Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2024 Jul 25;10(5):e1542. doi: 10.1002/vms3.1542

Diets containing phytobiotics, l‐arginine, vitamin E and captopril modulate ascites syndrome‐related genes expression in broiler chickens exposed to low ambient temperature

Hassan Shirzadi 1,✉, Farid Shariatmadari 2, Mohammad Amir Karimi‐Torshizi 2, Ali Akbar Masoudi 3, Shaban Rahimi 2, Fakhredin Saba 4, Gholamreza Zaboli 5, Nemat Hedayat‐Evrigh 6
PMCID: PMC11269884  PMID: 39049705

Abstract

Background

Our hypothesis centred on the potential to mitigate ascites outbreaks in birds exposed to cold stress by inhibiting pulmonary artery contraction through dietary intervention.

Objective

This study aimed to evaluate the effect of natural and synthetic medications on growth performance, ascites‐related parameters and the expression of ascites‐related genes in the lung tissue of broiler chickens under low ambient temperature.

Methods

We randomly assigned 450 one‐day‐old male Ross 308 chicks to six dietary treatments across five replicate pens, each containing 15 chicks. The treatments included a basal diet (control), and the basal diet was supplemented with hydroalcoholic extracts of sumac (HES, 200 mg/kg), Syrian mesquite (HEM, 200 mg/kg), l‐arginine (40% above requirement), captopril (15 mg/kg) and vitamin E (100 mg/kg).

Results

Diets containing HEM, l‐arginine and vitamin E resulted in increased average daily gain on days 8–14 and 0–28, whereas HES showed a similar effect only during days 8–14 compared to the control diet (p < 0.05). Additionally, feed additives decreased packed cell volume, left and right ventricle volumes and systolic blood pressure (p < 0.05). Moreover, chickens fed the control and l‐arginine diets exhibited higher levels of angiotensin converting enzyme (ACE) mRNA in lung tissue compared to those fed HES, HEM and captopril (p < 0.05). Meanwhile, supplementation with HEM and l‐arginine increased the expression of inducible nitric oxide synthase (iNOS) mRNA in lung tissue compared to other treatments (p < 0.05). Regarding Cu/Zn‐superoxide dismutase (Cu/Zn‐SOD) expression, feed additives increased mRNA level in lung tissue, except for captopril (p < 0.05).

Conclusions

This study demonstrates that the plant extracts may reduce the incidence of ascites syndrome not only through their antioxidant properties but also by modulating the expression of ACE, iNOS and Cu/Zn‐SOD genes.

Keywords: hypertrophy, l‐arginine, pulmonary hypertension, vasodilator, vitamin E

• This study was carried out to evaluate the effect of sumac, Syrian mesquite, l‐arginine, captopril and vitamin E on growth performance and ascites‐related parameters in broiler chickens exposed to cold stress.

• Average daily gain was increased by diets supplemented with sumac, Syrian mesquite, l‐arginine and vitamin E.

• All feed additives caused a decrease in packed cell volume, left and right ventricle volumes, systolic blood pressure and modulation of ACE, iNOS and Cu/Zn‐SOD genes expression.

graphic file with name VMS3-10-e1542-g002.jpg

1. INTRODUCTION

Ascites syndrome, also known as pulmonary arterial hypertension syndrome, is significant metabolic disorder in avian species, leading to substantial economic losses in the poultry industry (Leeson, 2007). Mortality rates associated with ascites can range from 5% to 8% across different populations, with even higher of 20%–30% reported in rooster flocks (Closter et al., 2009). The impact of these losses on the poultry industry is underscored by annual rearing of approximately 9 billion broilers in the United States alone (Rama et al., 2022). Ascites outbreaks are influenced by various factors, including genetic, environmental (particularly cold stress, which we induced to trigger ascites), nutritional and physiological factors, diseases and toxins, all of which elevate the demand for oxygen. This metabolic disorder predominantly affects fast‐growing broilers (Guo et al., 2023), with hypoxia or any condition increasing oxygen demands, such as cold stress (Sijun et al., 2002).

Numerous pharmaceutical and nutritional interventions have been suggested for controlling ascites, including furosemide, vitamin C and E, selenium, arginine, medicinal plants, skip‐a‐day feeding, limiting access to feed, low calorie diets and more (Gupta, 2011).

We hypothesized that through dietary manipulation to inhibit the contraction of pulmonary artery, we could potentially alleviate the outbreak of ascites in birds facing cold stress. Previous research indicates the involvement of inducible nitric oxide (NO) synthase (iNOS) and angiotensin converting enzyme (ACE) in artery contraction. It is known that the conversion of angiotensin (Ang) I into the physiologically active form, Ang II, is catalysed by ACE in lung tissue Ang II, within lung tissue. Ang II is recognized as a potent vasoconstrictor capable of inducing hypertension by enhancing sympathetic nervous system activity, vasoconstriction, and aldosterone secretion (Balasuriya & Rupasinghe, 2011). Moreover, it is reported that oxidation of arginine by iNOS generates NO, a powerful pulmonary vasodilator (Asadollahi et al., 2014). Wideman et al. (1995) suggested supplementation of l‐arginine at levels exceeding those necessary of optimal growth performance is essential as a precursor for NO production in broilers.

Therefore, targeting the inhibition of ACE and stimulation iNOS genes expression appears to be a promising therapeutic strategy for controlling hypertension and, consequently, ascites. Previous studies have demonstrated that flavonoids and proanthocyanidins have ACE inhibitory activities (Balasuriya & Rupasinghe, 2011; Wu et al., 2023) and iNOS stimulatory activities (Asadollahi et al., 2014). For instance, Häckl et al. (2002) investigated the inhibitory effect of quercetin on the ACE activity and results have shown that this flavonoid can have a therapeutic effect similar to captopril (D‐3‐mercapto‐2‐methylpropanoyl‐L‐proline) as an ACE inhibitor (Abd Alla et al., 2013; Häckl et al., 2002). On the other hand, reactive oxygen species have been implicated to induce lipid peroxidation and oxidative stress by depleting antioxidant reserves in tissues, which in turn can increase the outbreak of ascites syndrome (Wideman et al., 1995). The efficacy of vitamin E and plant‐derived flavonoids as free radical scavengers has been well established in numerous researches (Lu et al., 2023; Tang et al., 2023).

It appears that modulating the expression levels of ACE and iNOS could be a promising approach for controlling ascites syndrome. However, based on our knowledge of previous studies on ascites syndrome, limited research has been conducted to evaluate the expression of iNOS, and none has assessed the expression of ACE gene. Therefore, the present study aimed to investigate the effects of two plant extracts, along with l‐arginine and captopril, as modulators of ascites‐related genes expression as well as vitamin E as an antioxidant additive, in broiler chickens exposed to cold stress.

2. MATERIALS AND METHODS

2.1. Plant extract preparation

Sumac (Rhus coriaria) fruit and Syrian mesquite (Prosopis farcta) root were gathered, shade dried and ground. Aqueous acetone 70% (v/v) extraction was performed on each plant material (Kossah et al., 2010) followed by phytochemical analysis of the extracts (sumac and Syrian mesquite, respectively) was performed for detection of total phenolic compounds using the Folin–Ciocalteu method, with concentration of 224.5 mg tannic acid equivalents/g dried extract for sumac and 171.2 mg tannic acid equivalents/g dried extract as described by Lucas et al. (2022). Furthermore, the content of total tannin (44.86% vs. 37.64% of dried extract) and gallic acid (3.32% vs. 5.97% of dried extract) was analysed by the high‐performance liquid chromatography (HPLC) method (Saltan et al., 2019; Silva et al., 2023).

