The biosynthesis mechanism of bacterioruberin in halophilic archaea revealed by genome and transcriptome analysis

ABSTRACT

Halophilic archaea are promising microbial cell factories for bacterioruberin (BR) production. BR is a natural product with multi-bioactivities, allowing potential application in many fields. In the previous work, a haloarchaeon Halorubrum sp. HRM-150 with a high proportion of BR (about 85%) was isolated, but the low yield impeded its large-scale production. This work figured out BR synthesis characteristics and mechanisms, and proposed strategies for yield improvement. First, glucose (10 g/L) and tryptone (15 g/L) were tested to be better sources for BR production. Besides, the combination of glucose and starch achieved the diauxic growth, and the biomass and BR productivity increased by 85% and 54% than using glucose. Additionally, this work first proposed the BR synthesis pattern, which differs from that of other carotenoids. As a structural component of cell membranes, the BR synthesis is highly coupled with growth, which was most active in the logarithm phase. Meanwhile, the osmotic down shock at the logarithm phase could increase the BR productivity without sacrificing the biomass. Moreover, the de-novo pathway for BR synthesis with a key gene of lyeJ, and its competitive pathways (notably tetraether lipids and retinal) were revealed through genome, transcriptome, and osmotic down shock. Therefore, the BR yield is expected to be improved through mutant construction, such as the overexpression of key gene lyeJ and the knockout of competitive genes, which need to be further explored. The findings will contribute to a better understanding of the metabolism mechanism in haloarchaea and the development of haloarchaea as microbial cell factories.

IMPORTANCE

Recent studies have revealed that halophilic microorganism is a promising microbial factory for the next-generation industrialization. Among them, halophilic archaea are advantageous as microbial factories due to their low contamination risk and low freshwater consumption. The halophilic archaea usually accumulate long chain C₅₀ carotenoids, which are barely found in other organisms. Bacterioruberin (BR), the major C₅₀ carotenoid, has multi-bioactivities, allowing potential application in food, cosmetic, and biomedical industries. However, the low yield impedes its large-scale application. This work figured out the BR synthesis characteristics and mechanism, and proposed several strategies for BR yield improvement, encouraging halophilic archaea to function as microbial factories for BR production. Meanwhile, the archaea have special evolutionary status and unique characteristics in taxonomy, the revelation of BR biosynthesis mechanism is beneficial for a better understanding of archaea.

INTRODUCTION

In recent years, certain traditional industrial products are gradually replaced by biological products generated by microbial cell factory to the advancement of synthetic biology, such as bioplastic, cosmetic material, and food additive (1). The early studies mainly used bacteria or fungi as microbial cell factories, notably Escherichia coli and Saccharomyces cerevisiae (2). Nevertheless, recent studies have revealed that halophilic microorganisms are promising for the next-generation microbial cell factory (1, 2). Among them, the halophilic archaea are advantageous as microbial cell factories. First, the halophilic archaea are usually distributed in hypersaline environments with a salinity range of 200–300 g/L. The hypersaline environment and halocin secreted by halophilic archaea (3) inhibit the growth of other microorganisms, lowering the possibility of contamination and allowing open fermentation with unsterilized media (4). In addition, the culture medium of halophilic archaea could be prepared using seawater or brine water instead of freshwater, which saves valued freshwater resources (5, 6). Therefore, halophilic archaea are promising candidates for the next generation of industrial microbes because of these benefits.

Halophilic archaea accumulate various and special bioactive metabolites in the cells to survive in the harsh environment, including carotenoids, polyhydroxyalkanoates, archaeal rhodopsin, exopolysaccharide, and extracellular enzymes (3). As the main component of haloarchaeal carotenoids, the long-chain C₅₀ carotenoids are barely found in other organisms. Bacterioruberin (BR), the major C₅₀ carotenoid, is an oxygenated carotenoid with thirteen conjugated double bonds. BR has been reported to increase the stability of membranes under high osmotic conditions, and protect cells against UV light and oxidative stresses (7–9). The antioxidative activity of BR extracts has been reported to surpass the common C₄₀ carotenoids (e.g., β-carotene and astaxanthin) (10, 11) and non-pigment antioxidants (e.g., trolox, ascorbic acid and butylhydroxytoluene). Additionally, BR extracts also have multi-bioactivities, such as antibacterial (10), antiviral (12), antihemolytic (9), and antitumor activity (9, 13, 14), suggesting its potential application in food, cosmetic, and biomedical industries.

The production of BR mainly depends on haloarchaeal cultivation, but the low yield is the bottleneck for its industrialization. Optimization of the culture conditions has been studied to improve the BR production, particularly with the utilization of carbon sources. For example, glucose is more suitable for BR production in halophilic archaea, such as Haloferax mediterranei (15), Haloarcula sp. M1, and Halorubrum sp. M5 (16). However, there are only a handful of studies on the utilization of other carbon sources in halophilic archaea in comparison with the comprehensive research on glucose. Another strategy is to improve the BR production by means of synthetic biology, which should be based on understanding the BR synthesis pathway and regulatory system. Nevertheless, research on the metabolism of halophilic archaea is not as extensive as that of industrial microorganisms, and even less on the BR synthesis mechanism. Yang et al. (17) proposed the prolongation pathway from lycopene to BR for the first time, and identified three enzymes including bifunctional lycopene elongase and 1,2-hydratase (LyeJ), carotenoid 3,4-desaturase (CrtD) and C₅₀ carotenoid 2″,3″-hydratase (CruF) in Haloarcula japonica. Thereafter, a hypothetical metabolic map of carotenogenesis has been established in halophilic archaea (particularly the Haloferax genus) through bioinformatics analysis of a hundred haloarchaeal genomes, and the sequences of three genes (lyeJ, crtD, and cruF) were found highly conserved within the same genus (18). Despite those findings being helpful in understanding the BR synthesis mechanism, the low gene homology between genera and ambiguous annotations has nevertheless occurred. Consequently, further elucidation of the BR synthesis mechanism is needed.

