ROK family regulator NagC promotes prodigiosin biosynthesis independent of N-acetylglucosamine in Serratia sp. ATCC 39006

ABSTRACT

Serratia sp. ATCC 39006 is an important model strain for the study of prodigiosin production, whose prodigiosin biosynthesis genes (pigA-O) are arranged in an operon. Several transcription factors have been shown to control the transcription of the pig operon. However, since the regulation of prodigiosin biosynthesis is complex, the regulatory mechanism for this process has not been well established. In most γ-proteobacteria, the ROK family regulator NagC acts as a global transcription factor in response to N-acetylglucosamine (GlcNAc). In Serratia sp. ATCC 39006, NagC represses the transcription of two divergent operons, nagE and nagBAC, which encode proteins involved in the transport and metabolism of GlcNAc. Moreover, NagC directly binds to a 21-nt region that partially overlaps the −10 and −35 regions of the pig promoter and promotes the transcription of prodigiosin biosynthesis genes, thereby increasing prodigiosin production. Although NagC still acts as both repressor and activator in Serratia sp. ATCC 39006, its transcriptional regulatory activity is independent of GlcNAc. NagC was first found to regulate antibiotic biosynthesis in Gram-negative bacteria, and NagC-mediated regulation is not responsive to GlcNAc, which contributes to future studies on the regulation of secondary metabolism by NagC in other bacteria.

IMPORTANCE

The ROK family transcription factor NagC is an important global regulator in the γ-proteobacteria. A large number of genes involved in the transport and metabolism of sugars, as well as those associated with biofilm formation and pathogenicity, are regulated by NagC. In all of these regulations, the transcriptional regulatory activity of NagC responds to the supply of GlcNAc in the environment. Here, we found for the first time that NagC can regulate antibiotic biosynthesis, whose transcriptional regulatory activity is independent of GlcNAc. This suggests that NagC may respond to more signals and regulate more physiological processes in Gram-negative bacteria.

INTRODUCTION

Prodigiosin, a tripyrrole red pigment, is a promising microbial secondary metabolite with multiple biological activities, including anticancer, antiparasitic, immunosuppressive, and antimicrobial activities (1, 2). Prodigiosin and its derivatives can be produced by a wide variety of microorganisms. Serratia sp. ATCC 39006, reclassified as Prodigiosinella confusarubida ATCC 39006 (3), is a model strain for studying prodigiosin biosynthesis. In Serratia sp. ATCC 39006, the prodigiosin biosynthesis genes are arranged in an operon containing 15 open reading frames (ORF), the so-called pig operon (4–7). As all pig genes are polycistronic in transcription, prodigiosin synthesis can be controlled by regulating the transcription of the pig operon (5–7). With a promoter region of 922 bp, the transcription of the pig operon in Serratia sp. ATCC 39006 can be easily regulated by a wide range of transcription factors (5, 6). It has been found that several transcription factors, responding to different signals, are involved in the direct regulation of transcription of the prodigiosin biosynthesis operon (8–11). OhrR, a transcriptional repressor belonging to the MarR family, binds 319 to 286 nucleotides (nt) upstream of the transcription start site (TSS) of the pig operon to repress its transcription (10). Organic hydroperoxide increases prodigiosin yield by preventing OhrR from binding to its operator (10). PigT, a GntR family transcription factor, promotes transcription of the pig operon by binding 86 to 78 nt upstream of its TSS (9). Addition of gluconate to the medium suppresses the transcriptional activation of the prodigiosin biosynthetic cluster by PigT, thereby negatively regulating prodigiosin production (9). Fumarate and nitrate reduction regulatory protein (Fnr), a Crp/Fnr family transcription factor, binds to the spacer in the promoter of the pig operon between the −10 and −35 regions under aerobic conditions to negatively regulate prodigiosin production when the bacteria are cultured in LB supplemented with 2% glucose (11). The Rap protein, a SlyA/MarR family transcription factor, promotes prodigiosin production by binding to the ROP region spanning −320 to −120 nt relative to the TSS of the pig operon (8, 12). In conclusion, various transcription factors bind to distinct regions of the pig promoter to control the prodigiosin synthesis.

NagC is an important transcription factor in γ-proteobacteria, which belongs to the repressor subgroup of the so-called ROK (repressors ORFs and kinases) family of proteins (13, 14). NagC is a dual-function transcriptional regulator that can act as either a repressor or an activator, whose transcriptional regulatory activity is mainly in response to environmental GlcNAc (15, 16). In Escherichia coli, NagC represses the expression of the nag regulon, including nagE and the nagBACD operon, which encode proteins involved in the transport and metabolism of GlcNAc (17, 18). In the absence of GlcNAc, NagC binds to the bidirectional promoter region of the nag regulon and represses the divergently transcribed nagE and the nagBACD operon, resulting in bacteria unable to utilize GlcNAc (19–21). In the presence of GlcNAc, GlcNAc enters the cell and is converted to GlcNAc-6-P, which binds to NagC (20, 21). NagC then dissociates from its target sites, and transcriptional repression of the nag regulon is released, allowing bacteria to use GlcNAc as a carbon source (20, 21). In addition, NagC is an important global transcription factor that controls multiple physiological processes by directly regulating the transcription of related genes (22–27), including cell wall biosynthesis (22), pathogenicity (23), biofilm formation (24, 26), and chitobiose biosynthesis (25). However, NagC has not yet been reported to regulate the secondary metabolism.

In the present study, we show that NagC directly binds to a 21-nt region that partially overlaps the −10 and −35 regions of the pig promoter and promotes the transcription of prodigiosin biosynthesis genes, thereby increasing the prodigiosin production of Serratia sp. ATCC 39006. Further investigation reveals that Serratia sp. ATCC 39006 NagC can not only act as an activator to promote the transcription of the pig operon but also act as a repressor to inhibit the transcription of the nag regulon. However, the transcriptional regulatory activity of NagC is independent of GlcNAc in Serratia sp. ATCC 39006.

RESULTS

Identification of the nag regulon in Serratia sp. ATCC 39006

To search for the transcription factors that bind to the promoter region of the pig operon, the transposon mutagenesis assay was performed as shown in previous studies (11). First, the pigA gene was deleted to obtain a strain that did not produce prodigiosin, thus eliminating the effect of red prodigiosin on colony color. Second, pBBR1MCS5-P_pig-lacZ, a plasmid on which the lacZ gene is driven by the pig promoter, was transferred into ΔpigA. In this strain, the lacZ transcription was regulated by transcription factors that regulate the pig promoter. Finally, the plasmid with mini-Tn5 was transferred into ΔpigA/pBBR1MCS5-P_pig-lacZ. Transformants were screened on X-gal-containing plates to perform blue-white screening assay, and a colony that was whiter than its parent strain was selected for sequencing (Fig. 1A). The transposon was inserted into the open reading frame of Ser39006_018250 (protein_id="AUH05901.1"), which is annotated to encode a transcription factor of the ROK family. Amino acid alignment showed that the identity of Ser39006_018250 to Escherichia coli K-12 NagC (protein_id="NP_415202.1") is 73.71% (Fig. 1B); thus, Ser39006_018250 was identified as nagC. The genomic arrangement of the nag regulon in Serratia sp. ATCC 39006 is similar to that of E. coli, which consists of two divergent operons, nagE and nagBAC (Fig. 1C) (17, 18). nagC is arranged in the same direction with two upstream genes, nagB (Ser39006_018240, protein_id="AUH05899.1,” encoding a GlcN-6-P deaminase), and nagA (Ser39006_018245, protein_id="AUH05900.1,” encoding a GlcNAc-6-P deacetylase). The length of the intergenic regions of nagB-nagA and nagA-nagC is 22 bp and 8 bp, respectively, and reverse transcription PCR (RT-PCR) results indicate that these three genes are co-transcribed (Fig. 1D; Fig. S1). nagE (Ser39006_018235, protein_id="AUH05898.1,” encoding a PTS GlcNAc transporter subunit IIBC) is located 433 bp upstream of nagB and transcribed in divergent direction.