The concentration of total flavonoid compounds was determined using the colorimetric method as described by Orsavová et al. (2023), with concentration of 45.82 vs. 63.69 mg quercetin equivalents/g dried extract. Additionally, the concentrations of the specific flavonoids, including luteolin (22.45% vs. 10.93% of dried extract), apigenin (1.72% vs. 5.64% of dried extract), rutin (8.29% vs. 14.38% of dried extract) and quercetin (38.51% vs. 50.24% of dried extract), were individually assessed using the HPLC method (Mehrdad et al., 2009; Permana et al., 2023).

2.2. Birds and diets

A total of 450 one‐day‐old male Ross 308 chicks were randomly allocated to six dietary treatments, with each treatment having five replicate pens and each pen containing 15 chicks. The average initial body weight of chicks per pen was 44 g. The experimental period spanned 28 days and was divided into a starter phase (days 0–10) and a grower phases (days 11–28). During the first 3 days of trial, the room temperature was maintained at 32°C. Subsequently, the temperature gradually decreased to 14°C by the 21st day of the experiment with a reduction of one degree per day facilitated by a thermostat. The temperature remained constant at 14°C until day 28 (Wang et al., 2018). The chicks were reared in floor pens (2 × 1 × 1.2 m3), and the lighting schedule was implemented as follows: 24 h of light per day for the initial 3 days, which was then reduced to 18 h of light and 6 h of darkness.

The diets were formulated to meet the nutrient recommendation outlined in the Ross 308 manual. From the first day, the chicks were fed through a basal diet based on corn and soybean meal (as control) or the basal diet supplemented with specific additives. These additives included hydroalcoholic extract of sumac (HES, 200 mg/kg), hydroalcoholic extract of Syrian mesquite (HEM, 200 mg/kg), l‐arginine (40% above requirement (Ghamari Monavvar et al., 2020; Zampiga et al., 2019)), vitamin E (100 mg/kg) and captopril (15 mg/kg), respectively. Both water and mash feed were provided ad libitum. Table 1 presents the ingredients and chemical compositions of basal diets.

TABLE 1.

Ingredients and chemical compositions of the basal diets.

Basal diet
Item Starter (days 0–10) Grower (days 11–28)
Ingredients, %
Corn 59.19 64.55
Soybean meal, 48% CP 35.24 29.86
Corn oil 1.14 1.72
dl‐methionine 0.39 0.29
l‐lysine HCl 0.36 0.21
Vitamin‐mineral premix a 0.5 0.5
Dicalcium phosphate 1.97 1.74
Limestone 0.87 0.79
Common salt 0.34 0.34
Calculated composition (%, unless otherwise stated)
ME (Kcal/kg) 2900 3000
CP 21.20 19.05
Lys 1.39 1.14
Met 0.71 0.59
Met + Cys 1.05 0.90
Calcium 0.96 0.86
Available phosphorus 0.48 0.43
Sodium 0.15 0.15
Open in a new tab
a

Supplied per kilogram diet: vitamin A, 9000 IU; vitamin D3, 2000 IU; vitamin E, 18 IU; vitamin K3, 2 mg; riboflavin, 6.6 mg; pantothenic acid, 10 mg; pyridoxine, 3 mg; folic acid, 1 mg; thiamin, 1.8 mg; B12, 15 μg; biotin, 0.1 mg; niacin, 30 mg; choline, 500 mg; Se, 0.2 mg; I, 1 mg; Cu, 10 mg; Fe, 50 mg; Zn, 85 mg; Mn, 100 mg.

2.3. Growth performance

At the ages of 7, 14, 21 and 28 days, following an 8 h feed withdrawal period, broiler chickens in each pen were weighed, and weekly feed consumption was measured (per pen basis) to calculate average daily gain (ADG), average daily feed intake (ADFI) and feed efficiency (FE).The performance data were adjusted for any mortalities monitored throughout the experiment. Clinical signs and mortalities related to ascites were closely monitored throughout the experiment. Additionally, all deceased birds during the rearing period were dissected to diagnose ascites.

2.4. Ascites‐related parameters

At the end of the experiment (day 28 of age), three randomly selected birds were chosen from each pen (Total n = 15/treatment) to measure systolic blood pressure (SBP) using the brachial artery via the Lichtenberger method (Lichtenberger, 2005), with a sphygmomanometer (Riester, no. 1440 Babyphon), pediatric cuff (Nylon‐Velcyro, infant circumference 7.5–13 cm), ultrasound transmission gel (Polygel) and vascular flow detector (SONICAID, BV102R) equipped with a 5.5 MHz probe. Subsequently, 4 mL blood samples were collected from the wing vein of these birds using heparinized syringes (Zhejiang Oujian Medical Apparatus Co., Ltd.). The blood samples were carefully sucked in to microhaematocrit capillary tubes and then centrifuged at 15,500 × g for 5 min to determine the packed cell volume (PCV) percentage (Rajani et al., 2011).

In addition, whole blood samples were diluted 1:200 in Natt and Herrick's solution, and then red blood cells (RBCs) were counted using a haemocytometer chamber (Maxwell et al., 1986). Erythrocyte osmotic fragility (EOF), considered a criterion for RBC membrane fluidity, was measured in whole bloods samples using Dacie's method (Buffenstein et al., 2001), with slight modifications and a microplate reader (Awareness Technology Inc., Stat Fax 3200). Subsequently, the birds were slaughtered, and their hearts were removed. Major vessels, pericardium, atria and fat were excised using a laboratory scissor. The left and right ventricles (LV, RV) were separated, and their individual weights were measured using an analytical balance (Scaltec SBA41; precision 10–3 g). The ratio of RV to total ventricular (TV) weight (RV:TV, where TV = LV + RV) was calculated (Guo et al., 2023).

2.5. Ascites‐related genes expression in lung tissue

2.5.1. RNA and cDNA preparation

Following the experiment (day 28 of age), two birds per pen (n = 10/treatment) were randomly selected and slaughtered. Subsequently, the total RNA was extracted from each of the lung tissue samples and isolated (100 mg/each sample) using TRIzol reagent (Invitrogen Gibco‐BRL), based on the manufacturer's protocol. To enhance RNA purity, any remaining DNA was digested by DNAase I enzyme (Fermentas, Thermo Fisher Scientific). The purity and concentration of RNA samples were determined by measuring the optical density at 260 nm and calculating the OD260/OD280 ratio using a spectrophotometer (Genova MK3 UV/visible spectrophotometer, Jenway Ltd.). The calculated ratio for the extracted samples fell within the range of 1.95–2.05, indicating satisfactory RNA purity. All samples were subsequently stored in a −80°C freezer until further analysis.