In previous work, a haloarchaeon Halorubrum sp. HRM-150 were isolated from the brine in solar saltworks. Despite the low content of BR in the cell, the strain is an ideal candidate for BR production due to the fact that BR accounted for about 85% of the total carotenoids (11), which is much higher than 52.4% of H. mediterranei (19). Thus, this study analyzed the metabolic network of Halorubrum sp. HRM-150 in particular with the carbon source metabolism and revealed the de-novo BR synthesis pathway through the genome annotation, and determined the key gene involved in the BR synthesis by means of the osmotic shock. Furthermore, the growth coupling pattern of BR synthesis was proposed based on the analysis of the growth curve, BR production, and transcriptome. Additionally, some strategies were proposed to improve the BR production. The findings will enhance the comprehension of the metabolism mechanism in halophilic archaea, as well as develop halophilic archaea as microbial cell factories.

RESULTS

Bacterioruberin synthesis characteristics

Both the OD₆₀₀ value and BR productivity of Halorubrum sp. HRM-150 increased during 120 h culture. After that, the growth proceeded to the stationary phase, when the cell mass and BR productivity reached the peak (Fig. 1A and B). The maximum OD₆₀₀ and productivity were 2.73 ± 0.14 and 1.44 ± 0.04 µg/mL, respectively. To further validate the BR synthesis phase, the BR content per cell at different growth stages was determined, and found that the BR content in the cell increased two times from 48 to 96 h and kept stable afterward (Fig. 1C). This indicated that the cell massively synthesized BR at the logarithm phase instead of the stationary phase.

Fig 1.

Growth and bacterioruberin synthesis characteristics of Halorubrum sp. HRM-150. (A) Growth curve. The dotted line is the fitted curve using the logistic growth model. (B) Bacterioruberin productivity. (C) Bacterioruberin content per cell. The letters a, b, and c represent significant differences (P < 0.05).

Genome analysis and metabolic network prediction

The whole-genome map of Halorubrum sp. HRM-150 is shown in Fig. S1. The genome size was 2,996,265 bp with 68.78% of GC content. A total of 2,956 genes was obtained with an average length of 853 bp, and the encoding region accounted for 84.11%. In addition, the genome contained 39 repeat sequences, including 20 long terminal repeats, 8short interspersed nuclear elements, 7microsatellite DNA, and 4 long interspersed nuclear elements. However, CRISPR was not detected in the genome. According to the gene annotation, the metabolic network of Halorubrum sp. HRM-150 was analyzed, such as transport systems, carbon metabolism, nitrogen metabolism, amino acid metabolism, and so on (Fig. 2). And, the genes involved in the metabolic network were listed in Tables S1 to S4.

Fig 2.

Metabolic network predicted by the genome annotation. Blue arrow, amino acid synthesis; red arrow, semi-phosphorylated Entner-Doudoroff pathway; green arrow, nucleotide synthesis; purple arrow, tricarboxylic acid cycle; orange arrow, mevalonic acid pathway and ether lipid synthesis pathway; pink arrow, bacterioruberin synthesis; ellipses and arrows, transporters.

Carbon source preference

To explore the carbon source preference, a total of nine carbon sources (including glucose, glycerol, lactose, sucrose, fructose, maltose, starch, sodium acetate, and methyl cellulose) were included in the culture medium, respectively. The results displayed that the strain could utilize eight carbon sources well except for fructose (Fig. 3A). Moreover, the highest OD₆₀₀ value, BR productivity, and BR content per cell were achieved when the strain was cultured with supplementation of glycerol (3.13 ± 0.12), glucose (1.98 ± 0.05 µg/mL), and starch [(5.54 ± 0.30) × 10⁻¹⁰ µg/cell], respectively (Fig. 3A, C and D).

Fig 3.

Growth and bacterioruberin production of Halorubrum sp. HRM-150 with different carbon/nitrogen sources. (A) Growth curve with different carbon sources. (B) Growth curve with different nitrogen sources. (C) Bacterioruberin productivity with different carbon/nitrogen sources. (D) Bacterioruberin content per cell with different carbon/nitrogen sources. (E) Growth curve with the combination of glucose and starch. (F) Bacterioruberin productivity with the combination of glucose and starch. The letters a and b represent significant differences (P < 0.05). The carbon source preference was detected using 15 g/L casein acid hydrolysate as a nitrogen source. The nitrogen source preference was detected using 10 g/L glucose as a carbon source, and 0.5 g/L yeast extract was added in NH₄Cl, NaNO₃, and NaNO₂ group to provide vitamins and trace elements.