Fig 1.

Identification of the nag regulon. (A) Comparison of the parent strain and the transposon-inserted mutant by blue and white screening assay. (B) Sequence alignment of Serratia sp. ATCC 39006 NagC (SNagC, protein_id="AUH05901.1") and E. coli K-12 NagC (ENagC, protein_id="NP_415202.1"). Amino acids involved in the binding GlcNAc-6-P are indicated in bold red. Predicted secondary structures and their regions are indicated below the sequences. (C) Gene arrangement of nagE and the nagBAC operon. The suffix ID of each gene and its protein ID are given above the schematic diagram. The length of the intergenic region is indicated above the schematic diagram in red letters. The primers used in (D) are indicated below the schematic diagram by blue arrows and blue letters. The expected size of the amplicons produced by these primers is indicated below the schematic diagram in violet letters. (D) PCR amplification of the nagB-nagA and nagA-nagC intergenic regions using genomic DNA, cDNA, and RNA as the templates.

NagC promotes prodigiosin production by directly regulating the transcription of pig operon in Serratia sp. ATCC 39006

Transposon mutagenesis experiments suggest that NagC not only regulates the pig promoter but also regulates prodigiosin production. To confirm this result, we constructed nagC in-frame deleted mutant strain ΔnagC and compared the growth rate of WT and ΔnagC. The growth rates of the two strains showed no significant differences (Fig. 2A), indicating that the deletion of nagC does not affect cell growth. Then, we constructed the nagC complemented strain CnagC and the overexpression strain OnagC to compare the prodigiosin production of these four strains. The shake flask fermentation experiment showed that the prodigiosin production of ΔnagC was significantly lower than that of WT (Fig. 2B). Since nagC in CnagC was driven by a constitutive promoter, P_aacC1, the prodigiosin yield of CnagC was significantly higher than that of WT (Fig. 2B). Although the prodigiosin yield of the overexpression strain OnagC was slightly higher than that of CnagC, it was significantly higher than that of WT (Fig. 2B). These results indicate that NagC promotes the prodigiosin production in Serratia sp. ATCC 39006.

Fig 2.

NagC promotes prodigiosin production through direct regulation of pig operon transcription. (A) The growth rate of WT and ΔnagC. (B) Prodigiosin yield of WT, ΔnagC, CnagC, and OnagC. (C) Transcription levels of 15 prodigiosin biosynthesis genes in the WT and ΔnagC. The relative transcription values of evaluated genes in the WT strain is set as 1. (D) Expression analysis of C-terminal 3 × FLAG-tagged PigA in WT/PigA-FLAG and ΔnagC/PigA-FLAG strains. (E) Electrophoretic mobility shift assay verification of NagC binding to the P_pig probe (P208 fragment) that contains the promoter region of the pig operon. Labeled probe (0.2 nM) was added to each reaction mixture, and the concentration of NagC in each reaction mixture is shown above the figure. Lane S: 100-fold unlabeled specific competitive probe. Lane N: 100-fold unlabeled non-specific competitive probe. Arrow indicates free probes, and bracket indicates the protein-DNA complexes. (F) Prodigiosin yield of WT and WT/FLAG-NagC. (G) In vivo ChIP-qPCR analysis of FLAG-NagC binding to the promoter of the pig operon. An anti-FLAG affinity gel was used to precipitate the protein-DNA complex, and WT was used as a negative control. The Y-axis indicates the relative enrichment value of NagC at its target site, which was calculated by comparing the Ct value of the sample and the input. The strains used in (A) to (D) and (F) to (G) were all cultured in LB medium. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with Student’s t tests. NS: no statistical significance; *: P < 0.05; **: P < 0.01; ***: P < 0.001.

We next investigate whether NagC increases prodigiosin production by promoting the transcription of pigA-O genes. The qRT-PCR results showed that the transcription levels of 15 pig genes in ΔnagC were lower than those in the WT (Fig. 2C), indicating that NagC promotes the transcription of pig operon. To confirm these results, a chromosomal C-terminal 3× FLAG tag was attached to PigA in the WT and ΔnagC for western blotting assay, and the result showed that the intracellular PigA protein levels of ΔnagC were significantly decreased compared with WT (Fig. 2D; Fig. S2), which was largely consistent with the transcript levels. To investigate whether NagC directly promotes the transcription of pig operon, electrophoretic mobility shift assay (EMSA) was performed using His₆-tagged NagC protein (Fig. S3). The length of the pig promoter region is 922 bp, which was divided into four DNA fragments, including P208 (208 bp DNA fragment located between positions −112 and +96 relative to the TSS of the pig operon), P301 (301 bp DNA fragment located between positions −349 and −49 relative to the TSS of the pig operon), P297 (297 bp DNA fragment located between positions −549 and −298 relative to the TSS of the pig operon), and P319 (319 bp DNA fragment located between positions −881 and −563 relative to the TSS of the pig operon). NagC bound only the P208 fragment (P_pig), indicating that NagC specifically binds the promoter of the pig operon in vitro (Fig. 2E). To confirm this result, a chromosomal N-terminal 3× FLAG tag was attached to NagC in the WT to generate WT/FLAG-NagC for chromatin immunoprecipitation (ChIP)-quantitative PCR (qPCR) assay. The WT and WT/FLAG-NagC exhibited similar prodigiosin production (Fig. 2F), indicating that the function of NagC is not altered by the N-terminal 3× FLAG tag. The ChIP-qPCR result showed that the enrichment of the promoter of pig operon in WT/FLAG-NagC was significantly higher (about sevenfold) than that in the WT (Fig. 2G). Thus, NagC directly regulates the transcription of the pig operon.

To further analyze NagC binding sites in the promoter region of the pig operon, EMSAs were performed using His₆-tagged NagC and DNA probes of different lengths (P1–P3) (Fig. 3A). NagC bound to probe P2 (Fig. 3C), but no shifted bands were observed with probes P1 and P3 (Fig. 3B and D). The conservative binding sequence of E. coli NagC (SW4TTN9AAW4S, S: C/G; W: A/T; N: A/T/G/C) is found in the probe P2 (15), which is located from 12 ~ 34 nt upstream of the TSS (8, 11) of the pig operon (Fig. 3A and E). To investigate whether this sequence is the NagC binding site in the pig promoter, the sequence was mutated according to the principle that G intermutates with A (G←→A) and T intermutates with C (T←→C), which was labeled for EMSA (Fig. 3E, mutated sequence). The results showed that NagC did not bind to the mutated probe (P_pig-mut) (Fig. 3F), indicating that NagC promotes transcription of the pig operon by binding to a 21-nt region that partially overlaps the −10 and −35 regions. Thus, NagC promotes the transcription of the prodigiosin biosynthesis gene cluster by binding directly to the promoter of the pig operon. To investigate whether NagC only regulates the prodigiosin biosynthesis at the transcriptional level, the native pig promoter was replaced by a constitutive promoter, P_aacC1, and the pig-specific SD sequence and ATG were retained. The result showed that the pigA transcription of ΔnagC/P_aacC1-pig was similar to that of WT/P_aacC1-pig, indicating that the promoter replacement results in similar transcription of the pig operon in both bacteria (Fig. 3H). The similar intracellular PigA protein levels and the prodigiosin yield (Fig. 3G and I; Fig. S4) suggest that NagC only regulates the prodigiosin biosynthesis at the transcriptional level. Thus, NagC promotes prodigiosin biosynthesis by binding directly to the promoter of the pig operon.