The next step involved the reverse transcription of the total RNA into a single stranded complementary DNA (cDNA) synthesis using M‐MuLV Reverse Transcriptase enzyme (Vivantis) following the manufacturer's instructions. The reactions were carried out under the following conditions: 65°C for 5 min for mRNA denaturation, 42°C for 60 min for cDNA synthesis and 85°C for 5 min for enzyme inactivation. Subsequently, the solutions were chilled on ice and briefly centrifuged to collect the content. Finally, the synthesized cDNA products were stored at −20°C for subsequent use in real‐time PCR analysis (El‐Shobokshy et al., 2024).

2.5.2. Real‐time PCR of selected genes

A relative quantitative real‐time PCR technique was employed to quantitatively detect gene expression levels of ACE, iNOS, Cu/Zn‐superoxide dismutase (Cu/Zn‐SOD) and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH). Primer pairs for the relevant genes were designed using Allele ID v7.5 software and the specificity of the primers regarding their binding to the cDNA template was ensured through the primer BLAST procedure (Table 2). All reactions were carried out in 25‐μL volumes in triplicate using MiniOpticon system (Bio‐Rad Laboratories, Inc.). Each reaction mixture contained 1–2 μL cDNA, 0.5–1 μL per each primer pairs (forward and reverse; 10 μmol/μL), 7.0 μL ddH2O, 2.5 μL 5 × HQ buffer and 12.5 μL 2 × PCR Mix (Power SYBR Green PCR Master Mix, Applied Biosystems). The PCR cycling conditions began with an initial denaturation step at 95°C for 10 min, followed by 40 cycles of denaturing at 95°C for 10 s, and annealing/extending at 60°C for 1 min. Melting curve analysis and running the amplicons on agarose gels (in contrast to 100 bp DNA ladder marker; Promega) were performed to the determine the specificity of each PCR product. Negative controls (water replacing DNA) were also included on the agarose gel. Finally, the relative mRNA expression levels for the target genes were calculated using the 2−ΔΔCt method, where ΔΔCT represents the subtraction of [CTgene – CTGAPDH](Sample) from [CTgene – CTGAPDH](Control) (Pasri et al., 2024).

TABLE 2.

Specific primers used for real‐time PCR.

Genes Primer sequence (5′–3′) Serial number Product size (bp)
ACE F: GTCCCATTCCTGCTCACTTG NM_001167732.1 130
R: GTCCAGCCCTGTTGTTTCAT
iNOS F: AGTTTGAAATCCAGTCGTGTTA NM_204961.1 86
R: ATATGTTCTCCAGGCAGGTA
Cu/Zn‐SOD F: CGCAGGTGCTCACTTTAATCC NM_205064.1 89
R: CAGTCACATTGCCGAGGTCA
GAPDH F: GGAGAAACCAGCCAAGTATGAT NM_204305.1 119
R: CACCATTGAAGTCACAGGAGA
Open in a new tab

Abbreviations: ACE, angiotensin converting enzyme; Cu/Zn‐SOD, Cu/Zn superoxide dismutase; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; iNOS, inducible nitric oxide synthase.

2.6. Statistical analysis

The data were analysed using one‐way ANOVA through PROC GLM procedure (SAS Institute, 2002) as a completely randomized design experiment. Pen was considered the experimental unit for performance parameters, whereas the average of three birds in each pen served as the experimental unit for SBP, PCV, RBCs, EOF, RV:TV ratio and gene expression parameters. Following ANOVA, Duncan's multiple comparison test was conducted to assess the difference between the treatment means, and statistical significance was declared at a significance level of p ≤ 0.05.

3. RESULTS

3.1. Growth performance

The results of presented in Table 3 indicate that ADFI and FE were not significantly affected by the inclusion of the feed additive in the diet. However, ADG during days 8–14 of age showed significant increase when HEM, HES, l‐arginine and vitamin E were added to the broiler diets (p < 0.05). This trend persisted throughout the entire experimental period, except with HES. Additionally, the mortality rate significantly decreased with the supplementation of feed additive.

TABLE 3.

Effect of experimental treatments on performance of broiler chickens challenged with cold stress.

Treatments 1 Statistical parameters
Items Control HES HEM Arginine Captopril Vitamin E SEM 2 p‐value
ADG (g)
0–7 days 23.32 23.71 23.82 23.69 22.52 23.07 0.467 0.366
8–14 days 33.49b 37.97a 39.36a 38.85a 37.00ab 37.25a 1.213 0.033
15–21 days 54.49 58.38 60.26 60.90 59.12 59.75 2.535 0.550
22–28 days 70.89 73.66 77.24 76.84 71.35 77.80 3.427 0.569
0–28 days 45.55b 48.43ab 50.17a 50.07a 47.54ab 49.46a 1.061 0.039
ADFI (g)
0–7 days 24.27 23.74 24.04 22.60 22.80 22.83 0.514 0.106
8–14 days 54.53 60.98 59.01 58.40 60.35 56.32 2.458 0.442
15–21 days 106.26 110.94 111.50 114.03 105.32 109.67 5.220 0.844
22–28 days 157.10 158.73 161.13 166.73 154.39 164.13 6.475 0.775
0–28 days 85.54 88.60 88.92 90.44 85.72 88.21 2.592 0.739
FE (g/g)
0–7 days 0.966 1.000 0.994 0.990 1.046 1.016 0.027 0.433
8–14 days 0.616 0.626 0.670 0.614 0.666 0.664 0.018 0.088
15–21 days 0.528 0.530 0.548 0.578 0.542 0.548 0.047 0.978
22–28 days 0.458 0.464 0.484 0.466 0.470 0.478 0.032 0.993
0–28 days 0.534 0.548 0.564 0.554 0.560 0.562 0.022 0.935
Mortality (%) 17.33(13/75)a 6.67(5/75)b 5.33(4/75)b 8.00(6/75)b 6.67(5/75)b 9.33(7/75)b 2.582 0.037
Open in a new tab

Note: Means within a row without common superscript a–b are significantly different at the level p < 0.05.

Abbreviations: ADFI, average daily feed intake; ADG, average daily body weight gain; FE, feed efficiency; HES, hydroalcoholic extract sumac; HEM, hydroalcoholic extract of Syrian mesquite.

1

Control, basal diet; HES and HEM, basal diet supplemented with hydroalcoholic extract of sumac or Syrian mesquite at a level of 200 mg/kg diet, respectively; arginine, basal diet supplemented with l‐arginine at level 40% more than requirement; vitamin E, basal diet supplemented with α‐tocopherol at level 100 mg/kg diet; and captopril, basal diet supplemented with (l captopril tablets at level 15 mg/kg diet.

2

Standard error of the means.

3.2. Ascites‐related parameters

As shown in Table 4, the findings of this study revealed that supplementing with feed additive did not significant influence on RBCs and EOF; however, PCV, RV:TV and SBP were significantly decreased in groups treated with feed additive. Moreover, birds fed diets containing HEM and captopril exhibited a lower RV:TV compared to those fed the l‐arginine (p < 0.05). Additionally, in contrast to vitamin E, the inclusion of HEM in the diet resulted in lower SBP in broilers (p < 0.05).

TABLE 4.

Effect of experimental treatments on parameters related to haematology and ascites in broiler chickens challenged with cold stress.