The strain was further cultured using the combination of glucose and starch. The growth curve displayed a diauxic growth with the ratio of 1:2 and 1:1 (glucose:starch, g/g, Fig. 3E), and the brief cessation of growth occurred from 36 to 48 h. The stationary phase was delayed from 96 to 120 h, and high biomass (about OD₆₀₀ 5) was achieved with the ratio of 1:2 and 2:1 (glucose:starch, g/g), which was 1.8 times and 2.7 times that with glucose and starch, respectively. In addition, the BR productivity was 3.04 ± 0.31 µg/mL using a ratio of 1:2 (glucose:starch, g/g), which was 54% higher than that of glucose (Fig. 3F).

Nitrogen source preference

Five organic and inorganic nitrogen compounds (including casein acid hydrolysate, tryptone, NH₄Cl, NaNO₃, and NaNO₂) were used to explore the nitrogen source preference of Halorubrum sp. HRM-150. The strain cultured by organic nitrogen compounds (casein acid hydrolysate and tryptone) had higher cell mass than inorganic matter (Fig. 3B). Among the organic nitrogen compounds, the highest OD₆₀₀ value and BR productivity were achieved using casein acid hydrolysate (2.96 ± 0.13) and tryptone (2.52 ± 0.01 µg/mL), respectively (Fig. 3B and C). However, the OD₆₀₀ was lower than 1.0 using inorganic nitrogen source after 120 h of culture. Unexpectedly, cells cultured by NH₄Cl have higher BR content per cell [(6.75 ± 1.46) × 10⁻¹⁰ µg/cell], which was approximate to tryptone [(6.3 ± 0.9) × 10⁻¹⁰ µg/cell] (Fig. 3D).

Bacterioruberin synthesis pathway

The de-novo synthesis pathway of BR was revealed by the genome annotation (Fig. 4A). The synthesis process started from the precursor acetyl-CoA, then generated isopentenyl pyrophosphate (IPP) by the alternative mevalonate (MVA) pathway, followed by synthesized lycopene using dimethylallyl diphosphate (DMAPP) and IPP as substrates, consequently produced BR. Additionally, retinal and BR had a competitive relationship because of the substrate lycopene. In addition, there might be another branch pathway from dihydrobisanhydrobacterioruberin (DH-BABR) to monoanhydrobacterioruberin (MABR) based on the catalytic properties of CruF and CrtD. In the process, DH-BABR was first converted to Dihydromonoanhydrobacterioruberin (DH-MABR) through the reaction catalyzed by CruF, then generated MABR by the catalysis of CrtD. The phylogenetic tree indicated that the gene sequences were different between genera, but conserved between species of the same genus (Fig. 5A through F). And genes of Halorubrum sp. HRM-150 had a high similarity with Halorubrum ezzemoulense.

Fig 4.

The de-novo bacterioruberin synthesis pathway and transcriptional expression of related genes in different growth phases. (A) Bacterioruberin synthesis pathway in Halorubrum sp. HRM-150. Red: genes found in the genome, Gray: genes not found; Acetyl-CoA: Acetyl coenzyme A, Acetoacetyl-CoA: Acetoacetyl coenzyme A, HMG-CoA: Hydroxy methylglutaryl coenzyme A, Mev-5P: Mevalonate-5-phosphate, Mev-5PP: Mevalonate-5-diphosphate, Iso-P: Isopentenyl phosphate IPP: Isopentenyl pyrophosphate, DMAPP: Dimethylallyl diphosphate, GPP: Geranyl diphosphate, FPP: Farnesyl diphosphate, GGPP: Granylgeranyl diphosphate, DH-IDR: Dihydroisopentenyldehydrorhodopin, IDR: Isopentenyldehydrorhodopin, DH-BABR: Dihydrobisanhydrobacterioruberin, BABR: Bisanhydrobacterioruberin, TH-BABR: Tetrahydrobisanhydrobacterioruberin, MABR: Monoanhydrobacterioruberin, DH-MABR: Dihydromonoanhydrobacterioruberin, BR: Bacterioruberin, mvaE1: acetyl-CoA C-acetyltransferase, mvaS: hydroxymethylglutaryl-CoA synthase, mvaE2: hydroxymethylglutaryl-CoA reductase, mvaK1: mevalonate kinase, mvaK2: mevalonate phosphate kinase, mvd: diphosphomevalonate decarboxylase, mvaD: phosphomevalonate decarboxylase, ipk: isopentenyl phosphate kinase, idi: isopentenyl diphosphate isomerase, idsA/crtE: geranylgeranyl diphosphate synthase, crtB: 15-cis-phytoene synthase, crtI: phytoene desaturase, crtY: lycopene β-cyclase, brp/blh: β-carotene 15,15′-dioxygenase, lyeJ: lycopene elongase, crtD: 1-hydroxy-2-isopentenylcarotenoid 3,4-desaturase, and cruF: bisanhydrobacterioruberin hydratase. (B) The expression of genes related to bacterioruberin synthesis by transcriptome sequencing and qRT-PCR. The values in the heat map are the normalized FPKM values. (C) GO cluster of differentially expressed genes (96 h vs 48 h). The number of differently expressed genes was marked at the end of the column.

Fig 5.

The phylogenetic tree of genes related to bacterioruberin synthesis pathway using the maximum likelihood method. (A) Phylogenetic tree of mvaD. (B) Phylogenetic tree of ipk. (C) Phylogenetic tree of crtB. (D) Phylogenetic tree of lyeJ. (E) Phylogenetic tree of crtI/crtD. (F) Phylogenetic tree of cruF.