Fig 3.

NagC binds the region from 12 ~ 34 nt upstream of the pig TSS. (A) Nucleotide sequences of the P_pig EMSA probe (P208 fragment). Blue letters (blue arrow): P1 probe; underlined letters (black arrow): P2 probe; red letters (red arrow): P3 probe; shaded areas: predicted NagC operator; letter in the red frame: transcription start site of pig operon; and bold letters: −10 and −35 regions. (B) EMSA detection of NagC binding to the P1 probe. (C) EMSA detection of NagC binding to the P2 probe. (D) EMSA detection of NagC binding to the P3 probe. (E) Alignment of E. coli NagC and Serratia sp. ATCC 39006 NagC operators. Red letters: absolutely conserved sequences; underlined letters: less conserved sequences; and shaded letters: predicted NagC binding site in the pig promoter. (F) Identification of the NagC binding site in the pig promoter. EMSA of the Association between NagC and P_pig probe, as well as NagC and P_pig-mut, that is, P_pig probe containing the mutated sequence in (E). Labeled probe (0.2 nM) was added to each reaction mixture, and the NagC concentrations in each reaction mixture are shown above the figure. The arrow indicates free probes, and the bracket indicates protein-DNA complexes. (G) Prodigiosin yield, and (H) the pigA transcription levels of WT/P_aacC1-pig and ΔnagC/P_aacC1-pig strains. The relative transcription values of pigA in the WT/P_aacC1-pig strain are set as 1. (I) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/P_aacC1-pig/PigA-FLAG and ΔnagC/P_aacC1-pig/PigA-FLAG strains. The strains used in (G) to (I) were all cultured in LB medium. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with student’s t tests. NS: no statistical significance.

NagC promotes prodigiosin production independent of GlcNAc in Serratia sp. ATCC 39006

Although the addition of GlcNAc to the medium influences the transcriptional activity of NagC in E. coli, NagC cannot bind directly to GlcNAc (20). GlcNAc is converted to GlcNAc-6-phosphate (GlcNAc-6-P) when it enters E. coli cells (20). GlcNAc-6-P binds to NagC to prevent it from binding to its operators (20). To investigate whether NagC regulates prodigiosin production in response to GlcNAc in Serratia sp. ATCC 39006, LB supplemented with 1% GlcNAc was used to culture WT and ΔnagC. These results showed that the addition of GlcNAc increased cell growth (Fig. 4A) but decreased prodigiosin production in both strains (Fig. 4B). In addition, the prodigiosin yield (Fig. 4B), pigA transcription (Fig. 4C), and the intracellular PigA protein levels (Fig. 4D; Fig. S5) of ΔnagC were significantly lower than those of WT in both LB and in LB supplemented with 1% GlcNAc. These results suggest that although the addition of GlcNAc reduces prodigiosin production of Serratia sp. ATCC 39006, it does not exert its repressive function through NagC. To confirm this result, EMSAs were performed to analyze whether the addition of GlcNAc-6-P and GlcNAc influenced the binding of NagC to the pig promoter. In E. coli, GlcNAc-6-P can prevent NagC from binding to its target DNA, but GlcNAc does not have this function (20). Our EMSA result showed that the binding of Serratia sp. ATCC 39006 NagC to the P_pig probe was not attenuated by either GlcNAc-6-P or GlcNAc (Fig. 4E). Thus, the ability of NagC to bind the pig promoter is not affected by environmental GlcNAc. To confirm this conclusion, M9 medium was employed for subsequent experiments. When 5% GlcNAc was added to M9 medium as the sole carbon source, prodigiosin production (Fig. 5A), pigA transcription (Fig. 5B), and the intracellular PigA protein levels (Fig. 5C; Fig. S6) of ΔnagC were similar to those of WT. These results seem to indicate that the addition of 5% GlcNAc to the M9 medium causes NagC to no longer regulate WT prodigiosin production, resulting in a phenotype similar to that of ΔnagC. However, this conclusion contradicts the above results of the fermentation experiment in LB and the EMSA result and therefore requires further investigation. In previous studies, glucose is the common carbon source used to culture Serratia sp. ATCC 39006 in M9 medium (9). Thus, to determine whether the similarities in the phenotypes between WT and ΔnagC is due to the addition of GlcNAc, we added 5% glucose (Glc) to M9 medium as the sole carbon source or added both 4% glucose and 1% GlcNAc to M9 medium. The results showed that the prodigiosin production (Fig. 5D), pigA transcription (Fig. 5E), and the intracellular PigA protein levels (Fig. 5F; Fig. S7) of ΔnagC were similar to those of WT in M9 medium supplemented with 4% glucose and 1% GlcNAc, which also seem to indicate that even in the presence of glucose as a carbon source and at much higher concentrations than GlcNAc, GlcNAc is still able to prevent NagC regulation of WT prodigiosin production. However, WT and ΔnagC exhibited similar phenotypes (Fig. 5D through F) in M9 medium supplemented with 5% glucose as the sole carbon source. We speculate that there are two possible reasons for this result. First, since glucose can be converted to GlcNAc in bacteria (20), it is possible that even without adding GlcNAc to the medium, some glucose is converted to GlcNAc, preventing NagC from binding to the pig promoter region. Second, NagC still binds to the pig promoter region in the presence of GlcNAc but cannot initiate transcription of the pig operon alone under M9 culture conditions. To investigate which of the above regulatory models NagC conforms to, ChIP-qPCR was performed when the bacteria were cultured in M9 medium supplemented with 5% GlcNAc. The results showed that although the medium contained 5% GlcNAc, NagC still bound to the promoter region of the pig operon (Fig. 5G). In addition, M9 medium supplemented with 5% GlcNAc followed by 1% tryptone or 0.5% yeast extract was used to confirm this result. The results showed that in the presence of 1% tryptone or 0.5% yeast extract (YE), prodigiosin production (Fig. 5H), pigA transcription (Fig. 5I), and intracellular PigA protein levels (Fig. 5J; Fig. S8) of ΔnagC were significantly lower than those of WT. These results indicate that the addition of tryptone or yeast extract causes a difference in prodigiosin production between WT and ΔnagC, and even the presence of 5% GlcNAc in the medium does not prevent this discrepancy. Thus, these results lead to two conclusions. First, GlcNAc cannot prevent NagC from binding to the pig promoter. Second, when bacteria are grown in minimal medium, NagC can still bind to the pig promoter, but it cannot initiate the transcription of the pig operon. We speculate that this could be because the bacteria in enriched and minimal medium have different physiological metabolisms. In other words, the transcription initiation activity of NagC may only be activated when the bacteria are grown in enriched medium. In conclusion, the transcriptional regulatory activity of NagC on the pig operon is not affected by GlcNAc in Serratia sp. ATCC 39006.

Fig 4.

NagC promotes prodigiosin production independent of GlcNAc. (A) Cell growth, (B) prodigiosin yield, and (C) pigA transcription levels of WT and ΔnagC. The relative transcription values of pigA in the WT strain grown in LB medium are set as 1. (D) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/PigA-FLAG and ΔnagC/PigA-FLAG strains. The strains used in (A) to (D) were all cultured in LB or LB supplemented with 1% GlcNAc. (E) EMSA of the GlcNAc-6-P and GlcNAc-based effects on the binding of NagC to the P_pig probe (P208 fragment). The concentrations of GlcNAc-6-P and GlcNAc and NagC in each reaction mixture are shown above the figure. Labeled probe (0.2nM) was added to each reaction mixture. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with student’s t tests. NS: no statistical significance; **: P < 0.01; ***: P < 0.001.

Fig 5.

NagC directly regulates the transcription of the pig operon independently of GlcNAc. (A) Prodigiosin yield and (B) pigA transcription levels of WT and ΔnagC. The relative transcription value of pigA in the WT strain are set as 1. (C) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/PigA-FLAG and ΔnagC/PigA-FLAG strains. The strains used in (A) to (C) were all cultured in M9 medium supplemented with 5% GlcNAc. (D) Prodigiosin yield and (E) pigA transcription levels of WT and ΔnagC. The relative transcription values of pigA in the WT strain grown in M9 medium supplemented with 5% glucose is set as 1. (F) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/PigA-FLAG and ΔnagC/PigA-FLAG strains. The strains used in (D) to (F) were all cultured in M9 medium supplemented with 5% glucose (Glc) or M9 medium supplemented with 4% glucose and 1% GlcNAc. (G) In vivo ChIP-qPCR analysis of FLAG-NagC binding to the promoter of the pig operon when the strains were cultured in M9 medium supplemented with 5% GlcNAc. An anti-FLAG affinity gel was used to precipitate the protein-DNA complex, and WT was used as a negative control. The Y-axis indicates the relative enrichment value of NagC at its target site, which was calculated by comparing the Ct value of the sample and the input. (H) Prodigiosin yield and (I) pigA transcription levels of WT and ΔnagC. The relative transcription value of pigA in the WT strain grown in M9 medium supplemented with 5% GlcNAc and 1% tryptone is set as 1. (J) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/PigA-FLAG and ΔnagC/PigA-FLAG strains. The strains used in (H) to (J) were all cultured in M9 medium supplemented with 5% GlcNAc and 1% tryptone, or M9 medium supplemented with 5% GlcNAc and 0.5% YE. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with student’s t tests. NS: no statistical significance; **: P < 0.01; ***: P < 0.001.

NagC directly represses transcription of the nag operon independently of GlcNAc in Serratia sp. ATCC 39006

In E. coli, NagC directly represses the transcription of nagE and nagBACD operon, whereas GlcNAc-6-P binds to NagC to prevent it from binding to the bidirectional promoter, thereby suppressing the repression of the nag regulon by NagC (17). In Serratia sp. ATCC 39006, the nag regulon arrangement is similar to that of E. coli. Amino acid alignment showed that the identity of Serratia sp. ATCC 39006 NagB (protein_id="AUH05899.1") to E. coli K-12 NagB (protein_id="NP_415204.1") is 79.7%, the identity of Serratia sp. ATCC 39006 NagA (protein_id="AUH05900.1") to E. coli K-12 NagA (protein_id="NP_415203.1") is 68.75%, and the identity of Serratia sp. ATCC 39006 NagE (protein_id="AUH05898.1") to E. coli K-12 NagE (protein_id="NP_415205.1") is 33.09%. Thus, we next investigate whether NagC regulates the transcription of the nag regulon in Serratia sp. ATCC 39006. qRT-PCR assay results showed that the transcription of nagE, nagA, and nagB were all elevated in ΔnagC and restored in CnagC (Fig. 6A), indicating that NagC also negatively regulates the transcription of the nag regulon in Serratia sp. ATCC 39006. In Serratia sp. ATCC 39006, the length of the bidirectional promoter region of the nag regulon is 433 bp, which harbors the bidirectional promoter region of nagE and nagBAC operon (Fig. 1C). Similar to E. coli, two conservative binding sequences of NagC are found in the bidirectional promoter region of the nag regulon in Serratia sp. ATCC 39006, adjacent to the nagBAC operon and nagE, respectively (Fig. 3E). Thus, the nagE-nagB intergenic region was used as a probe for EMSA, and the result showed that NagC specifically bound to the bidirectional promoter region of the nag regulon (Fig. 6B). The ChIP-qPCR result indicated that the enrichment of the promoter of pig operon in WT/FLAG-NagC was significantly higher (about 15-fold) than that in the WT (Fig. 6C). Thus, NagC directly represses the transcription of the nag regulon in Serratia sp. ATCC 39006.

Fig 6.

NagC directly represses the transcription of the nag regulon independently of GlcNAc. (A) Transcription levels of nagE and nagBA in WT, ΔnagC, and CnagC. The relative transcription values of evaluated genes in the WT strain are set as 1. (B) EMSA detection of NagC binding to the P_nag probe that contains the promoter region of the nag operon. Labeled probe (0.2 nM) was added to each reaction mixture, and the NagC concentration in each reaction mixture is shown above the figure. Lane S: 100-fold unlabeled specific competitive probe. Lane N: 100-fold unlabeled non-specific competitive probe. Arrow indicates free probes, and bracket indicates the protein-DNA complexes. (C) In vivo ChIP-qPCR analysis of FLAG-NagC binding to the promoter of the nag operon. An anti-FLAG affinity gel was used to precipitate the protein-DNA complex, and WT was used as the negative control. The Y-axis indicates the relative enrichment value of NagC at its target site, which was calculated by comparing the Ct value of the sample and the input. The strains used in (A) and (C) were cultured in LB medium. (D) EMSA of the GlcNAc-6-P and GlcNAc-based effects on the binding of NagC to the P_nag probe. The concentrations of GlcNAc-6-P and GlcNAc and NagC in each reaction mixture are shown above the figure. Labeled probe (0.2 nM) was added to each reaction mixture. (E) In vivo ChIP-qPCR analysis of FLAG-NagC binding to the promoter of the nag operon. An anti-FLAG affinity gel was used to precipitate the protein-DNA complex, and WT was used as a negative control. The Y-axis indicates the relative enrichment value of NagC at its target site, which was calculated by comparing the Ct value of the sample and the input. (F) Transcription levels of nagE and nagBAC in WT and ΔnagC. The relative transcription values of evaluated genes in the WT strain are set as 1. The strains used in (E) and (F) were all cultured in M9 medium supplemented with 5% GlcNAc. (G)Transcription levels of nagE and nagBAC in WT and ΔnagC that were cultured in M9 medium supplemented with 5% GlcNAc and 1% tryptone. The relative transcription values of evaluated genes in the WT strain are set as 1. (H) Transcription levels of nagE and nagBAC in WT and ΔnagC that were cultured in M9 medium supplemented with 5% GlcNAc and 0.5% yeast extract (YE). The relative transcription values of evaluated genes in the WT strain are set as 1. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with student’s t tests. NS: no statistical significance; ***: P < 0.001.

In the above experiments, we found that the transcriptional regulation of the pig operon by NagC is not responsive to GlcNAc. Thus, we next investigate whether the regulation of the nag regulon by NagC responds to GlcNAc. The EMSAs were performed to analyze whether the addition of GlcNAc-6-P and GlcNAc influences the binding of NagC to the bidirectional promoter of the nag regulon. The result showed that the binding of NagC to the P_nag probe was not attenuated by either GlcNAc-6-P or GlcNAc (Fig. 6D). In addition, ChIP-qPCR was performed when the bacteria were cultured in M9 medium supplemented with 5% GlcNAc. The results showed that although the medium contained 5% GlcNAc, NagC was still bound to the promoter region of the nag operon (Fig. 6E). Thus, the ability of NagC to bind the nag promoter is not affected by GlcNAc. To confirm this result, qRT-PCR assay was performed to determine whether GlcNAc affects the transcription of the nag regulon by NagC. The results showed that the transcription of nagE, nagA, nagB, and nagC in ΔnagC was similar to that in WT when bacteria were cultured in M9 with 5% GlcNAc (Fig. 6F). However, when bacteria were cultured in M9 with 5% GlcNAc, either added 1% tryptone or 0.5% yeast extract, the transcription of nagE, nagA, nagB, and nagC in ΔnagC was significantly higher than that in WT (Fig. 6G and H), indicating that NagC directly represses transcription of the nag operon independent of GlcNAc. Thus, whether acting as an activator or a repressor, the transcriptional regulatory activity of NagC is independent of GlcNAc in Serratia sp. ATCC 39006.

DISCUSSION

In the present study, we find that NagC, a ROK family transcription factor, promotes the prodigiosin production of Serratia sp. ATCC 39006. NagC directly binds to a 21-nt region that partially overlaps the −10 and −35 regions of the pig promoter and promotes the transcription of prodigiosin biosynthetic genes. In this regulation, NagC probably acts as an activator to change the conformation of the target promoter to allow RNA polymerase to interact with the promoter −10 and/or −35 elements (28). With a promoter region of 922 bp, the transcription of the pig operon in Serratia sp. ATCC 39006 can be easily regulated by a wide range of transcription factors, including PigT (9), PhoB (6, 8, 29), Rap (6, 8), Fnr (11), and OhrR (10). Most of these transcription factors bind at different positions (relative to the TSS of the pig operon) to regulate the transcription of prodigiosin biosynthesis genes in response to various signals. In addition, some of these transcription factors bind to the −10 and −35 regions of the pig operon, such as PhoB, Fnr, and NagC in this study (6, 8, 11). Although they are regulated under different culture conditions, for example, PhoB exhibits regulatory activity only in phosphate-limiting medium (29), whether there is cross-regulation between these transcription factors under a particular condition needs further investigation.

NagC is a critical transcription factor in γ-proteobacteria. In previous studies, NagC mainly regulates the expression of genes involved in GlcNAc transport and metabolism (15, 16). Moreover, NagC can also control the expression of genes involved in chitobiose, galactose, and cellobiose metabolism (22, 25, 30). Notably, NagC can act as a global transcription factor to regulate the expression of multiple genes involved in biofilm formation, type 1 fimbriae, and curli production (24, 26, 27). However, NagC has not been reported to regulate the expression of secondary metabolism-related genes. This study is the first demonstration of NagC regulation of prodigiosin biosynthesis gene expression in Serratia sp. ATCC 39006, which contributes to future studies on the regulation of secondary metabolism by NagC in other bacteria.

In most bacteria, the transcriptional regulatory activity of NagC responds to environmental GlcNAc, either as an activator or repressor (16, 20). After entering the cell, GlcNAc is converted into GlcNAc-6-P, which binds to NagC and releases NagC from its operator, thereby controlling its transcriptional regulatory activity (20). Serratia sp. ATCC 39006 NagC (NagC₃₉₀₀₆) is 73.71% identical to E. coli NagC (NagC_{E. coli}) (Fig. 1B), and the conservative binding sequence of NagC₃₉₀₀₆ is also similar to that of NagC_{E. coli} (Fig. 3E). However, GlcNAc-6-P (environmental GlcNAc) cannot prevent NagC₃₉₀₀₆ from binding to its operator in vivo or in vitro (Fig. 4E, 5G, 6D and 6E), indicating that the ability of NagC₃₉₀₀₆ to bind DNA is not regulated by environmental GlcNAc. NagC has an N-terminal DNA-binding helix-turn-helix (HTH) motif that is linked to the C-terminal domain, which is approximately 300 amino acids in length and contains the ROK motif (31). In E. coli, three amino acids, P46, A47, and K50, in the HTH domain and four amino acids (31), H194, E244, G246, and E266, in the ROK domain play an important role in GlcNAc-6-P regulation of NagC_{E. coli} binding to DNA (19). Point mutations in these amino acid sites render NagC_{E. coli} insensitive to GlcNAc-6-P; that is, NagC_{E. coli} still binds to its operator in the presence of GlcNAc-6-P when these amino acid sites are mutated (19, 31). These seven amino acids of NagC₃₉₀₀₆ are completely identical to those of NagC_{E. coli} (Fig. 1B). These suggest that other amino acids may be involved in the regulation of NagC by GlcNAc-6-P, which happens to be mutated in NagC₃₉₀₀₆, resulting in NagC₃₉₀₀₆ no longer responding to GlcNAc-6-P. Furthermore, NagC₃₉₀₀₆ can bind to its operator when the bacteria were cultured in M9 with 5% GlcNAc (Fig. 5G and 6E), but the expression of the pig operon and nag regulon in WT was similar to that in ΔnagC (Fig. 5B, C, and 6F), suggesting that although NagC₃₉₀₀₆ binds to its operator, it cannot initiate the transcription of target genes in minimal medium. However, in LB medium or M9 (5% GlcNAc) supplement with 1% tryptone or 0.5% yeast extract, NagC not only bound to the pig operon and nag regulon (Fig. 2G and 6C) but also regulated the transcription of these regulons (Fig. 2C, 6A, G, and H). This may be because the transcription initiation activity of NagC can only be activated when the bacteria are grown in an enriched medium. However, the underlying mechanism by which NagC initiates transcription of its regulons in Serratia sp. ATCC 39006 is not revealed in the present study. Thus, further investigation is necessary to find these new regulatory models for NagC in γ-proteobacteria as well as other response signals.

GlcNAc is a nitrogen-containing monosaccharide, which is not only an essential component of the bacterial cell wall and lipopolysaccharide but also an excellent carbon source for bacteria (21, 32). GlcNAc has been reported to regulate the biosynthesis of secondary metabolites in Streptomyces (33–36). In Streptomyces verticillus, GlcNAc can increase the production of bleomycins (33). In γ-proteobacteria, GlcNAc also regulates antibiotic production. Pseudomonas aeruginosa enhances phenazine production in the presence of GlcNAc (37). In the present study, although NagC regulation of prodigiosin production is not responsive to GlcNAc, GlcNAc still controls prodigiosin biosynthesis of Serratia sp. ATCC 39006 (Fig. 4B through D). To confirm this result, the strains in which the native pig promoter was replaced by the constitutive P_aacC1 promoter were used. WT/P_aacC1-pig and ΔnagC/P_aacC1-pig were cultured in LB or LB supplemented with 1% GlcNAc. The results showed that both strains had similar prodigiosin yield, pigA transcription, and intracellular PigA protein levels (Fig. 7; Fig. S9), suggesting that GlcNAc regulates transcription of the pig operon. Transcription factors responsive to GlcNAc have been found to belong to three families (38): ROK family (e.g., E. coli NagC) (18, 20), LacI family (e.g., Xanthomonas campestris pv. campestris NagR, Shewanella oneidensis MR-1 NagR) (32), and GntR family (e.g., Streptomyces DasR, Pseudomonas aeruginosa NagR, and Xanthomonas campestris pv. campestris NagQ) (32, 36, 37). The regulatory models of these transcription factors are similar. In the absence of GlcNAc, these transcription factors bind to their operators to regulate the transcription of their target genes. In the presence of GlcNAc, these transcription factors dissociate from their operators and no longer regulate the transcription of their target genes (20, 33, 36). However, GlcNAc binds these transcription factors in different molecular forms in cells. The ligand for NagC is GlcNAc-6-P in E. coli (20). Both GlcNAc-6-P and GlcN-6-P serve as ligands for DasR in Streptomyces (39, 40). In the three families, the transcription factors that control the production of antibiotics in response to GlcNAc mainly belong to the GntR family (34, 36, 37). In Streptomyces roseosporus, DasR, a GntR family transcription factor, regulates daptomycin biosynthesis by controlling the transcription of the dpt structural genes and the global regulatory gene adpA (34). Thus, there may be other transcription factors that respond to GlcNAc to control the transcription of prodigiosin biosynthetic genes in Serratia sp. ATCC 39006. Further studies are required to identify GlcNAc-responsive transcription factors from Serratia sp. ATCC 39006. Optimization of medium composition is a significant technique for enhancing prodigiosin production. In several experiments, certain medium components have been shown to stimulate bacterial growth while suppressing antibiotic synthesis. For Serratia marcescens BWL1001, glycerol significantly increases cell growth but dramatically suppresses prodigiosin production when utilized as a carbon source (41). In this study, the addition of GlcNAc to LB promotes cell growth (Fig. 4A) but suppresses prodigiosin production in Serratia sp. ATCC 39006 (Fig. 4B). Thus, it is crucial to understand how these growth-promoting nutrients suppress prodigiosin production. By constructing genetic engineering bacteria to override this suppression, the upregulation of bacterial growth will contribute to a significant increase in the production of secondary metabolites.

Fig 7.

GlcNAc regulates prodigiosin production. (A) Prodigiosin yield and (B) pigA transcription levels of WT and ΔnagC. The relative transcription values of pigA in the WT strain grown in LB medium is set as 1. (C) Expression analysis of C-terminal 3× FLAG-tagged PigA in WT/P_aacC1-pig/PigA-FLAG and ΔnagC/ P_aacC1-pig/PigA-FLAG strains. The strains used in (A) to (C) were all cultured in LB or LB supplemented with 1% GlcNAc. Experimental data are shown as means ± SD (n = 3), and significant differences between data sets were evaluated with student’s t tests. NS: no statistical significance.

MATERIALS AND METHODS

Bacterial strains, plasmids, primers, oligonucleotides, and culture conditions

Bacteria strains used in this research are listed in Table 1, and the primers used in this research are listed in Table 2. The strains and vectors constructed in this study were verified by DNA sequencing. Serratia sp. ATCC 39006 and E. coli strains were cultured at 30℃ and 37℃, respectively. The shaking flask assay was performed with 25 mL of liquid medium in 100 mL volume Erlenmeyer flasks at 200 rpm. For solid media, agar was added to LB, LCS, and M9 medium to a final concentration of 1.8% (wt/vol) (11). Antibiotics were used at the following final concentrations: Kanamycin (Km): 50 µg/mL and Gentamicin (Gm): 15 µg/mL. The antibiotics, glucose, and GlcNAc used in this study were purchased from Beijing Solarbio Science & Technology Co., Ltd.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Usage or description	Source
Escherichia coli
S17-1(λpir)	Routine transconjugation host and cloning host for pMMB1 plasmid variants. recA, pro, hsdR, recA::RP4-2-Tc::Mu, λpir, TmpR, SpR, SmR	Laboratory stock
DH5α	Routine cloning host. fhuA2, lacΔU169, phoA, glnV44, Φ80', lacZΔM15, gyrA96, recA1, relA1, endA1, thi-1, hsdR17	Laboratory stock
BL21(DE3)	Protein expression host. dcm, ompT, hsdS (rB-mB-) gal	Laboratory stock
BL21(DE3)/pET28-nagC	Heterologous expression of N-terminal His6-tagged Serratia sp. ATCC 39006 NagC protein	This study
UQ3022	Donor strain for the mini-Tn5 transposon containing plasmid, pRL27	(42)
Serratia sp. ATCC 39006
Wild-type (WT)	Serratia sp. ATCC 39006 (car+, pig+, lac-)	(7)
ΔnagC	nagC (Ser39006_RS18250) deletion mutant	This study
CnagC	ΔnagC containing plasmid pBBR1MCS2-PaacC1-nagC for complement of nagC	This study
OnagC	WT containing plasmid pBBR1MCS2-PaacC1-nagC for overexpression of nagC	This study
WT/FLAG-NagC	N-terminal 3 × FLAG-tagged nagC transformant	This study
WT/PigA-FLAG	C-terminal 3 × FLAG-tagged pigA transformant	(11)
ΔnagC/PigA-FLAG	C-terminal 3 × FLAG-tagged pigA in ΔnagC	This study
WT/PaacC1-pig	replace the promoter region of pig operon with aacC1 promoter	(11)
ΔnagC/PaacC1-pig	replace the promoter region of pig operon with aacC1 promoter in ΔnagC	This study
WT/PaacC1-pig/PigA-FLAG	replace the promoter region of pig operon with aacC1 promoter, C-terminal 3 × FLAG-tagged pigA transformant	This study
ΔnagC/PaacC1-pig/PigA-FLAG	replace the promoter region of pig operon with aacC1 promoter, C-terminal 3 × FLAG-tagged pigA in ΔnagC	This study
ΔpigA/pBBR1MCS5-Ppig-lacZ	ΔpigA harboring a lacZ reporter plasmid with a pigA promoter	(11)
Plasmids
pET-28a(+)	Vector for heterologous protein expression in E. coli, Kmr	Novagen
pET28-nagC	Vector for heterologous expression of N-terminal His6-tagged Serratia sp. ATCC 39006 NagC, Kmr	This study
pMV-pigAPro-NagCMu	Vector containing the nucleotide sequence of EMSA probe Ppig, with its predicted NagC-binding sites mutated, Ampr	Synthesized by BGI Genomics in this study.
pRL27	Plasmid containing Mini-Tn5 transposon and a Pir protein-dependent DNA replication origin (oriR6K), Kmr	(42)
pBBR1MCS2	Broad-host-range vector, Kmr	(43)
pBBR1MCS2-PaacC1	pBBR1MCS2 containing a constitutive promoter, PaacC1, Kmr	Laboratory stock
pBBR1MCS5-Ppig-lacZ	Reporter vector for identifying the transcriptional regulators bind to the pig promoter, Gmr	(11)
pBBR1MCS2-PaacC1-nagC	Plasmid for expression of nagC under a constitutive promoter, PaacC1, Kmr	This study
pMMB1	Suicide plasmid for Serratia sp. ATCC 39006, replacing the DNA replication origin of pK19mobsacB with a Pir protein-dependent oriR6K from pKNG101, sacB (modified from Bacillus subtilis), lacZ, Kmr	(11)
pMMB1-DnagC	Plasmid used for in-frame deletion of nagC gene, Kmr	This study
pMMB1-NFlag-NagC-Knockin	Plasmid used to knock in 3 × FLAGtag to the N-terminus of nagC gene, Kmr	This study
pMMB1-PaacC1-pig	Plasmid used to replace Ppig with PaacC1, Kmr	(11)

TABLE 2.

Primers used in this study

Primer/ Oligonucleotide	Nucleotide sequence	Usage
Primers
Tn5-F	CAGCAACACCTTCTTCACGA	Mapping the transposon insertion site
Tn5-R	AACAAGCCAGGGATGTAACG
nagC-5F	TTACTGCAGATAAAGCACAGTGTTGAAGTCATG	nagC upstream homologous arm
nagC-5R	GGTAAGCTTTTCACAAATAATGGAGATGGCGCG
nagC-3F	TAGAAGCTTCAACGTTTGCTTGAAAATCAT	nagC downstream homologous arm
nagC-3R	GAAGGATCCGATGATAATACTCACGAATCTCAC
nagC-UF	GGAATATTGATCTGGTTAAGCAAC	Verification of ΔnagC deletion mutant
nagC-DR	GAGACTCCCTTGATTCACTCTTGG
nagC-OF	GTGGTGTTCAGTTTAACGACTCTT
nagC-OR	ATAAGGTACGTCAGACATCAGGTG
nagC-InF	ATCGACCACTTCATTGACACCCAT
nagC-InR	CCTTGTTCAAGCAAATTTCGTATC
nagC-CF	TTTGTGGGATCCAATGGTGAAGAAGTATTGACCACA	Complementation of nagC
nagC-CR	CCAAACGAATTCTTAATGATTTTCAAGCAAACGTTG
nagB-nagA-RTF	CGAATTGGAAGCTGAAAGTATCAA	Verification of co-transcription of nagB and nagA
nagB-nagA-RTR	AAAGAGTCGTTAAACTGAACACCA
nagA-nagC-RTF	TGAATGTGGTAAAGTAGCCAATCT	Verification of co-transcription of nagA and nagC
nagA-nagC-RTR	ATTGAGTTGCTTAACCAGATCAAT
Flag-NagC-ConF	TGAGCGGGATCCGATCCGCGCTCACCATGATTGAAG	Construction of pMMB1-NFlag-NagC-Knockin plasmid
Flag-NagC-ConR	GCGCTGCTGCAGATGGGTGTCAATGAAGTGGTCGAT
NagC-NFlag-F	GCTCTAGAACCACAAGCGGACAGACACAGATAGGGAATAT
NagC-NFlag-R	CGACGTCGACCATTAAAACGTTACTCGCCTGTGGTCAATA
Flag-NagC-F	ACGCGTCGACGGAGGTGGCGATTACAAGGATGAC
Flag-NagC-R	GCTCTAGAGCCACCTCCTTTATCGTCATCATC
16S-QF	CAACTTAACAGACCGCCTGCGTGC	qRT-PCR primer for 16S rRNA
16S-QR	GCAGAAGAAGCACCGGCTAACTCC
nagC-QF	GGAATATTGATCTGGTTAAGCA	qRT-PCR primer for nagC
nagC-QR	GATTTTGGTAACGCTAGCG
nagE-QF	TTGATTCCGCAGGGATTCGTGTTC	qRT-PCR primer for nagE
nagE-QR	TCCAGGCGTCATCAGGTTAAAGCG
nagB-QF	CATGATTCTGGTTAGCGGACGCAA	qRT-PCR primer for nagB
nagB-QR	GCTTTGGCATGAAGCTGTAGGCAA
nagA-QF	CATCTGTGTGGATGAGAACGGCAT	qRT-PCR primer for nagA
nagA-QR	TTCGGAGTGCTTCATCCAGAGCGA
pigA-QF	TGGAGCAGTGTCGGTTGATGCTCT	qRT-PCR primer for pigA
pigA-QR	GAACCGCGTACTCGGAAATCAGCA
pigB-QF	TGCTGGGTCATTCGTTTGGTGGCT	qRT-PCR primer for pigB
pigB-QR	ATGATCGTCCATCCAGTTGGCCAC
pigC-QF	CAGTGCCATTGCCGTGATTCTACA	qRT-PCR primer for pigC
pigC-QR	CTTATCGGTGCTCCCTGACAGAGG
pigD-QF	ACTGCCCACCGATAAGCGACAGTT	qRT-PCR primer for pigD
pigD-QR	ACTCATCGTCACTGACCGGTCCTA
pigE-QF	GATCAAACCTTCGCTGGTGCCGTA	qRT-PCR primer for pigE
pigE-QR	GGAATTTCCATGTCGTGTGCCAGT
pigF-QF	GGCGGTATCGAAAGCAGTCCTCAG	qRT-PCR primer for pigF
pigF-QR	ACTATCAGTGTACGAGGACCGGAT
pigG-QF	GAGCAAGGTCTCGATTGGCATGCA	qRT-PCR primer for pigG
pigG-QR	AGCCGTTGCACCAGCGCAACCATA
pigH-QF	CGCTGTCAGCGTTGAAGCAGTGTT	qRT-PCR primer for pigH
pigH-QR	GCATCATGGTCAATGGCGGAGTCG
pigI-QF	ATGTGCTGTCCAATCACGCCAGTT	qRT-PCR primer for pigI
pigI-QR	CGCGGCGCAATCTTTCTGTTCGCT
pigJ-QF	GACGCAATTGTATGCGCTGAATAG	qRT-PCR primer for pigJ
pigJ-QR	TACTGGCAATGATGATCGCCACAC
pigK-QF	GGATTATTGCGCTTGCGAGAGCCT	qRT-PCR primer for pigK
pigK-QR	GGCGTCCATCGAGCTTATGTGAAT
pigL-QF	CAACGGATGGTGAAACAGCGGGCA	qRT-PCR primer for pigL
pigL-QR	CACTCGGCCGATGAGTCAGTGTAA
pigM-QF	TGTCGCTGATCTGGTGGCTTATCA	qRT-PCR primer for pigM
pigM-QR	AATAACGCGTATAGTTGTGCCTGT
pigN-QF	CAATGGGTAGCCATCGTGGTTTAT	qRT-PCR primer for pigN
pigN-QR	CCGGAGCAGAGGATCTGGCCTTTA
pigO-QF	TTGCTACTCGCTCACCAAGACGGC	qRT-PCR primer for pigO
pigO-QR	TTCAGCAGATCCAGACCTCGAACA
NagC-EF	GTTTTAGGATCCATGACCACAAGCGGACAGACACAG	Construction of expression vector for His6-NagC
NagC-ER	CCAAACGAATTCTTAATGATTTTCAAGCAAACGTTG
nag-PF	AAGCAAGCAACAGAAAGTCT	Amplification of EMSA probe Pnag
nag-PR	GGCTAAAGGAATCAGTCTCAT
pigA-PF	CATGTGTTAATTGTGGGTATG	Amplification of EMSA probe Ppig or Ppig-mut
pigA-PR	TATACGCTGACTCATAAATATCTG
P1F	CATGTGTTAATTGTGGGTATG	Amplification of EMSA probe P1
P1R	GCAACATTGGAAAATACGT
P2F	ATTTTCCAATGTTGCATT	Amplification of EMSA probe P2
P2R	AATCCATAAAACACTCCATT
P3F	GGAAGCAATGGAGTGTTT	Amplification of EMSA probe P3
P3R	TATACGCTGACTCATAAATATCTG
nagC-ChIP-F	ATAGTTTAATATACTCACCTTCCCC	ChIP-qPCR primer for nagC
nagC-ChIP-R	ACAACACGAAACGAGGAAT
pigA-ChIP-F	GTTACTGGTAACTGGAAAGCTATT	ChIP-qPCR primer for pigA
pigA-ChIP-R	GACAGGTTAAAATCCATAAAACAC

Transposon mutagenesis and identification of transposon insertion site

To search for the transcription factors that bind to the promoter region of the pig operon, the mini-Tn5 transposon was used to mutate Serratia sp. ATCC 39006 as previously performed (11). The transposon insertion sites were identified using an inverse PCR assay, as previously described (11).

Gene manipulation and complementation

To perform in-frame deletion of nagC, a 1,090 bp upstream homologous arm and a 904 bp downstream homologous arm were amplified and purified. The homologous arms were digested and ligated to the pMMB1 plasmid to obtain the nagC in-frame deletion plasmid (11), pMMB1-DnagC. E. coli S17-1(λpir) containing pMMB1-DnagC was conjugated with the wild-type strain (WT) of Serratia sp. ATCC 39006 to generate the nagC in-frame deletion mutant, ΔnagC. The conjugation and verification procedures are described in previous research (11). Briefly, S17-1(λpir)/pMMB1-DnagC and Serratia sp. ATCC 39006, which were cultured overnight, were mixed, and dropped onto LB agar and incubated at 30°C for 12 h to form a lawn. The lawn was collected and washed twice with 10 mM MgSO₄, and the cells were plated on M9 agar containing 50 µg/mL kanamycin. Transformants were inoculated into LC liquid (1% tryptone; 0.5% yeast extract). After 24 h incubation at 30°C, the liquid was diluted and plated onto LCS agar (1% tryptone, 0.5% yeast extract, 20% sucrose and 1.8% agar powder). The right ΔnagC mutants were verified by colony PCR using the primer pairs nagC-UF/nagC-DR, nagC-OF/nagC-OR, and nagC-InF/nagC-InR.

To complement nagC, a complementary plasmid pBBR1MCS2-P_aacC1 with a constitutive promoter, P_aacC1, was used. The open reading frame of the nagC gene, as well as its ribosome binding site, was amplified and ligated to pBBR1MCS2-P_aacC1, and the resulting nagC-complementary vector pBBR1MCS2-CnagC was then conjugated to ΔnagC to obtain the complemented strain, CnagC.

To generate the N-terminal 3× FLAG-tagged NagC strain WT/Flag-NagC, primers Flag-NagC-ConF-BamHI and Flag-NagC-ConR-PstI were used to amplify a 740 bp fragment flanking the start codon of the nagC gene. The fragment was ligated to pMMB1 plasmid to obtain an intermediate plasmid, pMMB1-NFlag-NagC-Con. A pair of primers, NagC-NFlag-F and NagC-NFlag-R, were used to amplify a fragment F1, using the pMMB1-NFlag-NagC-Con as a template. A 3× FLAG tag encoding oligonucleotide, which is amplified with the Flag-NagC-F and Flag-NagC-R primers, was ligated to obtain the N-terminal 3× FLAG tag knock-in vector, pMMB1-NFlag-NagC-Knockin. The resulting plasmid was then conjugated to WT to generate the N-terminal 3× FLAG-tagged NagC strain WT/Flag-NagC.

Fermentation and prodigiosin yield analysis

The fermentation process was slightly modified from previous research (10, 11). To perform shake flask fermentation, Serratia strains were cultured in LB liquid overnight to obtain seed medium. The seed medium was then inoculated into fresh LB/M9 medium at 1% inoculation volume. The culture time for LB-based and M9-based fermentation was 9 hours, respectively. To analyze the prodigiosin yield, 5 mL of LB-based fermentation broth or 10 mL of M9-based fermentation broth were collected by centrifugation to discard the supernatant, and the prodigiosin was extracted from the cells using 1 mL acidified methanol (pH 3.0). The absorbance at 534 nm of the extract was then measured using a spectrophotometer. Then, the values were converted to prodigiosin concentrations according to a previously acquired standard curve (41). The cell mass was measured by spread plating and counting the colonies.

RNA isolation and real-time reverse transcription-PCR (qRT-PCR)

Two milliliters of the fermentation broth were centrifuged to collect cells used for RNA isolation. The RNA isolation, reverse transcription, and qRT-PCR experiments were performed as previously described (11). Primers are listed in Table 2. The 16S rRNA gene was used as an internal control.

Heterologous expression and purification of His₆-tagged NagC protein

The NagC expression vector, pET28-NagC, was generated by inserting the nagC ORF into the pET-28a(+) plasmid. The pET28-NagC was then transformed into the E. coli expressing strain BL21(DE3), resulting in the N-terminal His₆-tagged NagC expressing strain, BL21(DE3)/pET28-NagC. The subsequent heterologous expression and purification process was described in previous research (10).

Electrophoretic mobility shift assay

EMSA experiments were performed as previously described (10). Briefly, EMSAs were performed using digoxigenin (DIG)-labeled DNA probes (final concentration: 0.2 nM) and purified His₆-NagC protein was mixed in a reaction volume of 20 µL. If necessary, unlabeled specific/non-specific competitors, GlcNAc-6-P (Shanghai yuanye Bio-Technology Co., Ltd, Y63951) and GlcNAc (Solarbio Life Sciences, N8420) were added to the mixture. After incubation at 30°C for 40 min, the probes were separated by gel electrophoresis in 5% native polyacrylamide gels and then transferred to a nylon membrane. Cross-linking and chemiluminescence detection processes were performed as described in the Roche 2nd Generation DIG Gel Shift Kit (Cat#03353591910). The plasmid pMV-pigAPro-NagCMu was used as a template for the amplification of P_pig-mut probe.

Chromatin immunoprecipitation-qPCR (ChIP-qPCR)

ChIP-qPCR was performed as previously described with minor modifications (10). In vivo cross-linking was performed by adding formaldehyde to the fermentation broth to a final concentration of 1%. After shaking at 30°C, 200 rpm for 30 min, the cross-linking was quenched by the addition of glycine to the final concentration of 0.125 M. After shaking for 5 min, the cells were harvested. In total, 0.15 g cells were washed three times with ice-cold PBS and resuspended in 2 mL ice-cold lysis buffer (50 mM HEPES, 137 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0. Protease inhibitor cocktail was added before sonication). Cellular DNA was sheared by sonication to an average size of 250–500 bp, and cell debris was removed by centrifugation. The protein concentration of the supernatant was measured, and the protein concentration was adjusted to 2 mg/mL with lysis buffer. Ten microliters supernatant was retained as input sample, and 1 mL supernatant was added to 40 µL balanced anti-Flag gel (Bimake) and vertically rotated at 4°C for 4 h. After incubation, the gel was washed twice with ChIP buffer I (50 mM HEPES, 500 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0), three times with ChIP buffer II (250 mM LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0), and twice with ChIP buffer III (1 mM EDTA, 50 mM Tris-HCl, pH 8.0). For elution and reverse cross-linking, the gel and input sample were resuspended in 500 µL fresh elution buffer (0.1 M NaHCO₃, 1% SDS, 250 mM NaCl, 0.1 mg/mL proteinase K) and the samples were incubated overnight at 65°C. The nucleotide from the input sample and gel (ChIP sample) was precipitated with ethanol, resuspended in 200 µL ddH₂O and analyzed by qPCR. The primers used for ChIP-qPCR are listed in Table 2.

Western blotting

The western blotting assay was performed as previously described (10, 11). Briefly, total protein from Serratia sp. ATCC 39,006 cells was extracted using Bacterial Protein Extraction Reagent (B-PER) (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol. The protein concentration of each sample was measured, and equal amounts of protein were loaded onto SDS-PAGE gels for separation. The protein was then transferred to a PVDF membrane and blocked with skim milk (5% in TBST). The membranes were incubated with primary antibodies (mouse-raised anti-FLAG M2 monoclonal antibody, Sigma-Aldrich, USA or DYKDDDDK-Tag (3B9) Mouse mAb, Cat#M20008, RIID: AB_2713960, Abmart, China) to target FLAG-tagged PigA or NagC. The membranes were incubated with secondary antibody (goat anti-mouse IgG, HRP conjugated, CoWin Biosciences, China), and the target proteins were detected by chemiluminescence using the eECL Western blotting Kit (CoWin Biosciences, China).

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.00891-24.

Supplemental material. aem.00891-24-s0001.docx.

Full gels of agarose gel, SDS-PAGE, and western blot assays; plasmid sequences.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.