Treatments 1 Statistical parameters
Items Control HES HEM Arginine Captopril Vitamin E SEM 2 p‐value
RBCs (×106/μL) 3.52 3.32 3.40 3.31 3.25 3.17 0.113 0.379
PCV (%) 37.63a 32.38b 34.25b 31.25b 33.38b 33.88b 1.043 0.003
EOF (%) 17.89 17.15 16.32 18.20 16.92 15.45 1.072 0.501
RV:TV 0.29a 0.24bc 0.22c 0.25b 0.21c 0.23bc 0.008 >0.001
SBP (mmHg) 188a 142bc 122c 146bc 130bc 160b 9.557 >0.001
Open in a new tab

Note: Means within a row without common superscript a–c are significantly different at the level p < 0.05.

Abbreviations: EOF, erythrocyte osmotic fragility; HES, hydroalcoholic extract sumac; HEM, hydroalcoholic extract of Syrian mesquite; PCV, packed cell volume; RBCs, red blood cells; RV:TV, right ventricle:total ventricle; SBP, systolic blood pressure.

1

Control, basal diet; HES and HEM, basal diet supplemented with hydroalcoholic extract of sumac or Syrian mesquite at a level of 200 mg/kg diet, respectively; arginine, basal diet supplemented with l‐arginine at level 40% more than requirement; vitamin E, basal diet supplemented with α‐tocopherol at level 100 mg/kg diet; and captopril, basal diet supplemented with captopril tablets at level 15 mg/kg.

2

Standard error of the means.

3.3. Ascites‐related genes expression in lung tissue

The results of gene expression analysis (Figure 1a–c) indicate that the inclusion of HES, HEM and captopril in the diet led to a reduction in the expression level of the ACE in the lungs of broiler chickens (p < 0.05; Figure 1a). Furthermore, broilers fed vitamin E exhibited a lower ACE mRNA level in lung tissue compared to those fed l‐arginine (p < 0.05). Moreover, the mRNA level of iNOS experienced a significant increase with the addition of HEM and l‐arginine, compared to other treatments (p < 0.05; Figure 1b). Although no statistically significant difference was observed between the control, HES, vitamin E and captopril, supplementing the diet with captopril resulted in a higher mRNA level of iNOS compared with HES and vitamin E (p < 0.05). In term of Cu/Zn‐SOD expression, the feed additives were found to increase the mRNA level in lung tissue, except for captopril (p < 0.05; Figure 1c).

FIGURE 1.

FIGURE 1

Open in a new tab

Effect of experimental treatments on ascites‐related genes expression in lung tissue of broiler chickens: (a) angiotensin converting enzyme (ACE; SEM = 0.073; p‐value = 0.003), (b) inducible nitric oxide synthase (iNOS; SEM = 0.109; p‐value < 0.001), and (c) Cu/Zn superoxide dismutase (Cu/Zn‐SOD; SEM = 0.090; p‐value < 0.001). Control, basal diet; hydroalcoholic extracts of sumac (HES) and hydroalcoholic extract of Syrian mesquite (HEM), basal diet supplemented with hydroalcoholic extract of sumac or Syrian mesquite at a level of 200 mg/kg diet, respectively; arginine, basal diet supplemented with l‐arginine at level 40% more than requirement; vitamin E, basal diet supplemented with α‐tocopherol at level 100 mg/kg diet; and captopril, basal diet supplemented with captopril tablets at level 15 mg/kg.

4. DISCUSSION

The increased ADG observed in birds fed the diet supplemented with HEM and HES can be attributed to antimicrobial activities of secondary metabolites present in these products such as flavonoids and tannins. This finding aligns with the result of study conducted by Hashemi et al. (2012), which reported that supplementing the basal diet with Euphorbia hirta plant may lead to an increase in the ADG in broiler. E. hirta plant contains significant quantities of flavonoids and phenolic compounds, including quercetin and gallic acid (Bigoniya et al., 2013) with antibacterial activities (Rayne & Mazza, 2007), similar to the components isolated from the two plant extracts used in the current study. Plant extracts are known to have a potent effect on reducing enteropathogens (Manso et al., 2021; Rayne & Mazza, 2007; Singh et al., 2023). The reduction in enteropathogenic bacteria leads to beneficial alterations in intestinal mucosal architecture, resulting in increased in digestibility of ileal nutrients and, consequently, increased body weight (Sarrami et al., 2022).

Additionally, the improvements in ADG observed with l‐arginine supplementation may be attributed to enhancements in intestinal histomorphology. Khajali et al. (2014) reported that supplementing broiler diet with l‐arginine results in improvements in the structure of the intestinal brush border such as increased villi height and width. These changes can enhance digestibility, consequently improving broiler performance. Moreover, administrating arginine as in ovo has been shown to improve jejunal digestive and absorptive activities in neonatal turkey poults (Foye et al., 2007). Indeed, alterations in gut histomorphology can be linked to changes in the composition of the gut microbial (Saki et al., 2017), suggesting that the enhancement of mucosal architecture may be related to the antimicrobial activity of arginine. NO, produced as a result of the oxidation of arginine (Chen et al., 2022), is a potent antimicrobial molecule (Cela et al., 2023; Qi et al., 2023).

Furthermore, the lack of influence of HES on ADG throughout the entire experiment period (days 0–28) may be related to its lower content of total flavonoid compounds compared to HEM (45.82 against 63.69 mg/g of the dried extract, as mentioned earlier). It can be speculated that the secondary metabolites of HES at a 200 mg/kg concentration in the diet were not adequate enough to make significant contact with intestinal microbiota. Therefore, to enhance the performance of broiler chickens with HES as a potential substitute for AGPs in their diets, a higher concentration may be required.

Dietary supplementation of vitamin E significantly increased ADG. Vitamin E acts as a cell membrane antioxidant, protecting the integrity of pulmonary endothelial and other cells by preventing lipid peroxidation of lipoproteins through modulation gene expression involved in lipids metabolism (Englmaierová et al., 2011), It serves as a protective system against oxidative stress (Bautista‐Ortega & Ruiz‐Feria, 2010). Cold stress can induce oxidative stress (Wei et al., 2023) and vitamin E scavenging free radicals (Elgendey et al., 2022). Therefore, due to the fact that birds reared in present study were suffering from cold stress as an oxidative stress model, increased ADG may be as a result of enhancements in the immune system and protection of cell membranes against oxidation caused by free radicals, especially enterocytes, which play an important role in improvement of broiler chickens performance. Furthermore, increased ADG may be because of increased nutrient digestibility, as vitamin E has been reported to increase fat digestibility (Brenes et al., 2008). Furthermore, the decreased mortality rate associated with feed additives could be due to improvements in the cardiovascular system, which will be discussed in more detail later.

As the number of RBCs was not affected by dietary supplementation, the decreased PCV caused by feed additives cannot reasonably be attributed to the reduction of synthesis or the increased degradation of RBCs. Therefore, the significant difference in PCV observed in the treated groups compared to the control is likely due to an increase in the blood viscosity in the control group as a result of plasma leakage into the abdomen cavity. This phenomenon leads to an increase in RBC:plasma ratio, thereby causing the observed difference between broiler chickens fed the control diet and those fed the treated diets. Moreover, as previously reported, the RV:TV ratio was decreased by the treated diets. The reduction in RV:TV ratio may be the result of the feed additives effects on modulating ascites‐related genes expression (such as ACE and iNOS as seen in Figure 1a,b), thereby facilitating blood flow. Consequently, this reduction in blood flow may alleviate the additional burden on the RV and subsequently prevent its hypertrophy.

In addition, the decreased SBP observed in the treated groups may be attributed to reduced blood viscosity compared to the control group, as evidenced by the lower PCV (Table 4). However, it has been shown that diet supplementation with l‐arginine reduces pulmonary arterial pressure and the prevalence of pulmonary hypertension in broiler chickens having exposed to low ambient temperature (Wideman et al., 1995). Mitani et al. (1997) have found that l‐arginine improves chronic pulmonary hypertension and pulmonary vascular remodelling in rats by altering endogenous NO production.

Indeed, NO is a potent pulmonary vasodilator that can significantly reduce pulmonary vascular resistance and thereby prevent the outbreak of pulmonary hypertension (Wideman & Chapman, 2004). Studies have also shown that NO directly decreases pulmonary vascular resistance and modulates the release of serotonin, thromboxane and endothelin‐1 (Bowen et al., 2007; Wideman & Chapman, 2004; Wideman et al., 2006). Therefore, the regulatory effect of NO on blood pressure is likely due to its ability to inhibit the synthesis or release of key vasoconstrictors, including serotonin, thromboxane and endothelin‐1 (Bowen et al., 2007).

Furthermore, another reason for the decreased SBP in broiler chickens fed HEM may be related to the modulation of the ascites‐related genes expression, such as increased iNOS or decreased ACE (as seen in Figure 1a,b). iNOS, through the generation of NO, which is a vasodilator molecule (Liao et al., 2019), and ACE by inhibition of Ang II, a vasoconstrictor peptide hormone (Stoll et al., 2019), can reduce pulmonary arterials resistance against bloodstream and decrease SBP by improving blood flow. Similarly, the reduction in SBP caused by feeding HES and captopril may also be due to a decrease in ACE gene expression. As mentioned earlier, ACE is an enzyme that catalyses the conversion Ang I to Ang II. The latter is a potent vasoconstrictor that can induce hypertension; hence, ACE downregulation can decrease Ang II concentration and consequently lead to a reduction in SBP.

Cold ambient temperatures trigger an elevation in T3 concentration, a hormone crucial for generating additional metabolic heat necessary to uphold body temperature in colder environments. This surge in metabolic rate prompts an elevation in blood pressure as the heart endeavours to supply adequate oxygen to the organs and muscles, ultimately leading to pulmonary hypertension and right ventricular strain (Gupta, 2011).

Cold stress has been shown to induce oxidative stress (Wei et al., 2023), which, alongside lipid peroxidation, has been implicated to induce ascites syndrome. However, antioxidant materials can prevent the outbreak (Rajani et al., 2011). Conversely, oxidative stress has also been implicated in the development of pulmonary hypertension (Poyatos et al., 2023). Therefore, vitamin E, acting as an antioxidant, may help prevent the initiation of oxidative stress by scavenging reactive oxygen species, thus potentially explaining its role in reducing SBP.

Additionally, unlike vitamin E, the inclusion of HEM in the diet resulted in lower SBP in broiler chickens. SBP is evidently one of the most common signs of ascites syndrome. Hence, the reduction in SBP attributed to the inclusion of HEM in the diet could be linked to the heightened efficacy of secondary metabolites of HEM in preventing ascites syndrome. These metabolites not only enhance antioxidant activities by upregulation of Cu/Zn‐SOD gene but also lead to modulation of ACE and iNOS genes. Modulation of ACE and iNOS genes can prevent right ventricular hypertrophy due to ascites syndrome via inhibition of Ang conversion I into Ang II (as a vasoconstrictor) (Stoll et al., 2019) and production of NO as a vasodilator molecule (Liao et al., 2019).

Furthermore, a reduction in erythrocyte deformability has been noted in broiler chickens exposed to experimental salt‐induced ascites syndrome (Gupta, 2011). Therefore, one reason for the ineffectiveness of treatments in our study on EOF may be due to differences in methods of ascites induction. Thus, the use of cold temperature for stimulation of ascites has no significant effect on the fragility of RBCs membrane, unlike common salt induction. The lower RV:TV ratio observed as a result of the diets supplemented with feed additive may be attributed to the reduced SBP (as shown in Table 4), which, in turn, diminishes the additional burden on RV and subsequently reduces hypertrophy.

The results of gene expression revealed that the broilers fed vitamin E exhibited lower ACE mRNA levels in their lung tissue compared to those fed l‐arginine, though the exact cause remains unclear. Additionally, the use of HES, HEM and captopril resulted in a reduction in ACE expression level in lung tissue of broilers compared to control and l‐arginine groups. Studies have shown that the use of plant extracts can decrease ACE gene expression in aortic endothelial cells of rats (Balasuriya & Rupasinghe, 2011). This reduction in ACE gene expression may be related to the presence of flavonoids such as quercetin, rutin and others.

During recent decades, the use of flavonoids as a strategy for regulating hypertension has garnered attention and has been found to be effective as natural ACE inhibitors. Previous researches indicate that the supplementation of flavonoids can inhibit the ACE activity (Balasuriya & Rupasinghe, 2011; Wu et al., 2023). For example, supplementation with quercetin has been shown to lead to a significant decrease in plasma ACE level (Häckl et al., 2002). Moreover, apigenin and luteolin have been found to inhibit the ACE activity in a dose‐dependent manner (Balasuriya & Rupasinghe, 2011). In the present study, feeding flavonoids resulted in a reduction in ACE mRNA levels. Therefore, our results suggest that the reduction in ACE activity caused by plant secondary metabolites may be due to ACE gene downregulation.

In addition to relaxation of pulmonary arteries and consequently a reducting the outbreak of ascites syndrome by decreasing Ang II levels, ACE inhibition can enhance antioxidant capacity as well. It has been reported that ACE inhibition leads to the limitation of vascular NAD(P)H oxidase stimulation, thus preventing increased superoxide flux with the renin‐Ang system activation can be prevented (Münzel & Keaney, 2001). Due to the reaction of superoxide with NO, the inhibition of ACE can enhance the NO bioactivity, and such a prediction has come true among the patients suffering from coronary artery and in a number of experimental models of hypertension (Münzel & Keaney, 2001). This inhibition can enhance NO bioactivity, as superoxide can react with NO, leading to improved blood flow, particularly in pulmonary vessels, and a reduction in additional burden on the RV. Furthermore, since superoxide is a major source of H2O2, ACE inhibitors can limit smooth muscle proliferation (Münzel & Keaney, 2001). Abd Alla et al. (2013) have reported that ACE inhibition can have ROS‐dependent and ROS‐independent anti‐atherogenic influences. Therefore, ACE inhibitors play a pivotal role in reducing the incidence of ascites syndrome.

It has been reported that flavonoids can have both inhibitory and stimulatory effects on NO levels due to their complex interactions with NO synthesis and bioavailability of NO; accordingly, some flavonoids may scavenge NO due to their pro‐oxidant properties by increased production of superoxide (O2 −). However, it has been shown that quercetin, a plant flavonol, is a better scavenger of O2 − compared to NO, particularly under conditions of increased O2 −. Moreover, under oxidative stress circumstances, NO may be also protected from superoxide‐driven inactivation by flavonoids due to their ability to prevent the overexpression of ROS generating enzymes. Furthermore, flavonols, flavones and fava‐3‐ols and their glucuronidated metabolites have been found to be potent O2 − scavengers (Duarte et al., 2014).