Transcriptome analysis

The transcriptome of cells at different growth phases was sequenced, and the expression of 18 genes (Table 1) related to the BR synthesis was analyzed (Fig. 4B). The accuracy of transcriptome analysis was verified by the expression trend of six genes obtained using qRT-PCR, including mvaS, mvaD, crtD3, lyeJ, cruF, and brp. According to the transcriptome analysis, the expression of eight genes in the BR synthesis pathway was significantly higher at the early growth phase (24 and 48 h) than at the late growth phase (96 and 192 h) (P < 0.05), including mvaS, mvaE2, mvaD, ipk, idsA1/crtE, idsA2/crtE, lyeJ, and cruF. Besides, the genes related to the competitive pathway, including crtY, brp, and blh, were all downregulated at the early growth stage. Moreover, the GO enrichment analysis of differentially expressed genes showed that most genes related to cell composition were significantly downregulated in 96 h compared to 48 h (P < 0.05, Fig. 4C).

TABLE 1.

Genes related to bacterioruberin synthesis

Gene	Gene ID	Enzyme	EC number
mvaE1	GM000504	Acetyl-CoA C-acetyltransferase	2.3.1.9
mvaS	GM001716	Hydroxymethylglutaryl-CoA synthase	2.3.3.10
mvaE2	GM002287	Hydroxymethylglutaryl-CoA reductase	1.1.1.34
mvaK1	GM002180	Mevalonate kinase	2.7.1.36
mvaD	GM002625	Phosphomevalonate decarboxylase	4.1.1.99
ipk	GM002181	Isopentenyl phosphate kinase	2.7.4.26
idi	GM000030	Isopentenyl-diphosphate Delta-isomerase	5.3.3.2
idsA/crtE	GM000780	Geranylgeranyl diphosphate synthase	2.5.1.1/2.5.1.10/2.5.1.29
idsA/crtE	GM001903	Geranylgeranyl diphosphate synthase	2.5.1.1/2.5.1.10/2.5.1.29
crtB	GM001583	15-cis-phytoene synthase	2.5.1.32
crtD1/crtI	GM000359	Phytoene desaturase	1.3.99.31
crtD2/crtI	GM000563	Phytoene desaturase	1.3.99.31
lyeJ	GM002304	Lycopene elongase	2.5.1.150
crtD3	GM002305	1-Hydroxy-2-isopentenylcarotenoid 3,4-desaturase	1.3.99.37
cruF	GM002303	Bisanhydrobacterioruberin hydratase	4.2.1.161
brp	GM000527	Probable beta-carotene 15,15′-dioxygenase	1.13.11.63
crtY	GM001331	Lycopene beta-cyclase	5.5.1.19
blh	GM001330	Beta-carotene 15,15′-dioxygenase	1.13.11.63

Osmotic down shock

The osmotic down shock with low salinity was conducted to induce cells synthesizing BR. The findings showed that the BR content per cell only experienced a slight change when the salinity decreased from 20% to 17%. However, the BR content per cell was significantly higher at 24 h after osmotic shock with 14% salinity (P < 0.05), and reached the peak (4.83 × 10⁻¹⁰ µg/cell) at 48 h with an increase of 48% compared with that of 20% salinity (Fig. 6A). Furthermore, the expression of lyeJ, cruF, and crtB was detected. After osmotic shock at 14% salinity, the expression trend of lyeJ was in accordance with the BR synthesis, first increasing dramatically, and remaining higher than that at 20% salinity until 24 h, subsequently decreasing at 48 h (Fig. 6B). In contrast, the expression of cruF only transiently increased at the beginning of osmotic shock (at 6 h, Fig. 6C), and crtB even decreased at 14% salinity (Fig. 6D).

Fig 6.

The bacterioruberin content and gene expression of Halorubrum sp. HRM-150 after osmotic down shock. (A) Bacterioruberin content per cell. (B) The expression of lyeJ. (C) The expression of cruF. (D) The expression of crtB. ns: P > 0.05, *: P < 0.05, **: P < 0.01, ***: P < 0.001.

DISCUSSION

Metabolic network analysis

As known, the archaea is distinguished from bacteria and eukarya as a unique domain in taxonomy (20). The research on archaeal metabolism plays an important role in deciphering biological evolution. In this study, the metabolic network of a halophilic archaeon Halorubrum sp. HRM-150 was constructed based on the results of genome annotation and carbon/nitrogen source preference, including transport system, carbon metabolism, nitrogen metabolism, and amino acid metabolism.

Carbon source transport system

As known, the skeleton of BR consists of carbon elements, which are mainly provided by the carbon source. The annotation suggested that Halorubrum sp. HRM-150 primarily transported monosaccharides by the ATP-binding cassette (ABC) transporters in the absence of the phosphotransferase system (PTS). The ABC transporters have high substrate affinity, even at a low concentration of carbon sources, supporting the halophilic archaea survive in the oligotrophic environment (21, 22). Additionally, two types of ABC transporters were found in the genome, glucose/mannose ABC transporter (GtsABC) and galacto-oligosaccharide/malto-oligosaccharide ABC transporter (GanOPQ) (Fig. 2). It has been demonstrated that the GtsABC transfers the glucose from the medium into the cell (23), which indicates that Halorubrum sp. HRM-150 could directly use glucose. Another transporter GanOPQ can only transfer the galactose (24), thereby the lactose should be degraded to galactose before transporting it into Halorubrum cell. However, neither PTS (25) nor ABC transporter for fructose was found in the genome, resulting in difficulty of fructose utilization.

Carbon source utilization

The strain could utilize a variety of carbon sources based on the findings. However, various carbon sources have different effects on the cell growth and BR accumulation. As the highest OD₆₀₀ value, BR productivity and BR content per cell were achieved with supplementation of glycerol, glucose, and starch, respectively (Fig. 3A, C and D), the utilization of these carbon sources is analyzed in the following two paragraphs.

Glycerol utilization

Glycerol is the most abundant carbon source in the hypersaline environment in particular with the presence of halophilic microalgae Dunaliella salina, which usually enters the cell through diffusion (26). Results showed that the maximum OD₆₀₀ value was achieved using glycerol as a carbon source (Fig. 3A). And two genes relevant to glycerol utilization were discovered in the genome, glpK and glpABC. It has been reported that the glpK gene encodes glycerol kinase converting glycerol to glycerol-3-phosphate, while the glpABC gene encodes glycerol-3-phosphate dehydrogenase catalyzing the reaction from glycerol-3-phosphate to dihydroxyacetone phosphate (DHAP). Furthermore, DHAP involves the central carbon metabolism (27), allowing the strain to grow better with glycerol than other carbon sources. However, glycerol resulted in lower BR content per cell when compared with most carbon sources in this study (Fig. 3D). To figure out the reason, the metabolic network was further analyzed, and the synthesis of phospholipid was found to compete with BR. The above two pathways shared a substrate of isoprene, thereby the flow of isoprene plays an important role in BR synthesis. It is well known that the archaeal phospholipid is different from bacteria and eukaryotes, which are usually called tetraether lipids (28). In the reported synthesis process, isoprene instead of fatty acid is linked to glycerol by ether bonds, followed by multiple reactions including condensation, phosphorylation, the addition of polar heads, and desaturation (29, 30). The lower BR content obtained in this study revealed that the glycerol facilitated the isoprene flux to the synthesis of ether lipids.

Glucose and starch utilization

Glucose is a common carbon source supporting the growth of most heterotrophic microorganisms. Our study showed the Halorubrum strain could utilize the glucose for growth and BR production, even resulting in the highest BR productivity among nine carbon sources (Fig. 3A, C and D). This indicated glucose was an ideal carbon source for BR production, which was in accordance with the previous studies in Haloferax mediterranei (15), Haloarcula sp. M1 and Halorubrum sp. M5 (16). This strain also could utilize starch for growth and BR accumulation, but it grew slowly before 48 h (Fig. 3A). It is possible that the starch was utilized after amylase-catalyzed decomposition. Actually, three genes encoding α-amylase were found in the genome of this strain. The decomposition catalyzed by α-amylase can be divided into two stages, converting starch to oligosaccharide, followed by hydrolyzing oligosaccharide to glucose (31). As such, the decomposition of starch delayed the cell growth at the early stage. Subsequently, the products decomposed by starch supported exponential cell growth from 48 to 84 h, and reached the peak at 84 h. Moreover, the BR content per cell was the highest using starch as a carbon source (Fig. 3D). Since glucose and lactose have been shown to enable diauxic growth in E. coli (32), it is speculated that glucose and starch together will also cause diauxic growth of Halorubrum sp. HRM-150 as well as the increase of BR production. Further experiments confirmed that the biomass and BR productivity were admittedly improved by the combination of glucose and starch (Fig. 3E and F). Additionally, the diauxic growth was found in the ratio of 1:2 and 1:1 (glucose:starch, g/g), except for the ratio of 2:1, indicating that the increase of glucose provides enough carbon source for the cell growth during the decomposition of starch.

Central carbon metabolism

The central carbon metabolism has been known to be essential for microorganisms, which provide energy and intermediate products (33). The completed tricarboxylic acid cycle (TCA) was present in Halorubrum sp. HRM-150 (Fig. 2). However, fructose 6-monophosphate kinase was not detected in the genome, indicating that the strain lacks the classical Embden-Meyerhoff pathway (EMP) (34). Instead, the genome contained genes relating to semi-phosphorylated Entner-Doudoroff (spED) pathway, such as genes encoding glucose dehydrogenase (GDH), gluconate dehydratase (GAD), and 2-keto-3-deoxy-6-phosphogluconate aldolase (KDPGA) (35). Therefore, Halorubrum should degrade glucose by spED pathway, which also occurs in other archaea species, for example, Natronomonas pharaonis (36).

Nitrogen source utilization

This study found that the strain cultured by organic nitrogen compounds (casein acid hydrolysate and tryptone) had higher cell mass than inorganic matters (Fig. 3B). The organic nitrogen compounds are rich in proteins. And an extracellular serine protease was found in gene annotation, which was reported to degrade proteins into oligopeptides and amino acids (37). The degradation products were thereafter delivered into the cell via the oligopeptide transporter OPT and the branched-chain amino acid ABC transporter Liv (Fig. 2), and supported the cell growth. Although the tryptone resulted in a lower cell mass than casein acid hydrolysate, it had a higher BR productivity (Fig. 3C and D), indicating that tryptone is a suitable nitrogen source for producing BR. As reported, the inorganic nitrogen compounds are mostly utilized through the nitrification and denitrification pathways (38). Nevertheless, the above two pathways were not detected in the genome, resulting in weak utilization of inorganic resources. Moreover, results displayed that the strain was unable to survive when using sodium nitrite as a nitrogen source in the absence of nitrite transporter, which has been reported to transport nitrite into cells (39). Unexpectedly, cells cultured by NH₄Cl have higher BR content, but the mechanism for this remains unclear.

