein interacts with p53 and activates the p53-DREAM pathway, which subsequently induces S-phase arrest and creates a favorable environment for viral replication (38). In addition, Zhichao Hao et al. found that the inhibition of viral infection by p53 was mediated by p53-dependent IFN signaling through overexpression of p53 protein (39). In the present study, we found that PEDV infection activated p53, and the p53 inhibitor PFT-α inhibited PEDV-induced apoptosis and hindered PEDV replication, suggesting that PEDV infection can trigger apoptosis by activating the p53 pathway, thereby promoting viral replication. PA-824 can inhibit PEDV-induced p53 activation, which is responsible for its ability to alleviate PEDV-induced apoptosis and inhibit viral replication as a mechanism. However, there are many signaling pathways that affect p53 activation; therefore, the specific reason why PA-824 inhibits PEDV-induced p53 activation, and its effect on PEDV needs to be further investigated.

In summary, our results suggest that PA-824 has a high inhibitory effect on PEDV both in vitro and in vivo and that PA-824 can inhibit PEDV-induced apoptosis through the PEDV-dependent p53 signaling pathway (Fig. 11). These results help deepen the understanding of the pathogenesis of PEDV infection and provide clues for the development of drugs or feed additives.

Fig 11.

Schematic diagram of PA-824 inhibiting PEDV-induced P53-dependent apoptosis. PEDV infection promoted the phosphorylation of p53 and then upregulated the expression of Bax and downregulated the expression of Bcl-2. Finally, it causes the activation of caspase-3. PA-824 could alleviate the activation of p53, thereby inhibiting PEDV-induced apoptosis.

MATERIALS AND METHODS

Cells, viruses, and reagents

Vero cells and IPEC-J2 cells were preserved in DMEM (Gibco, USA) containing 10% fetal bovine serum (Lonsera, Uruguay). Cells were cultured in a humidified incubator at 37°C with 5% CO₂. Strain PEDV AH-2018-HF1 (GenBank: MN315264.1) was preserved in our laboratory and passaged in Vero cells with 2.5% trypsin. The PEDV AH-2018-HF1 strain was used in all experiments and is denoted as “PEDV” in this paper. PA-824 at >99% purity was used for in vivo and in vitro experiments (Selleck Chemicals, USA).

50% cytotoxic concentration (CC₅₀) assay

Different concentrations of PA-824 were added to DMEM and incubated at 37°C for 24 h. Cell viability was assayed using Cell Counting Kit-8 (Haimenbi Institute of Biotechnology, China) according to the manufacturer’s instructions. CC₅₀ was calculated using GPraphPad Prism 9.0 software (GraphPad Software, Inc., La Jolla, CA, USA). DMSO was used as a negative control.

Screening of natural product library

A library of 314 small molecule drugs (FDA-approved) was purchased from Selleck Chemicals. The compounds were stored in DMSO at −80°C. The high-throughput screening (HTS) process for the libraries is shown in Fig. 1A and B. Vero cells were inoculated on 96-well plates at 5 × 10⁴ cells per well. When cell fusion reached 90%, cells were treated with 10 µM or DMSO for 1 h and then infected with PEDV (0.01 MOI) or mock infection for 1 h. Cells were washed three times with phosphate buffered saline (PBS) and then added containing 10 µM drug. At 20 hpi, CPE and IFA were observed under the microscope. The fluorescence intensity of IFA was measured using ImageJ software. The percent inhibition of fluorescence intensity was calculated by drug treatment relative to DMSO treatment.

During the initial screening, compounds were excluded if they caused any visible cytotoxicity or showed a decrease in CPE of less than 50% compared with the DMSO control. For the second round of screening, cell viability must be at least 80% and inhibition of PEDV must be at least 70% as determined by the IFA. IC₅₀ (compounds at concentrations of 1.0, 10.0, 20.0, 50.0, and 100.0 µM) and CC₅₀ (compounds at concentrations of 1.0, 10.0, 20.0, 50.0, 100.0, 200.0, and 300.0 µM) for each remaining candidate compound were calculated using the log (inhibitor) and response variable slope (four parameters) methods via Graphpad Prism 9.0 software, and those exhibiting a dose-dependent inhibition and selectivity index (SI, SI = CC₅₀/IC₅₀) of PEDV above 10 were considered for further study. In addition, cell viability was assayed using the Enhanced Cell Counting Kit-8 (CCK-8) (Beyotime, China) according to the manufacturer’s instructions. CC₅₀ was calculated using GraphPad Prism 9.0 software, and the negative control was DMSO.