Lee et al. (2003) reported that production of NO in cytokine‐stimulated astrocytes can be inhibited by the reduced availability of l‐arginine, which leads to the suppression iNOS expression. Arginine, an essential amino acid, plays a crucial role in various physiological functions in broiler chickens. It is not only necessary for optimal growth but also vital for processes such as NO production, polyamine synthesis, protein biosynthesis, nitrogen transportation and excretion and stimulation of several endocrine glands (Efron & Barbul, 1998, 2000). Additionally, it acts as a significant microbiocidal molecule (Cela et al., 2023; Qi et al., 2023).

Furthermore, unlike the supplementation of HES and vitamin E, including captopril in the diet of broiler chickens led to an increase in the expression of iNOS mRNA. This finding aligns with Baroni et al. (2004), who observed an increase in the NO production and iNOS gene expression in the human keratinocyte cells treated with captopril.

5. CONCLUSION

It can be concluded that supplementing diet with HES and HEM at levels of 200 mg/kg diet can mitigate prevalence of ascites syndrome outbreak in broiler chickens. Moreover, when there is a possibility of ascites syndrome outbreak in broiler chickens, l‐arginine (40% above requirement), vitamin E (100 mg/kg diet) and captopril (15 mg/kg diet) can be added to the diet to deal with this disease.

AUTHOR CONTRIBUTIONS

Conceptualization; Investigation; Project administration; Resources; Writing—original draft: Hassan Shirzadi. Project administration; Supervision; Validation; Visualization; Writing—review and editing: Farid Shariatmadari. Methodology; Project administration; Supervision; Validation; Visualization:Mohammad Amir Karimi‐Torshizi. Data curation; Software: Ali Akbar Masoudi. Formal analysis; Validation; Visualization; Writing—review and editing: Shaban Rahimi. Software; Validation; Visualization: Fakhredin Saba. Data curation; Formal analysis: Gholamreza Zaboli. Formal analysis; Software: Nemat Hedayat‐Evrigh.

CONFLICT OF INTEREST STATEMENT

The authors declare that there are no financial or personal conflicts of interest about this study.

ETHICS STATEMENT

The whole animal procedure was confirmed by the Animal Ethics Committee of Tarbiat Modares University, Tehran, Iran (Approval ID: IR.MODARES.AEC.1391.048).

AUTHOR DECLARATIONS

All authors are either employed by, or associated with, a government agency or university, whose primary function is research and education.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.1542.

ACKNOWLEDGEMENTS

This study was partly supported by training grants from Tarbiat Modares University, Tehran, Iran. We greatly appreciate Vice‐Chancellor for Research Affairs, Tarbiat Modares University for financial supporting this project by grant number 8930182003.

Shirzadi, H. , Shariatmadari, F. , Karimi‐Torshizi, M. A. , Masoudi, A. A. , Rahimi, S. , Saba, F. , Zaboli, G. , & Hedayat‐Evrigh, N. (2024). Diets containing phytobiotics, l‐arginine, vitamin E and captopril modulate ascites syndrome‐related genes expression in broiler chickens exposed to low ambient temperature. Veterinary Medicine and Science, 10, e1542. 10.1002/vms3.1542

PLANT COLLECTION:

Sumac (Rhus coriaria) fruit and Syrian mesquite (Prosopis farcta) root samples were gathered in August from Shazand (Markazi province, Iran; latitude: 33°48′49.54″N; longitude: 49°19′43.71″E; altitude: 2278 m) and Gilan‐e Gharb (Kermanshah province, Iran; latitude: 34°05′00.02″N; longitude: 45°53′57.05″E; altitude: 939 m) countryside, respectively.

DATA AVAILABILITY STATEMENT

The data that supports the findings of this study are available on the request of readers via the email address provided.