Amino acid metabolism

Protein consists of amino acids, which are crucial substances for its structure and function. The synthesis pathways of 20 amino acids were predicted through genome annotation, including aspartic acid, asparagine, lysine, methionine, threonine, glutamic acid, glutamine, proline, arginine, valine, alanine, leucine, isoleucine, serine, glycine, cysteine, phenylalanine, tyrosine, tryptophan, and histidine (Fig. 2). The synthesis pathways of most amino acids were similar to those other microorganisms (40), with only a few exceptions. For example, there were two possible pathways for serine synthesis in Halorubrum, using pyruvate and 3-phosphoglycerate as substrates, respectively. Additionally, 3-dehyroquinate has been considered as the precursor for aromatic amino acid synthesis, such as phenylalanine, tyrosine and tryptophan. However, the shikimate pathway (SP), the classical synthesis pathway of 3-dehyroquinate, was absent in this strain. Instead, the genome contained the genes related to the reported 3-dehyroquinate by 6-deoxy-5-ketofructose-1-phosphate (DFKP) pathway, an alternative pathway for 3-dehyroquinate synthesis (40), including methylglyoxal synthase gene (mgsA) missing in N. pharaonis. In addition, histidine synthesis began with 5-phosphoribosyl-1-pyrophosphate (PRPP), which was also a precursor for nucleotide synthesis (Fig. 2).

Bacterioruberin synthesis mechanism

The strain has de-novo synthesis pathway of BR, but lacks the genes mvaK2 and mvd reported in the classical MVA pathway, catalyzing the reaction from mevalonate-5-phosphate (Mev-5P) to IPP. Instead, two genes (mvaD and ipk) were found, which have been involved in the alternative MVA pathway (29). Except for the synthesis process from lycopene to BR reported by Yang et al. (17), a new branch pathway in BR synthesis was first proposed based on the function of CruF and CrtD in this study. The cruF has been reported to be a carotenoid 1,2-hydratase that catalyzes the hydration of the C-2,3 and C-2′,3' double bonds, and crtD has been suggested to be a carotenoid 3,4 desaturase involved in the desaturation reaction in the C-3,4 and the C-3′,4' forming double bonds in the desaturation reaction. Therefore, the two enzymes could catalyze the reaction from DH-BABR to MABR. Furthermore, most genes were highly conserved between species of the same genus according to the results of the phylogenetic tree, suggesting the BR synthesis pathway was also applicable to other species of Halorubrum. Meanwhile, although some genes have different sequences, they were annotated to the same enzyme, for example, three genes were annotated as CrtD/CrtI in the genome (Fig. 5E). It is possible that the enzyme has multiple functions, but it is difficult to pinpoint its location in the pathway. The query is also mentioned by Giani et al. (18), and need more research on archaea to demystify.

The mechanism of BR synthesis was further revealed by comparative transcriptome analysis of cells at different growth phases. Results showed that most genes in the BR synthesis pathway were upregulated at the early stage, especially lyeJ and cruF. The LyeJ was reported to initiate the first reaction from lycopene to BR, while the CruF was involved in the last reaction (17). In addition, the expression of genes related to the competitive pathways showed an opposite trend. It could be speculated that the synthesis of BR is more active at the early growth stage. Yet the gene crtB encoding phytoene synthase, the known rate-limiting enzyme of lycopene synthesis (41), was downregulated at the early stage, which indicated that it perhaps not be the key gene for BR synthesis. The results of osmotic shock with low salinity confirmed the inference. The osmotic shock with 14% salinity induced the cell synthesized more BR than 20% salinity, but the expression of crtB decreased at 14% salinity. Instead, the expression trend of lyeJ was in accordance with the BR synthesis, indicating lyeJ was the key gene of BR synthesis. It was noteworthy that the osmotic shock at 14% salinity at the stationary phase (96 h) did not increase the BR content (data were not shown), indicating that the manipulation timing is crucial.

The findings showed that the BR synthesis was active at the logarithm phase, which was different from other carotenoids. For example, astaxanthin cannot be synthesized at the early growth stage, but accumulates in the cell at the stationary phase (42). Additionally, the GO enrichment analysis showed that most genes related to cell composition upregulated at the logarithm phase. It is hypothesized that BR synthesis and cell composition synthesis have a positive correlation. As BR is an important regulator of cell membranes, it enhances the rigidity of the membranes and reduces the fluidity of the membrane, especially under the pressure (43). Our results showed that BR production increased by osmotic down shock, which confirmed that BR production was related to the cell membrane.

Based on the BR synthesis characteristics and the omics data, the synthesis pattern of BR was first proposed in this study (Fig. 7). As the component of cell membranes, the synthesis of BR is highly coupled with the cell growth, and the BR synthesis was active at the logarithm phase. In this phase, the rapid cell fission resulted in increasing cell number. As the archaeal cell control the size by the adder model (44), resulting in the cell volume approximately half of that before fission. This could explain why the BR content per cell was only half of the stationary phase. Furthermore, the BR productivity depends on content per cell and cell number. As the cell numbers increased exponentially, the BR productivity rose accordingly at the logarithm phase. In addition, the BR content per cell and productivity reached a peak at the stationary phase because of the maximum cell volume and number (Fig. 1B and C), but the synthesis rate of BR was lower than those logarithm phase.

Fig 7.

Schematic diagram of bacterioruberin synthesis pattern in Halorubrum. At the lag phase, the cell size and the bacterioruberin content per cell are normal, but the number of cells is relatively small due to the low proliferation rate, thereby the bacterioruberin productivity is low. At the logarithm phase, the cell size and the bacterioruberin content per cell are half of that before fission, while the number of cells exponentially increases, allowing the increase of bacterioruberin productivity. At the stationary phase, the cell size and the bacterioruberin content per cell return to normal, and the number of cells is maximumized, thereby the bacterioruberin productivity reaches its peak.

Strategies for increasing bacterioruberin production

The large-scale production of BR is the prerequisite for application, and the increase in production is the keystone of industrialization. Several strategies to enhance the BR production are proposed according to the results and knowledge obtained in this study. First, the combination of various carbon sources (e.g., glucose and starch) achieves the diauxic growth of haloarchaea to increase the cell mass, resulting in enhancing BR production. Additionally, appropriate stimulation (e.g., osmotic shock) at the logarithm phase facilitates the synthesis of BR. The clarification of synthesis mechanism of BR also enables the genetic engineering manipulation, including the overexpression of key gene lyeJ and knockout of key genes in the competitive pathways (e.g., crtY, brp, and blh). However, universal genetic manipulation tool is lackng in haloarchaea due to its special evolutionary status and characteristics (45). Although the finding of native CRISPR makes it possible to edit genes in some haloarchaea, such as Haloferax and Haloarcula (46), the gene editing is still difficult in haloarchaea without native CRISPR system, such as Halorubrum. In addition, Halorubrum was known as polyploidy (47), which increases the difficulty of genetic manipulation and needs further exploration.

Conclusion

This study elucidated the BR synthesis mechanism and proposed strategies for increasing BR yield in halophilic archaea. Glucose and tryptone were better substrates for BR production, and the combination of glucose and starch would achieve diauxic growth. Additionally, this work first proposed that the synthesis of BR followed the growth-coupling pattern, which was active at the logarithmic phase. Furthermore, the genome and transcriptome analysis and osmotic shock revealed that Halorubrum sp. HRM-150 had the de-novo synthesis pathway of BR containing a key gene lyeJ. Finally, the yield of BR would be improved by the combination of various carbon sources and environmental stimulation at the logarithm phase.

MATERIALS AND METHODS

Growth and bacterioruberin production

The strain Halorubrum sp. HRM-150 (CGMCC 17350) was inoculated at a 5% (vol:vol) ratio in a 500 mL flask with 200 mL modified marine broth medium containing 28.6 g/L MgCl₂, 19 g/L MgSO₄, 1 g/L CaCl₂, 6 g/L KCl, 0.2 g/L NaHCO₃, 0.7 g/L NaBr, 166 g/L NaCl, 10 g/L yeast extract, and 15 g/L casein acid hydrolysate with an initial pH 7.2–7.4 (48). The flasks were incubated at 37℃ and 150 rpm. The growth curve was generated based on the value of OD₆₀₀ monitored every 12 h. The cells were collected at 24, 48, 72, 96, 120, 144, 168, and 192 h, respectively, by 10 min centrifugation. Also the pigment was extracted following the procedure proposed in the previous work (11). The OD₄₉₄ was detected by spectrophotometer (UV3100, Mapada, China), and the BR concentration in methanol was calculated by the formula (equation 1) (10), which was then converted to the BR productivity (μg/mL broth) or the BR content per cell (μg/cell).

$${\displaystyle \mathrm{C}(\mu \mathrm{g}/\mathrm{m}\mathrm{L})=\frac{\mathrm{O}{\mathrm{D}}_{494}\times \mathrm{D}\times {10}^4}{{\mathrm{E}}_{1\mathrm{c}\mathrm{m}}^{1\mathrm{\%}}}}$$ (1)

D: dilution ratio; ${\displaystyle {\mathrm{E}}_{1\mathrm{c}\mathrm{m}}^{1\mathrm{\%}}}$: 2,660, the absorption coefficient of archaeal carotenoids in methanol.

Genome sequencing

The cells were collected at the logarithm phase (60 h of culture) by centrifugation at 10,000 × g for 5 min. The cell pellet was rinsed using phosphate-buffered saline (PBS), then the genome DNA was extracted by TIANamp Bacteria DNA Kit (Tiangen, Beijing, China). The whole genome of Halorubrum sp. HRM-150 was sequenced using PacBio Sequel platform and Illumina NovaSeq PE150 at the Beijing Novogene Bioinformatics Technology Co., Ltd, followed by assembly using the SMRT Link software. The RepeatMasker (Version open-4.0.5) and CRISPR digger (Version 1.0) were used to detect the repeat sequences and clustered regularly interspaced short palindromic repeat sequences (CRISPR). The gene functions were then predicted by seven databases, including Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), Clusters of Orthologous Groups (COG), Non-Redundant Protein Database (NR), Transporter Classification Database (TCDB), and Swiss-Prot. The sequences of genes related to BR synthesis were aligned in NCBI, and the phylogenetic tree was constructed by the neighbor-joining method using MAGE11 software.

Carbon and nitrogen source preference

Nine carbon sources (glucose, glycerol, lactose, sucrose, fructose, maltose, starch, sodium acetate, and methyl cellulose) and five nitrogen sources (casein acid hydrolysate, tryptone, NH₄Cl, NaNO₃, and NaNO₂) were chosen to culture Halorubrum sp. HRM-150 for the analysis of substrate preference. The information on the nitrogen sources and carbon sources were listed in Table S5. The cells were cultured in 100 mL marine broth medium in which 10 g/L yeast extract was replaced by an equal concentration (10 g/L) of carbon sources. Meanwhile, the nitrogen source preference was detected using glucose instead of yeast extract as a carbon source, and a low-concentration yeast extract (0.5 g/L) was added to NH₄Cl, NaNO₃, and NaNO₂ group to provide vitamins and trace elements. The cells were further cultured using the combination of glucose and starch with a total concentration of 10 g/L, setting the ratio of 1:1, 1:2, and 2:1 (glucose:starch, g/g). The culture was conducted at 37°C and 150 rpm. The OD₆₀₀ was monitored every 12 h, while the BR productivity and BR content per cell were measured at the stationary phase.

Transcriptome sequencing

The cells were collected at 24, 48, 96, and 192 h, respectively. The total RNA was extracted by RNAprep Pure Cell/Bacteria Kit (Tiangen, Beijing, China). The quality of RNA extraction was monitored on 1% agarose gel, and total amounts and integrity of RNA were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The mRNA was purified using probes to remove rRNA prior to cDNA synthesis. After sequencing by the Illumina NovaSeq 6000, the sequences of cDNA were aligned with the reference genome acquired in section Genome sequencing. Differentially expressed gene analysis of pairwise comparison was performed using the DESeq2 R package (1.20.0).

Osmotic down shock

Halorubrum sp. HRM-150 was cultured in 110 mL marine broth medium at salinity 20% for 48 h, which were then subjected to the salinity shock. The salinity of culture medium was adjusted to 14% by adding 90 mL fresh medium without NaCl, 17% by adding 90 mL fresh medium with 10.8 g NaCl, and 20% by adding 90 mL fresh medium. The initial salinity of medium was measured by the salinity meter (Master-S/Millm, Atago, Japan). The subsequent cultures were conducted in a 500-mL flask containing 200 mL above media, at 37°C and 150 rpm. Subsequently, the cells were collected at 6, 12, 24, 48, and 72 h, respectively, to determine the OD₆₀₀ , BR productivity, and BR content per cell.

Quantitative real-time PCR

Total RNA of the samples collected in transcriptome and osmotic down shock experiments were extracted with the Total RNA Extraction Kit (TAKARA, Beijing, China), which were then reverse-transcribed to cDNA using the PrimeScript RT reagent Kit (TAKARA, Beijing, China). The glnA was chosen as a reference gene, and the primers were synthesized by the Beijing Genomics Institute (Table 2). The total volume of qRT-PCR reaction was 20 µL, containing 6.4 µL enzyme-free water, 10 µL TB Green Premix ExTap TMII, 2 µL cDNA, 0.8 µL forward primer, and 0.8 µL reverse primer. The procedure was conducted as follows: pre-denaturing at 95°C for 2 min, 40 cycles of denaturing at 95°C for 5 s, annealing at Tm for 30 s and elongating at 72°C for 20 s, finally heating from 65°C to 95°C at a rate of 0.5°C/s to generate the melting curve. The relative expression of the target gene was calculated according to 2^−∆∆Ct, and the significance analysis was performed by SPSS software.

TABLE 2.

Primers for quantitative real-time PCR

Primer	Sequence (5′−3′）	Tm (°C)
glnA-F	ATGACGGACGAACACGC	53
glnA-R	CTGAAGCCGCAGGAAAT	53
5SrRNA-F	CCCGTACCCATTCCGAACAC	53
5SrRNA-R	CCAGAGGATCGCTCACTCCA	53
mavD-F	CGGTGTCGGTCGAGAAGTAG	53
mavD-R	CCAGCTAGTCGAGATGACCG	53
mvaS-F	TGACTTCCTCAAGCCGAACC	52
mvaS-R	GTCTTCCAGCTCGATGTCGT	52
crtD3-F	CAGGCAGCTGTTGGAGTACA	60.5
crtD3-R	CGATCACCTCGTACATCCCG	60.5
brp-F	CAGATGATCGCGTACCTCGT	59.5
brp-R	GGCGGAGATTCGAGAAGTGT	59.5
lyeJ-F	ACCCCGAAGCAGTAGG	52
lyeJ-R	CGTGGCTCTGGACGAT	52
crtB-F	GACCACCACCGCCTCATC	54
crtB-R	GGTTCCACTGCCACTTCC	54
cruF-F	GTACCTCATCGAGTCGGTCG	54
cruF-R	AGCAGGTAGGCGTTCATCAC	54

Statistical analysis

All experiments were performed in triplicate. The data are presented as mean ± SD. Statistical significance was determined using one-way ANOVA, followed by Tukey multiple range tests as P < 0.05 (25.0, IBM SPSS Statistics, IBM Corp., USA).

DATA AVAILABILITY

The whole-genome sequence of Halorubrum sp. HRM-150 has been uploaded to the NCBI with accession number SAMN36631273. Illumina sequencing metadata have been uploaded to the GenBank SRA database with accession number SRR28267438.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.00540-24.

Supplemental material. aem.00540-24-s0001.pdf.

Figure S1; Tables S1 to S5.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.