Animal challenge

Twenty 2-day-old piglets (without maternal antibodies) were randomly assigned to the following four groups (five animals per group): (1) PEDV-infected and drug diluent-treated (0.5% sodium carboxymethylcellulose) group, (2) PEDV-infected and PA-824-treated (25 mg/kg) group, (3) PEDV-infected and PA-824-treated (50 mg/kg) group, and (4) treated with DMEM and drug diluent. As shown in Fig. 2A, 1 mL PEDV (4 × 105 TCID₅₀) was fed to piglets. At 12 h post-infection, piglets were given 25, 50 mg/kg of PA-824 or 0.5% sodium carboxymethylcellulose orally. Treatment was administered every 6 h until 66 h. After infection, piglets were monitored daily for general health and rectal temperature. All piglets were executed at 72 h. Intestinal and lung tissues were collected for determination of viral RNA load and histopathological analysis. All the animal experiments were approved by the Animal Care and Ethics Committee of Anhui Agricultural University (permit number SYXK 2016–007) and followed the Guiding Principles for Biomedical Research Involving Animals.

Pathological examination

Intestinal tissues were collected from all piglets at 72 hpi. Macroscopic intestinal lesions were estimated and scored based on the percentage of infected tissue. Meanwhile, fixed intestinal tissues were dehydrated, xylene-removed, paraffin-embedded, and then sectioned on slides and stained with hematoxylin and eosin, and the stained tissue sections were observed with a microscope.

Clinical evaluations

The pigs were scored daily on their clinical condition, with four points each for mental condition, diarrhea, and coat condition, from 1 to 4, with one being clinically normal and three indicating maximum disease. A dead pig scored four points each. The total daily clinical score was the sum of the scores in each case.

Western blot assay

Vero cells were washed with PBS and lysed on ice with lysis solution for 15 min. Protein samples containing equal amounts were separated by 10% SDS-PAGE and transferred to PVDF membranes. After transfer, PVDF membranes were closed with 5% skim milk powder (diluted with phosphate-buffered saline with 0.1% Tween-20 [PBST]) for 1 h at room temperature, washed three times with PBST, and then incubated with the following primary antibodies: anti-PEDV N-protein (1:3,000), anti-β-actin (1:5,000; sc-47778, Santa Cruz, USA), anti-p-p53 (1:5,000, abmart), anti-p53 (1:5,000, abmart), anti-Bax (1:10,000, abmart), anti-Bcl-2 (1:10,000, abmart), and anti-caspase-3 (1:10,000, abmart). Incubate at room temperature for 2 h or overnight at 4°C. The membranes were then washed three times with PBST and then incubated with HRP-conjugated goat anti-mouse and anti-rabbit IgG (H + L) secondary antibodies for 1 h at room temperature (1:5,000; Beyotime, China). Binding proteins were exposed with the ECL kit (Tanon, China).

RNA extraction and real-time fluorescence quantitative PCR

Total RNA was extracted from cells using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Inc., Norcross, GA, USA) and then reverse-transcribed using the HiScript II First Strand cDNA Synthesis Kit (Vazyme Biotechnology Co., Ltd., Nanjing, China). qRT-PCR was performed using the SuperReal PreMix Plus (SYBR Green) (TIANGEN BIOTECH Co., Ltd) was used according to the manufacturer’s instructions. Design RT-qPCR primers, based on the mRNA sequence on NCBI, are shown in Table 1. Data are expressed as ploidy changes in gene expression normalized to β-actin and ploidy changes relative to mock-infected controls. Three replicates of each reaction were performed, and data are expressed as mean ± standard deviation (SD).

TABLE 1.

Primers used for RT-qPCR

Primer	Sequence (5′→3′)
β-actin- F	CCCAGAGCAAGAGAGGCAT
β-actin-R	GGTAGTCAGTCAGGTCCCG
PEDV-F	GCAGATTTAGAGCAGCGTTCA
PEDV-R	TAATCAACCAAACCCACCAC
IL-6-F	TGAACTCCTTCTCCACAAGC
IL-6-R	GCGGCTACATCTTTGGAATC
IL-8-F	CTGGCGGTGGCTCTCTTC
IL-8-R	CCTTGGCAAAACTGCACCTT
IL-1β-F	GCGGCAACGAGGATGACTT
IL-1β-R	TGGCTACAACAACTGACACGG
TNF-a-F	GCCACCACGCTCTTCTGTCTG
TNF-a-R	AGGGGTCCTTGGGGAACTCTT

Virus titration

Vero cells cultured in 96-well plates were infected with 10-fold serial dilutions of PEDV samples in eight replicates. After 1 h incubation at 37°C, the medium was replaced with fresh DMEM. Incubation at 37°C for 72 h. Viral titers were expressed as TCID₅₀, and the TCID₅₀ of PEDV was calculated using the Reed-Muench method.

Indirect Immunofluorescence Assay

The effect of PA-824 on PEDV infection in Vero cells was assayed with IFA. Serially diluted PA-824 was added to the cell culture medium (final concentrations of 10, 30, and 50 µM). The negative control was DMSO. Then, PEDV (0.01 MOI) was added to the cells and incubated at 37°C for 20 h. The cells were then fixed with 4% paraformaldehyde for 20 min, washed with PBS, and then permeabilized with 0.1% Triton X-100 at 37°C for 20 min. The treated cells were incubated with mouse anti-PEDV N protein multiplexes prepared in our laboratory (1:100 dilution) at 37°C for 2 h. PBS was used to wash the cells three times and FITC-labeled goat anti-mouse IgG (H + L) antibody (1:200 dilution) (A0568, Beyotime, China) was incubated at 37°C for 1 h. After PBS washing, cells were observed with a Zeiss inverted fluorescence microscope. Fluorescence-integrated optical density was measured using ImageJ software.

Virus inactivated assay

PA-824 (50 µM) or DMSO was incubated with PEDV (0.01 MOI) at 37°C for 3 h and 5 h (−3 h/−5 h: after the liquid is prepared, incubate for 3 or 5 h at 37°C before mixing the liquid into the corresponding well). The mixture of PA-824 (50 µM) or DMSO with PEDV was placed in 24-well plates. A mixture of PA-824 (50 µM) or DMSO with PEDV was placed in Vero cells on 24-well plates. After incubation at 37°C for 1 h, the culture supernatant was replaced with fresh DMEM and incubated for another 12 h. Cells were rinsed with PBS and PEDV N and β-actin mRNA levels were detected in cells by qRT-PCR.

Virus attachment assay

Vero cells were pretreated with PA-824 (50 µM) or DMSO at 37°C for 1 h and then infected with PEDV (0.01 MOI) at 4°C for 15 min, 30 min, and 1 h. Cells were then washed with pre-chilled PBS, and PEDV N and β-actin mRNA levels were detected in cells by qRT-PCR.

Virus internalization assay

Vero cells were infected with PEDV (0.01 MOI) at 4°C for 1 h. The supernatant was replaced with DMEM containing PA-824 (50 µM) or DMSO and then incubated for 30 min, 1 h, and 2 h at 37°C. Cells were washed with citrate buffer (pH = 3) to remove the non-internalized virus. The mRNA levels of PEDV N and β-actin in the cells were detected by qRT-PCR.

Virus replication assay

Vero cells were incubated with PEDV (0.01 MOI) at 37°C for 1 h. PBS was used to wash the samples three times to remove free viruses. The medium was replaced with fresh DMEM containing PA-824 (50 µM) or DMSO at 4 hpi and incubated at 37°C (Fig. 3D). PEDV N and β-actin mRNA levels in specimens collected at 6, 8, and 10 hpi were detected by qRT-PCR.

Virus release assay

Vero cells were infected with PEDV (0.01 MOI) at 37°C for 1 h. The medium was then replaced with fresh DMEM. Cells were washed three times withPBS under 10 hpi conditions, and the culture medium was replaced with fresh DMEM containing PA-824 (50 µM) or DMSO. Cells were incubated at 37°C for 0.5, 1, and 2 h, and the supernatants were collected (Fig. 3E). The mRNA levels of PEDV N and β-actin in the cells were detected by qRT-PCR.

Molecular docking

3D modeling of PEDV nonstructural proteins using I-TASSER docked PA-824 to the active pocket of potential replication-associated proteins using the Autodock 4.2 program. The estimated binding free energies were ranked, and the docking results were visualized using PyMOL 2.3.2.

Apoptotic rate measurement

Using different concentrations of PA-824, treat cells simulated to be infected or PEDV infected. At 24 hpi, cell apoptosis was detected using FITC Annexin V Apoptosis Detection Kit (Vazyme Biotechnology Co., Ltd., Nanjing, China) according to the manufacturer’s protocol. Briefly, cells were washed twice with PBS and re-suspended in 100 µL binding buffer; then, 5 µL Annexin V-FITC and 5 µL PI were added. After incubating in the dark at 37°C for 10 min, 400 µL binding buffer was added. Additionally, 10,000 cells were acquired, and the percentage of positive cells was analyzed by flow cytometry (BD FACSCalibur Flow Cytometer, BD Biosciences, San Diego, CA, USA).

Statistical analysis

All statistical analyses were performed using GraphPad Prism 9.0 software. The results are expressed as mean ± standard deviation. Significance of differences between groups was determined by one-way or two-way ANOVA. P < 0.05 differences were considered significant and are indicated by an asterisk (*) in the graph.

ETHICS APPROVAL

This study strictly followed the experimental protocol for animal testing and was approved by the Ethics Committee of Anhui Agricultural University.