REFERENCES

  1. Abd Alla, J. , el Faramawy, Y. , & Quitterer, U. (2013). Microarray gene expression profiling reveals antioxidant‐like effects of angiotensin II inhibition in atherosclerosis. Frontiers in Physiology, 4, 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Asadollahi, A. , Sarir, H. , Omidi, A. , & Torbati, M. B. M. (2014). Hepatoprotective potential of Prosopis farcta beans extracts against acetaminophen induced hepatotoxicity in Wistar Rats. International Journal of Preventive Medicine, 5, 1281–1285. [PMC free article] [PubMed] [Google Scholar]
  3. Balasuriya, B. W. N. , & Rupasinghe, H. P. V. (2011). Plant flavonoids as angiotensin converting enzyme inhibitors in regulation of hypertension. Functional Foods in Health and Disease, 5, 172–188. [Google Scholar]
  4. Baroni, A. , Buommino, E. , Paoletti, I. , Orlando, M. , Ruocco, E. , & Ruocco, V. (2004). Pemphigus serum and captopril induce heat shock protein 70 and inducible nitric oxide synthase overexpression, triggering apoptosis in human keratinocytes. British Journal of Dermatology, 150, 1070–1080. [DOI] [PubMed] [Google Scholar]
  5. Bautista‐Ortega, J. , & Ruiz‐Feria, C. A. (2010). l‐Arginine and antioxidant vitamins E and C improve the cardiovascular performance of broiler chickens grown under chronic hypobaric hypoxia. Poultry Science, 89, 2141–2146. [DOI] [PubMed] [Google Scholar]
  6. Bigoniya, P. , Agrawal, S. , & Verma, N. K. (2013). Potential wound healing activity of Euphorbia hirta Linn total flavonoid fraction. International Journal of Pharmaceutical Sciences Review and Research, 22, 149–156. [Google Scholar]
  7. Bowen, O. T. , Erf, G. F. , Chapman, M. E. , & Wideman, R. F. Jr. (2007). Plasma nitric oxide concentrations in broilers after intravenous injections of lipopolysaccharide or microparticles. Poultry Science, 86, 2550–2554. [DOI] [PubMed] [Google Scholar]
  8. Brenes, A. , Viveros, A. , Goñí, I. , Centeno, C. , Sayago‐Ayerdy, S. G. , Arija, I. , & Saura‐Calixto, F. (2008). Effect of grape pomace concentrate and vitamin E on digestibility of polyphenols and antioxidant activity in chickens. Poultry Science, 87, 307–316. [DOI] [PubMed] [Google Scholar]
  9. Buffenstein, R. , McCarron, H. C. K. , & Dawson, T. J. (2001). Erythrocyte osmotic fragility of red (Macropus rufus) and grey (Macropus fuliginosus and Macropus giganteus) kangaroos and free‐ranging sheep of the arid regions of Australia. Journal of Comparative Physiology B, 171, 41–47. [DOI] [PubMed] [Google Scholar]
  10. Cela, E. M. , Urquiza, D. , Gómez, M. I. , & Gonzalez, C. D. (2023). New weapons to fight against Staphylococcus aureus skin infections. Antibiotics, 12, 1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen, J. , Liu, L. , Wang, W. , & Gao, H. (2022). Nitric oxide, nitric oxide formers and their physiological impacts in bacteria. International Journal of Molecular Sciences, 23, 10778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Closter, A. M. , Van As, P. , Groenen, M. A. M. , Vereijken, A. L. J. , Van Arendonk, J. A. M. , & Bovenhuis, H. (2009). Genetic and phenotypic relationships between blood gas parameters and ascites‐related traits in broilers. Poultry Science, 88, 483–490. [DOI] [PubMed] [Google Scholar]
  13. Duarte, J. , Francisco, V. , & Perez‐Vizcaino, F. (2014). Modulation of nitric oxide by flavonoids. Food and Function, 5, 1653–1668. [DOI] [PubMed] [Google Scholar]
  14. Efron, D. T. , & Barbul, A. (1998). Modulation of inflammation and immunity by arginine supplements. Current Opinion in Clinical Nutrition and Metabolic Care, 1, 531–538. [DOI] [PubMed] [Google Scholar]
  15. Efron, D. T. , & Barbul, A. (2000). Role of arginine in immunonutrition. Journal of Gastroenterology, 35, 20–23. [PubMed] [Google Scholar]
  16. El‐Shobokshy, S. A. , Abo‐Samaha, M. I. , Khafaga, A. F. , Fakiha, K. G. , Khatab, S. A. , Abdelmaksoud, E. M. , Khalek Soltan, M. A. , Othman, S. I. , Rudayni, H. A. , & Allam, A. A. (2024). The beneficial effect of nanomethionine supplementation on growth performance, gene expression profile, and histopathology of heat‐stressed broiler chicken. Poultry Science, 103, 103206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Elgendey, F. , Al Wakeel, R. A. , Hemeda, S. A. , Elshwash, A. M. , Fadl, S. E. , Abdelazim, A. M. , Alhujaily, M. , & Khalifa, O. A. (2022). Selenium and/or vitamin E upregulate the antioxidant gene expression and parameters in broilers. BMC Veterinary Research, 18, 310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Englmaierová, M. , Bubancová, I. , Vít, T. , & Skrivan, M. (2011). The effect of lycopene and vitamin E on growth performance, quality and oxidative stability of chicken leg meat. Czech Journal of Animal Science, 56, 536–543. [Google Scholar]
  19. Foye, O. T. , Ferket, P. R. , & Uni, Z. (2007). The effects of in ovo feeding arginine, β‐hydroxy‐β‐methyl‐butyrate, and protein on jejunal digestive and absorptive activity in embryonic and neonatal Turkey poults. Poultry Science, 86, 2343–2349. [DOI] [PubMed] [Google Scholar]
  20. Ghamari Monavvar, H. , Moghaddam, G. , & Ebrahimi, M. (2020). A review on the effect of arginine on growth performance, meat quality, intestine morphology, and immune system of broiler chickens. Iranian Journal of Applied Animal Science, 10, 587–594. [Google Scholar]
  21. Guo, D. , Zhang, J. , Han, Y. , Cui, L. , Wang, H. , Wang, K. , Li, P. , Deng, R. , Kang, J. , & Duan, Z. (2023). Transcriptomic study on the lungs of broilers with ascites syndrome. Animals, 13, 175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gupta, A. R. (2011). Ascites syndrome in poultry: A review. World's Poultry Science Journal, 67, 457–468. [Google Scholar]
  23. Häckl, L. P. N. , Cuttle, G. , Sanches Dovichi, S. , Lima‐Landman, M. T. , & Nicolau, M. (2002). Inhibition of angiotensin‐converting enzyme by quercetin alters the vascular response to bradykinin and angiotensin I. Pharmacology, 65, 182–186. [DOI] [PubMed] [Google Scholar]
  24. Hashemi, S. R. , Zulkifli, I. , Davoodi, H. , Zunita, Z. , & Ebrahimi, M. (2012). Growth performance, intestinal microflora, plasma fatty acid profile in broiler chickens fed herbal plant (Euphorbia hirta) and mix of acidifiers. Animal Feed Science and Technology, 178, 167–174. [Google Scholar]
  25. Khajali, F. , Moghaddam, M. H. , & Hassanpour, H. (2014). An l‐Arginine supplement improves broiler hypertensive response and gut function in broiler chickens reared at high altitude. International Journal of Biometeorology, 58, 1175–1179. [DOI] [PubMed] [Google Scholar]
  26. Kossah, R. , Nsabimana, C. , Zhang, H. , & Chen, W. (2010). Optimization of extraction of polyphenols from Syrian sumac (Rhus coriaria L.) and Chinese sumac (Rhus typhina L.) fruits. Research Journal of Phytochemistry, 4, 146–153. [Google Scholar]
  27. Lee, J. , Ryu, H. , Ferrante, R. J. , Morris, S. M. , & Ratan, R. R. (2003). Translational control of inducible nitric oxide synthase expression by arginine can explain the arginine paradox. Proceedings of the National Academy of Sciences, 100, 4843–4848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Leeson, S. (2007). Metabolic challenges: Past, present, and future. The Journal of Applied Poultry Research, 16, 121–125. [Google Scholar]
  29. Liao, W. , Ye, T. , & Liu, H. (2019). Prognostic value of inducible nitric oxide synthase (iNOS) in human cancer: A systematic review and meta‐analysis. BioMed Research International, 2019, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lichtenberger, M. (2005). Determination of indirect blood pressure in the companion bird. Seminars in Avian and Exotic Pet Medicine, 14, 149–152. [Google Scholar]
  31. Lu, X.‐Q. , Qin, S. , & Li, J. (2023). Radical scavenging capability and mechanism of three isoflavonoids extracted from radix Astragali: A theoretical study. Molecules, 28, 5039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lucas, B. N. , Nora, D. , Boeira, C. P. , & Verruck, S. (2022). Determination of total phenolic compounds in plant extracts via Folin–Ciocalteu's method adapted to the usage of digital images. Food Science and Technology, 42, e35122. [Google Scholar]
  33. Manso, T. , Lores, M. , & de Miguel, T. (2021). Antimicrobial activity of polyphenols and natural polyphenolic extracts on clinical isolates. Antibiotics, 11, 46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Maxwell, M. H. , Robertson, G. W. , & Spence, S. (1986). Studies on an ascitic syndrome in young broilers 1. Haematology and pathology. Avian Pathology, 15, 511–524. [DOI] [PubMed] [Google Scholar]
  35. Mehrdad, M. , Zebardast, M. , Abedi, G. , Koupaei, M. N. , Rasouli, H. , & Talebi, M. (2009). Validated high‐throughput HPLC method for the analysis of flavonol aglycones myricetin, quercetin, and kaempferol in Rhus coriaria L. Using a monolithic column. Journal of AOAC International, 92, 1035–1043. [PubMed] [Google Scholar]
  36. Mitani, Y. , Maruyama, K. , & Sakurai, M. (1997). Prolonged administration of l‐arginine ameliorates chronic pulmonary hypertension and pulmonary vascular remodeling in rats. Circulation, 96, 689–697. [PubMed] [Google Scholar]
  37. Münzel, T. , & Keaney, J. F. (2001). Are ACE inhibitors a “magic bullet” against oxidative stress? Circulation, 104, 1571–1574. [DOI] [PubMed] [Google Scholar]
  38. Orsavová, J. , Juríková, T. , Bednaříková, R. , & Mlček, J. (2023). Total phenolic and total flavonoid content, individual phenolic compounds and antioxidant activity in sweet rowanberry cultivars. Antioxidants, 12, 913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pasri, P. , Rakngam, S. , Gérard, N. , Mermillod, P. , & Khempaka, S. (2024). Synthetic and phytogenic antioxidants improve productive performance, antioxidant activity, gene expression, and offspring quality in breeder hens subjected to heat stress. Poultry Science, 103, 103390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Permana, A. D. , Maddeppungeng, N. M. , Asma, N. , Rahim, A. , Nainu, F. , Bahar, M. A. , & Yulianty, R. (2023). Validation of HPLC‐UV method for simultaneous determination of quercetin and luteolin from Carthamus tinctorius L in solid lipid nanoparticles incorporated in floating gel in situ formulation. Microchemical Journal, 194, 109373. [Google Scholar]
  41. Poyatos, P. , Gratacós, M. , Samuel, K. , Orriols, R. , & Tura‐Ceide, O. (2023). Oxidative stress and antioxidant therapy in pulmonary hypertension. Antioxidants, 12, 1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Qi, C. , Chen, J. , Zhuang, Y. , Zhang, Y. , Zhang, Q. , & Tu, J. (2023). PHMB modified photothermally triggered nitric oxide release nanoplatform for precise synergistic therapy of wound bacterial infections. International Journal of Pharmaceutics, 640, 123014. [DOI] [PubMed] [Google Scholar]
  43. Rajani, J. , Karimi‐Torshizi, M. A. , & Rahimi, S. (2011). Control of ascites mortality and improved performance and meat shelf‐life in broilers using feed adjuncts with presumed antioxidant activity. Animal Feed Science and Technology, 170, 239–245. [Google Scholar]
  44. Rama, E. N. , Bailey, M. , Kumar, S. , Leone, C. , den Bakker, H. C. , Thippareddi, H. , & Singh, M. (2022). Prevalence and antimicrobial resistance of Salmonella in conventional and no antibiotics ever broiler farms in the United States. Food Control, 135, 108738. [DOI] [PubMed] [Google Scholar]
  45. Rayne, S. , & Mazza, G. (2007). Biological activities of extracts from sumac (Rhus spp.): A review. Plant Foods for Human Nutrition, 62, 165–175. [DOI] [PubMed] [Google Scholar]
  46. Saki, A. A. , Ala, F. S. , Zamani, P. , Alipour, D. , & Abbasinezhad, M. (2017). Japanese quail performance, intestinal microflora, and molecular responses to screened wheat and multienzyme diet. Turkish Journal of Veterinary and Animal Sciences, 41, 30–37. [Google Scholar]
  47. Saltan, F. Z. , Canbay, H. S. , Üvez, A. , Konak, M. , & Armutak, E. İ. (2019). Quantitative determination of tannic acid in Quercus species by high performance liquid chromatography. FABAD Journal of Pharmaceutical Sciences, 44, 197–203. [Google Scholar]
  48. Sarrami, Z. , Sedghi, M. , Mohammadi, I. , Kim, W. K. , & Mahdavi, A. H. (2022). Effects of bacteriophage supplement on the growth performance, microbial population, and PGC‐1α and TLR4 gene expressions of broiler chickens. Scientific Reports, 12, 14391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. SAS Institute . (2002). SAS user's guide. Version 9.1 (4th ed.). SAS Inst. Inc. [Google Scholar]
  50. Sijun, Y. , Dingzong, G. , & Baoan, Y. (2002). Histopathology of the lymphatic system in ascitic broilers. Veterinarni Medicina‐Praha‐, 47, 264–269. [Google Scholar]
  51. Silva, L. S. , Oliveira, M. G. , Martins, C. F. , Borges, L. L. , Fiuza, T. S. , Conceição, E. C. , & Paula, J. R. (2023). Validation HPLC‐DAD method for quantification of gallic and ellagic acid from Eugenia punicifolia leaves, extracts and fractions. Journal of the Brazilian Chemical Society, 34, 401–413. [Google Scholar]
  52. Singh, A. A. , Naaz, Z. T. , Rakaseta, E. , Perera, M. , Singh, V. , Cheung, W. , Mani, F. , & Nath, S. (2023). Antimicrobial activity of selected plant extracts against common food borne pathogenic bacteria. Food and Humanity, 1, 64–70. [Google Scholar]
  53. Stoll, D. , Yokota, R. , Sanches Aragão, D. , & Casarini, D. E. (2019). Both aldosterone and spironolactone can modulate the intracellular ACE/ANG II/AT1 and ACE2/ANG (1–7)/MAS receptor axes in human mesangial cells. Physiological Reports, 7, 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tang, J. , Zhang, C. , Jiang, L. , Chen, D. , Jiang, P. , & Huang, B. (2023). Effects of vitamin E on immune response, antioxidant capacity, and liver tissue structure of crucian carp under acute cold stress. Aquaculture Research, 2023, 1–12. [Google Scholar]
  55. Wang, J. , Yang, G. , Zhang, K. , Ding, X. , Bai, S. , & Zeng, Q. (2018). Effects of dietary supplementation of DL‐2‐hydroxy‐4 (methylthio) butanoic acid on antioxidant capacity and its related gene expression in lung and liver of broilers exposed to low temperature. Poultry Science, 98, 341–349. [DOI] [PubMed] [Google Scholar]
  56. Wei, H. , Li, T. , Zhang, Y. , Liu, X. , Gong, R. , Bao, J. , & Li, J. (2023). Cold stimulation causes oxidative stress, inflammatory response and apoptosis in broiler heart via regulating Nrf2/HO‐1 and NF‐κB pathway. Journal of Thermal Biology, 116, 103658. [DOI] [PubMed] [Google Scholar]
  57. Wideman, R. F. , Bowen, O. T. , Erf, G. F. , & Chapman, M. E. (2006). Influence of aminoguanidine, an inhibitor of inducible nitric oxide synthase, on the pulmonary hypertensive response to microparticle injections in broilers. Poultry Science, 85, 511–527. [DOI] [PubMed] [Google Scholar]
  58. Wideman, R. F. , & Chapman, M. E. (2004). Nω‐nitro‐l‐arginine methyl ester (L‐NAME) amplifies the pulmonary hypertensive response to endotoxin in broilers. Poultry Science, 83, 485–494. [DOI] [PubMed] [Google Scholar]
  59. Wideman, R. F. , Kirby, Y. K. , Ismail, M. , Bottje, W. G. , Moore, R. W. , & Vardeman, R. C. (1995). Supplemental l‐arginine attenuates pulmonary hypertension syndrome (ascites) in broilers. Poultry Science, 74, 323–330. [DOI] [PubMed] [Google Scholar]
  60. Wu, Q. , Jiao, Y. , Luo, M. , Wang, J. , Li, J. , Ma, Y. , & Liu, C. (2023). Detection of various traditional Chinese medicinal metabolites as angiotensin‐converting enzyme inhibitors: Molecular docking, activity testing, and surface plasmon resonance approaches. Molecules, 28, 7131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zampiga, M. , Soglia, F. , Petracci, M. , Meluzzi, A. , & Sirri, F. (2019). Effect of different arginine‐to‐lysine ratios in broiler chicken diets on the occurrence of breast myopathies and meat quality attributes. Poultry Science, 98, 2691–2697. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that supports the findings of this study are available on the request of readers via the email address provided.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES