Skip to main content
Genes logoLink to Genes
. 2024 Jul 15;15(7):921. doi: 10.3390/genes15070921

Genetic Variations of MSTN and Callipyge in Tibetan Sheep: Implications for Early Growth Traits

Kai Zhao 1,*,†, Xue Li 1,†, Dehui Liu 1,2, Lei Wang 3, Quanbang Pei 3, Buying Han 1,2, Zian Zhang 3, Dehong Tian 1, Song Wang 1,2, Jincai Zhao 3, Bin Huang 3, Fuqiang Zhang 3
Editor: Emilia Bagnicka
PMCID: PMC11276372  PMID: 39062700

Abstract

Simple Summary

Tibetan sheep are integral to the ecosystems and livelihoods of the Tibetan Plateau; however, their breeding practices limit their production and growth. Candidate genes myostatin (MSTN)and Callipyge have been recognized as important for improving growth traits in livestock. This research examined the polymorphic loci of these genes in Tibetan sheep and their association with growth traits. The results indicated that SNP loci of MSTN could potentially be utilized as a molecular indicator for early growth traits in Tibetan sheep.

Abstract

Tibetan sheep are vital to the ecosystem and livelihood of the Tibetan Plateau; however, traditional breeding methods limit their production and growth. Modern molecular breeding techniques are required to improve these traits. This study identified a single nucleotide polymorphism (SNP) in myostatin (MSTN) and Callipyge in Tibetan sheep. The findings indicated notable associations between MSTN genotypes and growth traits including birth weight (BW), body length (BL), chest width (ChW), and chest circumference (ChC), as well as a particularly strong association with cannon circumference (CaC) at 2 months of age. Conversely, Callipyge polymorphisms did not have a significant impact on Tibetan sheep. Moreover, the analyses revealed a significant association between sex and BW or hip width (HW) at 2 months of age and ChW, ChC, and CaC at 4 months of age. Furthermore, the study’s results suggested that the genotype of MSTN as a GA was associated with a notable sex effect on BW, while the genotype of Callipyge (CC) showed a significant impact of sex on CaC at 2 months of age. These results indicated that the SNP of MSTN could potentially serve as a molecular marker for early growth traits in Tibetan sheep.

Keywords: MSTN, Callipyge, SNP, growth traits, Tibetan sheep

1. Introduction

The Qinghai–Tibetan Plateau is distinguished by its distinctive ecosystem and extreme environmental factors, including high altitude, low temperature, and intense ultraviolet radiation [1]. Tibetan sheep (Ovis aries) hold a prominent ecological position as the predominant and extensively distributed livestock species on the Tibetan Plateau and serve as a vital resource for the indigenous population [2]. Additionally, they play a crucial role in supporting the livelihoods of the Tibetan Plateau inhabitants by offering a dependable source of meat, wool, and leather [3]. The morphology of Tibetan sheep is characterized by a rectangular body shape, with an average body height of 68.19 cm for rams and 65.11 cm for ewes, and body lengths of 76.56 cm and 65.79 cm, respectively. The predominant color of their hair is white, with variegated patterns on the head and limbs [4]. In terms of growth performance, Tibetan sheep exhibit lower weights compared to high-quality meat sheep breeds, with adult rams weighing around 51.0 kg and ewes around 43.6 kg [5]. In contrast, Hu sheep have adult weights of 53 kg for ewes and 85 kg for rams [6], while Dubo sheep reach weights of approximately 120 kg and 85 kg for adult rams and ewes [7]. Furthermore, Tibetan sheep, being a traditional meat sheep breed, exhibit problems such as constrained productivity, sluggish growth, and diminished slaughter rates attributed to the absence of sophisticated breeding techniques. Numerous research studies have identified a wide array of candidate genes implicated in the control of metabolism and modulation of growth rates in domestic animals. [8]. Variations in these genes have been extensively employed as molecular markers to facilitate breeding and enhance productivity [9]. However, studies on Tibetan sheep are limited.

Myostatin (MSTN), also known as GDF-8, is a growth factor belonging to the TGF-β superfamily, located on the long arm of chromosome 2 in sheep. It is composed of three exons and two introns [10]. Predominantly found in muscle tissues, it plays a critical role in the control of development and growth through its inhibition of cell cycle progression [11]. Extensive research has demonstrated that the suppression of MSTN expression leads to increased meat production in animals, commonly called double-muscle animals [12,13]. A notable augmentation (2–3-fold) in skeletal muscle mass has been documented in MSTN-null mice [14]. Multiple investigations have recognized MSTN as a pivotal candidate gene that impacts productivity, growth, and performance in diverse domestic animal species, including pigs, sheep, and chickens [15,16,17]. Specifically, investigations have demonstrated that MSTN-KO sheep exhibit a propensity for accelerated growth compared with wild-type (WT) sheep [18]. Additionally, studies have demonstrated that mutations in MSTN in sheep led to notable gains in body weight and muscle mass [19].

The Callipyge mutation site, situated in the proximal telomere region of chromosome 18, known as the DLK1-GTL2 imprinted domain, is characterized by a remarkably preserved A-G mutation [20]. This domain spans approximately 20 kb [21]. Furthermore, mice and humans share similar homology regions on chromosomes 12 and 14 [22,23]. This area of study centers on a significant quantity of imprinted genes that have been characterized. The gene products of these imprinted genes primarily encompass growth hormones, cell cycle regulators, nutrient transport proteins, and diverse non-coding RNA molecules, all of which are essential for governing growth and development [24]. The genetic mechanism underlying the Callipyge gene is distinguished by its polar predominance. This suggests that in the heterozygous state, only the C allele is paternally transmitted, resulting in the manifestation of the Callipyge phenotype in sheep. Conversely, if heterozygous offspring inherit the C allele maternally or form a CC homozygous genotype, the sheep display a normal phenotype, precluding the manifestation of the Callipyge phenotype [25,26]. Multiple studies have documented the capacity of the Callipyge gene to not only induce hypertrophy in the rump muscles of sheep but also enhance the efficiency of slaughter, increase carcass weight, and augment the proportion of lean meat [27,28,29].

Because of their vital role, the polymorphisms of these genes were explored in the Tibetan sheep population and their impact on pre-weaning growth traits was examined. This study contributes to the evaluation of MSTN and Callipyge genes as potential markers for growth marker-assisted selection (MAS) in Tibetan sheep breeding, laying the groundwork for the incorporation of molecular markers in breeding programs.

2. Materials and Methods

2.1. Experimental Animals

The experimental group comprised 313 purebred, single-parity Tibetan sheep (male = 180, female = 133) born between January and February 2022 in Gangcha County, Haibei Tibetan Autonomous Prefecture. The sheep were raised on the Qinghai Provincial Sheep Breeding and Promotion Center ranch, where they were allowed to graze freely and had unlimited access to water and grass. Growth traits such as body weight (BW), body length (BL), body height (BH), chest circumference (ChC), chest depth (ChD), chest width (ChW), hip width (HW), and cannon circumference (CaC) were observed from birth until weaning at four months of age. The animal experiments adhered to the regulations outlined in the approved “Guidelines for animal care and use” manual by the Animal Care and Use Committee.

2.2. Sample Collection and Primer Design

Ear tissues were collected and preserved in a 75% alcohol solution, followed by DNA extraction using a DNA extraction kit from TIANGEN, Beijing, China. Custom-designed primers were utilized for all exons of the MSTN and Callipyge genes with the assistance of Primer3 v0.4.0 [30]. The MSTN gene consists of three exons, and the entire region of each exon was targeted by specific primers. Conversely, the Callipyge gene sequence was obtained from GenBank (AF401294), and a set of primers was developed to target this region. Additional details regarding the primers employed can be found in Table 1.

Table 1.

Primer information of MSTN and Callipyge genes in Tibetan sheep.

Primer Names Primer Sequences (5′–3′) Size (bp) Tm (°C)
Callipyge F:TGAAAACGTGAACCCAGAAGC 493 60
R: GGCAGGAGAGACGGTTAAT
MSTN-Exon1 F: ATCACAGATCCCGACGACAC 704 60
R: CTCTTTGCCCTCCTCCTTAC
MSTN-Exon2 F: CATAGATTGACATGGAGGCG 601 60
R: TTTATTGGGTACAGGGCTAC
MSTN-Exon3 F: CCATAAAGGCAGAATCAAGC 736 60
R: TGTTGTGATGGTTAAATGCC

2.3. SNP Identification and Sequencing

We performed PCR reactions in a reaction volume of 30 μL, comprising 1.0 μL of DNA, 15 μL of 2×Taq PCR Master Mix, 1.0 μL of each primer, and double-distilled water (ddH2O) to reach the intended volume. We used a Bio-Rad S1000 thermal cycler (Bio-Rad, Hercules, CA, USA) for amplification, which consisted of an initial denaturation step at 94 °C for 2 min, 35 cycles of denaturation for 10 s at 94 °C, followed by annealing at 60 °C for 30 s, and elongation at 72 °C for 60 s. In the final step, PCR products were visualized on 1.0% agarose gel electrophoresis to determine the quality and quantity of the amplicons. Mutations were identified through Sanger sequencing using the Agilent 3730 system (Santa Clara, CA, USA). DNAMAN version 5.2.10 (Lynnon BioSoft, Vaudreuil, QC, Canada) was used for sequence analysis.

2.4. Population Genetic Index Calculation

Genetic parameters including allele frequency, heterozygosity (He), observed heterozygosity (Ho), effective allele numbers (Ne), and polymorphism information content (PIC) were evaluated utilizing Nei’s method [31]. The genotypes of the SNPs were examined for adherence to Hardy–Weinberg equilibrium (HW) in accordance with the Hardy–Weinberg law [32].

2.5. Statistical Analysis

The data analysis in this study was conducted using SPSS Statistics (Version 19, IBM SPSS Statistics, New York, NY, USA), with results presented as mean ± standard error. Associations between genotypes and individual growth traits were examined using general linear mixed models (GLMMs), with statistical significance defined as p < 0.05. The specific statistical model utilized in this research is detailed below:

Y = μ + Genotype + Sex + Interaction + ε

where Y represents the trait measured for each animal, including BW, BL, BH, ChW, ChD, ChW, HW, and CaC.

μ is the mean for the growth traits.

Genotypes represent the effects of the genotype.

Sex represents the effects of sex.

The interaction represents the interaction effect of sex and genotype.

ε is a random error, and it is assumed to be independent, with N (0, σ2) distribution.

3. Results

3.1. Polymorphism in Genes

An SNP locus was discovered within the MSTN and Callipyge, labeled A592G (rs410961001) in the MSTN and C232T in the Callipyge (AF401294). The sequencing peak maps for these genes illustrating the mutated sites are shown in Figure 1.

Figure 1.

Figure 1

The peak map of mutated SNPs in MSTN and Callipyge of Tibetan sheep 1. 1 The sequences were subsequently analyzed utilizing the DNAMAN software. The identified location of the red arrow is the mutation site. (A) MSTN mutations marked by the red arrows are located in exon 2 of MSTN A592G (rs410961001). (B) SNP mutation C232T was identified in Callipyge (AF401294) at the sites marked with the red arrow.

3.2. Population Genetic Analysis

Ne was calculated for each SNP and varied between 1 and 2. The allele frequencies of the SNPs were found to be in Hardy–Weinberg equilibrium. The PIC revealed that the SNP in MSTN was categorized as a locus with low-grade polymorphism (PIC ≤ 0.25), whereas the SNP in Callipyge was classified as a locus with moderate polymorphism (0.25 < PIC ≤ 0.5) (Table 2).

Table 2.

Population genetic analyses of MSTN and Callipyge in Tibetan sheep 1.

SNP Gene Frequency N Ho He PIC Ne HW
A B
MSTN 0.058 0.942 311 0.116 0.109 0.221 1.122 ns
Callipyge 0.861 0.139 312 0.234 0.240 0.404 1.316 ns

1 A represents the wild-type genotype, B represents the mutant genotype, N represents group size, Ho for homozygosity, He for heterozygosity, PIC for polymorphism information content, Ne for effective allele numbers, HW for Hardy–Weinberg equilibrium, and ns for non-significance.

3.3. Association Analyses of Sex with Growth Traits

The results revealed a statistically significant relationship between sex and various growth traits at different ages, including HW at 2 months, BW and ChW at 4 months (p < 0.05), and ChC and CaC at 4 months (p < 0.01). Nevertheless, no significant associations were found between sex and other growth traits at birth, 2 months, or 4 months of age (p > 0.05; Figure 2).

Figure 2.

Figure 2

The association between sex and growth traits in Tibetan sheep 1. 1 (A) Analyses of the associations between sex and growth traits in Tibetan sheep at birth. (B) Analyses of the associations between sex and growth traits in Tibetan sheep at 2 months of age. (C) Analyses of the associations between sex and growth traits in Tibetan sheep at 4 months of age. BW stands for body weight; BL stands for body length; BH stands for body height; ChC stands for chest circumference; ChD stands for chest depth; ChW stands for chest width; HWstands for hip width; CaC stands for cannon circumference. Different superscript letters indicate significant differences at different levels of significance, with * representing p < 0.05, ** representing p < 0.01, and *** representing p < 0.001.

3.4. Analyses of SNPs Associated with Growth Traits

The analyses demonstrated statistically significant associations between the genotypes of MSTN and BL, ChW, and ChC (p < 0.05), and there was a highly significant association with CaC at 2 months of age (p < 0.01; Figure 3). However, all other associations between SNP in MSTN and Callipyge were not significant (p > 0.05; Figure 3 and Figure 4).

Figure 3.

Figure 3

The association of SNPs in MSTN with Tibetan sheep’s growth traits 1. 1 (A) Association analysis of SNPs in MSTN and growth traits in Tibetan sheep at birth. (B) Association analysis of SNPs in MSTN and growth traits in Tibetan sheep at 2 months of age. (C) Association analysis of SNPs in MSTN and growth traits in Tibetan sheep at 4 months of age. AB represents the heterozygous mutant genotype; BB represents the homozygous mutant genotype; BW stands for body weight; BL stands for body length; BH stands for body height; ChC stands for chest circumference; ChD stands for chest depth; ChW stands for chest width; HWstands for hip width; CaC stands for cannon circumference. Different superscript letters indicate significant differences at different levels of significance, with * representing p < 0.05, ** representing p < 0.01.

Figure 4.

Figure 4

The association of SNPs in Callipyge with Tibetan sheep’s growth traits 1. 1 (A) Association analysis of SNPs in Callipyge and growth traits in Tibetan sheep at birth. (B) Association analysis of SNPs in Callipyge and growth traits in Tibetan sheep at 2 months of age. (C) Association analysis of SNPs in Callipyge and growth traits in Tibetan sheep at 4 months of age. AA represents the wild-type genotype; AB represents the heterozygous mutant genotype; BB represents the homozygous mutant genotype; BW stands for body weight; BL stands for body length; BH stands for body height; ChC stands for chest circumference; ChD stands for chest depth; ChW stands for chest width; HWstands for hip width; CaC stands for cannon circumference.

3.5. Analysis of Interaction Associations between Sex and SNPs with Growth Traits

The results revealed that there was a significant effect of sex on BW when the genotype of the MSTN gene was GA (p < 0.05). Additionally, when the genotype of Callipyge was CC, the effect of sex on CaC was highly significant at 2 months of age (p < 0.01, Table 3).

Table 3.

Interaction association analyses between sex and SNPs in MSTN and Callipyge with growth traits in Tibetan sheep 1.

State SNP Trait Genotype Female Male p-Value
Birth MSTN BW AB 3.12 ± 0.10 b 3.51 ± 0.13 a 0.020
BB 3.37 ± 0.05 3.40 ± 0.04 0.587
p-value 0.044
2 months Callipyge CaC AA 5.88 ± 0.04 B 6.04 ± 0.03 A 0.003
AB 5.99 ± 0.07 5.85 ± 0.06 0.123
BB 6.03 ± 0.22 5.70 ± 0.19 0.249
p-value 0.007

1 AA represents the wild-type genotype; AB represents the heterozygous mutant genotype; BB represents the homozygous mutant genotype; BW stands for body weight; CaC stands for cannon circumference. Within a row, means denoted by different superscript letters are deemed to be significantly different at the 0.05 level of significance for a,b and at the 0.01 level of significance for A,B.

4. Discussion

Notably, MSTN and Callipyge are widely recognized as the most extensively studied genes that influence muscle cell movement and growth [33,34]. This study aimed to identify SNPs in two specific genes and establish their association with pre-weaning growth traits in Tibetan sheep. Furthermore, we aimed to identify effective loci that could enhance the growth performance of Tibetan sheep. The findings of this study will contribute to establishing a molecular foundation for improving the growth performance of Tibetan sheep.

Studies have indicated that sex is a significant determinant of the growth traits of domestic animals, with male animals typically exhibiting superior growth traits to their female counterparts [35]. In this study, it was found that the HW of ewes at 2 months of age and BW, ChC, and ChW at 4 months of age were significantly higher compared to rams. Furthermore, the CaC of rams at 4 months of age was observed to be greater than that of ewes. CaC is an indicator of somatic bone development, suggesting that the skeleton of rams is superior to that of ewes, specifically in terms of body size. It is crucial to acknowledge that the timeframe analyzed in this research aligns with the initial phases of sheep growth and maturation, potentially obscuring the observable reproductive benefits of rams [36].

The MSTN gene has been recognized as a suppressor of skeletal muscle growth and suggested as a potential gene for enhancing muscle production in sheep [37]. Importantly, mutations in MSTN that interfere with its expression have been associated with the phenomenon of “double-muscling” observed in various species. Prior research has demonstrated the identification of approximately 8–10 SNPs in this gene of sheep, as indicated in Table 4 [38,39,40,41,42,43,44], and these mutations lead to the production of nonfunctional proteins, ultimately promoting substantial muscle growth and increased muscularity [45]. Considering the significant importance of MSTN in animal breeding, using CRISPR/Cas9 technology to generate MSTN-edited brown sheep, the results revealed a substantial enhancement in myofiber diameter, mean daily gain, and overall body weight in MSTN-edited sheep [46,47]. In contrast, an analysis of variations within intron 1 of MSTN revealed no significant association with the average BW, weaning weight, or pre-weaning growth rate [48]. Additionally, g.6223G exhibited no discernible effect on the growth or weight of Australian white Suffolk, Bordeaux Set, or Lincoln sheep [44]. Our study found that the mutation site significantly affected the BH, ChC, Chw, and CaC in Tibetan sheep at 2 months of age. This observation indicated that the mutation site plays a crucial role in the early growth and development of Tibetan sheep, highlighting its potential as a molecular marker for evaluating early growth traits.

Table 4.

SNPs have been identified in the sheep MSTN and Callipyge genes.

Gene Breed SNP
MSTN Dubo sheep, Tan sheep, small-tailed Han sheep rs129059715
Texel × Altai crossbred sheep g.6723G>A
East Friensian sheep 3′-UTR-272, 5-UTR-176
Tan sheep rs417816017
Charollais sheep g.2449G>C
Nilagiri sheep g.5622G>C
New Zealand Romney sheep g.6223G
Callipyge Tausset sheep A→G (at 211 bp in AF401294 amplified region)
Tibetan sheep C→T (at 176 bp in AF401294 amplified region)

Conversely, only 2 SNPs have been identified in the Callipyge gene of sheep as shown in Table 4 [49,50,51]. The Callipyge phenotype has been documented in sheep populations, with subsequent research establishing that the A→G mutation situated 32.8 kb upstream of GTL2 serves as the principal factor influencing this phenotype. However, it is important to acknowledge that the mutation frequency at this locus is notably low [49]. Notably, no instances of A→G mutations were detected in the Callipyge gene analysis conducted on Chinese and foreign sheep breeds [52]. This study was consistent with the results that identified a C→T mutation located 35 base pairs upstream of the mutation site responsible for the manifestation of the Callipyge phenotype. The findings of the study indicate a significant association between the C→T mutation located upstream of the mutation site of the double muscle hip gene and the occurrence of hind breech [50,51]. Moreover, a study indicated that the mutation in question did not have a substantial influence on the growth characteristics of Hornless Tawset, Suffolk, and Texel breeds. Nonetheless, significant discrepancies in growth traits were noted in the Tan sheep [50]. Studies analyzed the association between genotype and multiple growth traits in a cohort of 83 mature Oula sheep. Their findings suggested that the genotype of the locus under study did not yield statistically significant effects on BW, ChC, or ChD (p > 0.05). Nevertheless, heterozygous individuals tended to display higher values than homozygous individuals. In the present study, the genotype of the locus under investigation had no significant impact on growth performance at birth, 2 months of age, and 4 months of age [23]. This finding was consistent with previous studies where they observed that the growth rate of mutant Callipyge sheep before weaning was comparable to that of normal sheep. Furthermore, the phenotypic outcomes of the three genotypes did not exhibit any discernible trend, except for a significant difference in the CaC of rams when the genotype was heterozygous for CC, which was higher than that of ewes (p < 0.01) [53]. In summary, the SNP of the Callipyge gene did not exhibit any discernible effect on the pre-weaning growth performance of Tibetan sheep. However, additional studies are required to determine their potential effects on muscle development.

5. Conclusions

In conclusion, this study identified polymorphisms in two significant candidate genes in Tibetan sheep and assessed their impact on growth traits at birth and 2 and 4 months of age. Our findings reveal an association between the SNP locus of MSTN and growth and development at 2 months of age, suggesting its potential utility as a molecular marker for early growth traits in Tibetan sheep.

Acknowledgments

We sincerely appreciate the support of the key Laboratory of Adaptation and Evolution of Plateau Biota, Qinghai Provincial Key Laboratory of Animal Ecological Genomics, Northwest Institute of Plateau Biology, and the Chinese Academy of Sciences.

Author Contributions

K.Z. and X.L. wrote and revised the manuscript; D.L., L.W. and Q.P. provided the study concept and design; B.H. (Buying Han), Z.Z. and D.T. analyzed the data; S.W., J.Z., B.H. (Bin Huang) and F.Z. collected data and samples. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

All animal experiments adhered to the protocols outlined in the “Guidelines for Animal Care and Use manual (Approval No. NWIPB2023015, Date: 12 July 2023), which were approved by the Animal Care and Use Committee of the Northwest Institute of Plateau Biology, Chinese Academy of Sciences.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data will be made available on request.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This study was supported by the Natural Science Foundation of the Qinghai Province (2022-ZJ-901) and the Tibetan Sheep Germplasm Innovation Joint National Breeding Project.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Huang J.Q., Li Y.J., Luo Y.Z. Bacterial community in the rumen of Tibetan sheep and Gansu alpine fine-wool sheep grazing on the Qinghai-Tibetan Plateau, China. J. Gen. Appl. Microbiol. 2017;63:122–130. doi: 10.2323/jgam.2016.08.003. [DOI] [PubMed] [Google Scholar]
  • 2.Wang X., Xu T., Zhang X., Geng Y., Kang S., Xu S. Effects of Dietary Protein Levels on Growth Performance, Carcass Traits, Serum Metabolites, and Meat Composition of Tibetan Sheep during the Cold Season on the Qinghai-Tibetan Plateau. Animals. 2020;10:801. doi: 10.3390/ani10050801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Li J., Zhu W., Luo M., Ren H., Tang L., Liao H., Wang Y. Molecular cloning, expression and purification of lactoferrin from Tibetan sheep mammary gland using a yeast expression system. Protein Expr. Purif. 2015;109:35–39. doi: 10.1016/j.pep.2015.01.008. [DOI] [PubMed] [Google Scholar]
  • 4.Li L.L. Study on the Effect of Mixed Forage Silage and Supplemental Feeding on Euler-Type Tibetan Sheep in Qingnan Pastoral Area. Chinese Academy of Agricultural Sciences; Beijing, China: 2017. [Google Scholar]
  • 5.Zhang Y.H. Breed characteristics, production performance and grazing technology of Tibetan sheep. Contemp. Livest. Poult. Breed. 2017;9:15. doi: 10.14070/j.cnki.15-1150.2017.09.010. [DOI] [Google Scholar]
  • 6.Wang G.F., Li J., Jiang Q., Ren H.X., Wang L., Li S.Y., Zhou P. Growth performance and blood parameters of Hu sheep in southwest China. Heilongjiang Anim. Sci. Vet. Med. 2018;11:122–124. [Google Scholar]
  • 7.Xu P. Application of Early Weaning of Lambs. Gansu Agricultural University; Lanzhou, China: 2008. [Google Scholar]
  • 8.Al-Mamun H.A., Kwan P., Clark S.A., Ferdosi M.H., Tellam R., Gondro C. Genome-wide association study of body weight in Australian Merino sheep reveals an orthologous region on OAR6 to human and bovine genomic regions affecting height and weight. Genet. Sel. Evol. 2015;47:66. doi: 10.1186/s12711-015-0142-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.La Y., Zhang X., Li F., Zhang D., Li C., Mo F., Wang W. Molecular Characterization and Expression of SPP1, LAP3 and LCORL and Their Association with Growth Traits in Sheep. Genes. 2019;10:616. doi: 10.3390/genes10080616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Salabi F., Nazari M., Chen Q., Nimal J., Tong J., Cao W.G. Myostatin knockout using zinc-finger nucleases promotes proliferation of ovine primary satellite cells in vitro. J. Biotechnol. 2014;192:268–280. doi: 10.1016/j.jbiotec.2014.10.038. [DOI] [PubMed] [Google Scholar]
  • 11.Du C., Zhou X., Zhang K., Huang S., Wang X., Zhou S., Chen Y. Inactivation of the MSTN gene expression changes the composition and function of the gut microbiome in sheep. BMC Microbiol. 2022;22:273. doi: 10.1186/s12866-022-02687-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Grobet L., Martin L.J., Poncelet D., Pirottin D., Brouwers B., Riquet J., Schoeberlein A., Dunner S., Ménissier F., Massabanda J., et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet. 1997;17:71–74. doi: 10.1038/ng0997-71. [DOI] [PubMed] [Google Scholar]
  • 13.Lee S.J., McPherron A.C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA. 2001;98:9306–9311. doi: 10.1073/pnas.151270098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mcpherron A.C., Lawler A.M., Lee S.J. Regulation of skeletal muscle mass in mice by a new TGF-psuperfamily member. Nature. 1997;387:83–90. doi: 10.1038/387083a0. [DOI] [PubMed] [Google Scholar]
  • 15.Yu L., Tang H., Wang J., Wu Y., Zou L., Jiang Y., Wu C., Li N. Polymorphisms in the 5′ regulatory region of myostatin gene are associated with early growth traits in Yorkshire pigs. Sci. China C Life Sci. 2007;50:642–647. doi: 10.1007/s11427-007-0075-4. [DOI] [PubMed] [Google Scholar]
  • 16.Boman I.A., Klemetsdal G., Blichfeldt T., Nafstad O., Våge D.I. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian white sheep (Ovis aries) Anim. Genet. 2009;40:418–422. doi: 10.1111/j.1365-2052.2009.01855.x. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang G.X., Zhao X.H., Wang J.Y., Ding F.X., Zhang L. Effect of an exon 1 mutation in the myostatin gene on the growth traits of the Bian chicken. Anim. Genet. 2011;43:458–459. doi: 10.1111/j.1365-2052.2011.02274.x. [DOI] [PubMed] [Google Scholar]
  • 18.Li H., Wang G., Hao Z., Zhang G., Qing Y., Liu S., Qing L., Pan W., Chen L., Liu G., et al. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer. Sci. Rep. 2016;6:33675. doi: 10.1038/srep33675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Clop A., Marcq F., Takeda H., Pirottin D., Tordoir X., Bibé B., Bouix J., Caiment F., Elsen J.M., Eychenne F., et al. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 2006;38:813–818. doi: 10.1038/ng1810. [DOI] [PubMed] [Google Scholar]
  • 20.Ren Z.Z., He X.Y., Chu M.X. Research Progress of Callipyge in Sheep. Chin. Herbiv. Sci. 2023;43:52–54. [Google Scholar]
  • 21.Li J., Greenwood P.L., Cockett N.E., Hadfield T.S., Vuocolo T., Byrne K., White J.D., Tellam R.L., Schirra H.J. Impacts of the Callipyge mutation on ovine plasma metabolites and muscle fibre type. PLoS ONE. 2014;9:99726. doi: 10.1371/journal.pone.0099726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Charlier C., Segers K., Wagenaar D., Karim L., Berghmans S., Jaillon O., Shay T., Weissenbach J., Cockett N., Gyapay G., et al. Humanovine comparative sequencing of a 250kilo base imprinted domaien compassing the Callipyge (clpg) gene and identification of six imprinted transcripts:DLK1,DAT GTL2,PEG11, antiPEG11 and MEG8. Genome Res. 2001;11:850–862. doi: 10.1101/gr.172701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Georgiades P., Watkins M., Surani M.A., Ferguson-Smith A.C. Parental origin-pecific developmental defects in mice with uniparental disomy for chromosome 12. Development. 2000;127:4719–4728. doi: 10.1242/dev.127.21.4719. [DOI] [PubMed] [Google Scholar]
  • 24.Lewis A., Redrup L. Genetic imprinting:conflict at the Callipyge locus. Curr. Biol. 2005;15:291–294. doi: 10.1016/j.cub.2005.04.003. [DOI] [PubMed] [Google Scholar]
  • 25.Charlier C. Towards the molecular understanding of the polar over dominance phenomenon associated with the Callipyge phenotype in sheep. Bull. Mem. Acad. R. Med. Belg. 2004;159:490–496. [PubMed] [Google Scholar]
  • 26.Cockett N.E., Jackson S.P., Shay T.L., Farnir F., Berghmans S., Snowder G.D., Nielsen D.M., Georges M. Polar Overdominance at the Ovine Callipyge Locus. Science. 1996;273:236–238. doi: 10.1126/science.273.5272.236. [DOI] [PubMed] [Google Scholar]
  • 27.Bidwell C.A., Shay T.L., Georges M., Beever J.E., Berghmans S., Cockett N.E. Differential expression of the GTL2 gene within the Callipyge region of ovine chromosome 18. Anim. Genet. 2001;32:248–256. doi: 10.1046/j.1365-2052.2001.00776.x. [DOI] [PubMed] [Google Scholar]
  • 28.Liu X.M., Zhang L.P., Yang L., Wu J.P., Ha Z.J., Yu L.H., Li W.W., Wu X.J. Study on correlation between Callipyge gene polymorphisms and growth traits in Oula Tibetan sheep. J. Gansu Agric. Univ. 2010;45:1–4+9. doi: 10.13432/j.cnki.jgsau.2010.04.023. [DOI] [Google Scholar]
  • 29.Hu S.J., Zhang S.Z., Yuan Z.H., Xuan J.L., Ma X.M., Zhang L., Zhao F.P., Wei C.H., Du L.X. Polymorphisms of CLPG and MSTN genes in sheep and their association with growth traits. China Anim. Husb. Vet. Med. 2016;43:1285–1293. doi: 10.16431/j.cnki.1671-7236.2016.05.025. [DOI] [Google Scholar]
  • 30.Koressaar T., Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23:1289–1291. doi: 10.1093/bioinformatics/btm091. [DOI] [PubMed] [Google Scholar]
  • 31.Nei M., Roychoudhury A.K. Sampling variances of heterozygosity and genetic distance. Genetics. 1974;76:379–390. doi: 10.1093/genetics/76.2.379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ortega M.S., Denicol A.C., Cole J.B., Null D.J., Hansen P.J. Use of single nucleotide polymorphisms in candidate genes associated with daughter pregnancy rate for prediction of genetic merit for reproduction in Holstein cows. Anim. Genet. 2016;47:288–297. doi: 10.1111/age.12420. [DOI] [PubMed] [Google Scholar]
  • 33.Marcq F., Larzul C., Marot V., Bouix J., Eychenne F., Laville É., Bibé B., Leroy P., Georges M., Elsenet J. Preliminary results of a whole-genome scan targeting QTL for carcass traits in a Texel×Romanov intercross. Agric. Food Sci. 2002;34:371. doi: 10.1186/1297-9686-34-3-371. [DOI] [Google Scholar]
  • 34.Fahrenkrug S.C., Freking B.A., Rexroad C.E., Leymaster K.A., Kappes S.M., Smith T.P. Comparative mapping of the ovine clpg locus. Mamm. Genome. 2000;11:871–876. doi: 10.1007/s003350010150. [DOI] [PubMed] [Google Scholar]
  • 35.Wang S., Ma T., Zhao G., Zhang N., Tu Y., Li F., Cui K., Bi Y., Ding H., Diao Q. Effect of Age and Weaning on Growth Performance, Rumen Fermentation, and Serum Parameters in Lambs Fed Starter with Limited Ewe-Lamb Interaction. Animals. 2019;9:825. doi: 10.3390/ani9100825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Harmata A.J., Ma Y., Sanchez C.J., Zienkiewicz K.J., Elefteriou F., Wenke J.C., Guelcher S.A. D-amino acid inhibits biofilm but not new bone formation in an ovine model. Clin. Orthop. Relat. Res. 2015;473:3951–3961. doi: 10.1007/s11999-015-4465-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Deng B., Zhang F., Wen J., Ye S., Wang L., Yang Y., Gong P., Jiang S. The function of myostatin in the regulation of fat mass in mammals. Nutr. Metab. 2017;14:29. doi: 10.1186/s12986-017-0179-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tao M.H., Meng K., Rong X., Qiang H., Nie W., Guo C.H., Feng D.Z. Polymorphisms of MSTN gene and its association with meat quality traits in sheep. China Anim. Husb. Vet. Med. 2023:2766–2776. doi: 10.16431/j.cnki.1671-7236.2023.07.017. [DOI] [Google Scholar]
  • 39.Lei X., Liu C.X., He S.G., Peng X.R., Mao L.J., Liu M.J., Qi A. Association analysis of g+6723GA locus of MSTN gene with carcass body size and muscle weight in different parts. Grass-Fed. Livest. 2022:1–8. doi: 10.16863/j.cnki.1003-6377.2022.06.001. [DOI] [Google Scholar]
  • 40.Zhang L., Li D.N., Wang Y.C., Yang L.C., He J., Song Y.X. Polymorphisms of MSTN gene and its association with growth traits in East Freey sheep. China Anim. Husb. Vet. Med. 2021:4537–4544. doi: 10.16431/j.cnki.1671-7236.2021.12.022. [DOI] [Google Scholar]
  • 41.Ma L.N., Li Y.K., Yu Y., E E.H.H., Ma Q. TaqMan probe SNP typing of myostatin (MSTN) gene and its association with growth traits. Heilongjiang Anim. Husb. Vet. Med. 2016:4–6. doi: 10.13881/j.cnki.hljxmsy.2016.0182. [DOI] [Google Scholar]
  • 42.Hadjipavlou G., Matika O., Clop A., Bishop S.C. Two single nucleotide polymorphisms in the myostatin (GDF8) gene have significant association with muscle depth of commercial Charollais sheep. Anim. Genet. 2008;39:346–353. doi: 10.1111/j.1365-2052.2008.01734.x. [DOI] [PubMed] [Google Scholar]
  • 43.Sahu A.R., Jeichitra V., Rajendran R., Raja A. Novel report on mutation in exon 3 of myostatin (MSTN) gene in Nilagiri sheep: An endangered breed of South India. Trop. Anim. Health Prod. 2019;51:1817–1822. doi: 10.1007/s11250-019-01873-7. [DOI] [PubMed] [Google Scholar]
  • 44.Hickford J.G., Forrest R.H., Zhou H., Fang Q., Han J., Frampton C.M., Horrell A.L. Polymorphisms in the ovine myostatin gene (MSTN) and their association with growth and carcass traits in New Zealand Romney sheep. Anim. Genet. 2010;41:64–72. doi: 10.1111/j.1365-2052.2009.01965.x. [DOI] [PubMed] [Google Scholar]
  • 45.Grade C.V.C., Mantovani C.S., Alvares L.E. Myostatin gene promoter:Structure, conservation and importance as a target for muscle modulation. J. Anim. Sci. Biotechnol. 2019;10:32. doi: 10.1186/s40104-019-0338-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wang X., Niu Y., Zhou J., Yu H., Kou Q., Lei A., Zhao X., Yan H., Cai B., Shen Q., et al. Multiplex gene editing via CRISPR/Cas9 exhibits desirable muscle hypertrophy without detectable off-target effects in sheep. Sci. Rep. 2016;6:32271. doi: 10.1038/srep32271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhou S., Kalds P., Luo Q., Sun K., Zhao X., Gao Y., Cai B., Huang S., Kou Q., Petersen B., et al. Optimized Cas9:sgRNA delivery efficiently generates biallelic MSTN knockout sheep without affecting meat quality. BMC Genom. 2022;23:348. doi: 10.1186/s12864-022-08594-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kijas J.W., McCulloch R., Edwards J.E., Oddy V.H., Lee S.H., van der Werf J. Evidence for multiple alleles effecting muscling and fatness at the ovine GDF8 locus. BMC Genet. 2007;8:80. doi: 10.1186/1471-2156-8-80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Li Y.L., Chen R.J., Mao Y.J., Huang D.L., Yang Z.P. Analysis on SNPs of Callipyge gene and Meg3.1 and DLK1-INTR1.1 loci in four sheep. Anim. Husb. Vet. Med. 2008;4:11–15. doi: 10.18632/aging.202376. [DOI] [Google Scholar]
  • 50.Yan Y.B. Study on the Correlation between SNPs and Five Microsatellite Loci Polymorphisms of CLPG Gene and Hind Rump Development in Meat Sheep. Gansu Agricultural University; Lanzhou, China: 2008. [Google Scholar]
  • 51.Freking B.A., Murphy S.K., Wylie A.A., Rhodes S.J., Keele J.W., Leymaster K.A., Jirtle R.L., Smith T.P. Identification of the single base change causing the Callipyge muscle hypertrophy phenotype, the only known example of polar overdominance in mammals. Genome Res. 2002;12:1496–1506. doi: 10.1101/gr.571002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Dai R.A. Preliminary Study on the Relationship between CLPG and BMP15 Gene Polymorphisms and the Production Performance of Seven Sheep Populations in Northern Xinjiang. Nanjing Agricultural University; Nanjing, China: 2004. [Google Scholar]
  • 53.Meyer H.H., Busboom J.R., Abdulkhaliq A. Carcass and cooked meat traits of lambs sired by Dorset rams heterozygous for the Callipyge gene, Suffolk rams and Texel rams Proc. West. Sect. Am. Soc. Anim. Sci. 1995;46:199 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data will be made available on request.


Articles from Genes are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES