Skip to main content
Journal of Fungi logoLink to Journal of Fungi
. 2024 Jun 28;10(7):454. doi: 10.3390/jof10070454

Diversity and New Species of Ascomycota from Bamboo in China

Zhiying Zhao 1, Taichang Mu 1, Nemat O Keyhani 2, Huili Pu 1, Yongsheng Lin 1, Ziying Lv 1, Jinming Xiong 3, Xiaohao Chen 1, Xinyang Zhan 1, Huajun Lv 1, Motunrayo Yemisi Jibola-Shittu 1, Peisong Jia 4, Jianlong Wu 5, Shuaishuai Huang 6, Junzhi Qiu 1,*, Xiayu Guan 7,*
Editor: Seung-Yoon Oh
PMCID: PMC11277934  PMID: 39057339

Abstract

Bamboo is an economically important crop that has gained prominence as an alternative to wood to reduce deforestation and ecosystem destruction. Diseases of bamboo that typically occur on leaves and stems can cause significant loss, reducing the quality and yield of the bamboo. However, there are few reports identifying the fungal species diversity and potential pathogens of bamboo. Here, we describe four new species of plant fungi from the leaves of bamboo within Fujian provinces, China. Fungi were isolated from diseased leaves collected within Fujian province and identified based on their morphological characteristics and multilocus phylogenies using nucleotide sequences derived from combined datasets of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), the translation elongation factor 1-α gene (tef1-α), and the partial beta-tubulin gene (tub2). These analyses helped reveal and clarify taxonomic relationships in the family Magnaporthaceae. The new species of bambusicolous fungi identified include two species of Bifusisporella, described as B. fujianensis sp. nov. and B. bambooensis sp. nov., and two species of Apiospora, described as A. fujianensis sp. nov. and A. fuzhouensis sp. nov. This study further expands the characterization and distribution of fungi associated with bamboo.

Keywords: Apiospora, Bifusisporella, bambusicolous fungi, molecular phylogeny, morphology, new species

1. Introduction

The bamboo plant (Poales, Bambusoideae) family includes over 1400 different species of monocotyledon, mostly evergreen perennials. Bamboo encompasses the largest members of the grass family, occur naturally in a wide range of different ecosystems, and are cultivated as a highly versatile crop [1]. Bamboos are well known to confer a number of beneficial ecological effects including carbon sequestration and erosion control, include some of the fastest growing plants known, have widespread ornamental use, and represent an important economic crop in regions where they are cultivated. Commercial applications of bamboo as a material for use in building/construction and fabrication of furniture, fabric, paper, cookware, cooking utensils, and many other items stems from its high strength-to-weight ratio and ease of cultivation that includes rapid plant growth. In addition, the plant is a food source for humans and other animals, notably giant and red pandas, as well as bamboo lemurs [2]. Currently, approximately 80% of the world’s bamboo species are found in the eastern and/or southern areas of Asia, with China having the richest bamboo resources in terms of highest diversity and overall cultivated area, accounting for more than 50% of the worldwide bamboo species [3,4]. Bamboos plants show high resistance to microbial diseases, with fungal ascomycetes as the major microorganisms that limit the health and productivity of bamboo forests. Different bamboo fungi can infect various parts of the plant, resulting in nevus (gall-like “tumors”), spotted wilt, leaf damage/necrosis, and other symptoms and diseases that can lead to reduced quality and yield of the bamboo. Deleterious effects of Bambusicolous Ascomycota can impact economic development, and methods for the biological control of some bamboo fungi can reduce losses in bamboo forests and the cultivation industry, helping to maintain diversity, plant populations, and the varied beneficial ecological functions of bamboo forests [5]. Over 1150 different species of ascomycetes may have some association (including pathogens, mutualists, and commensals) with bamboo, of which 350 asexual morphs, 240 hyphomycelia, and 110 coelomycetes have been tentatively identified [6]. These fungi are mainly distributed in the Sordariomycetes, Dothideomycetes, and Eurotiomycetes, with the more representative families of bamboo fungi found in the Magnaporthaceae and Apiosporaceae families within the Sordariomycetes.

Magnaporthaceae classification was proposed by Cannon [7] and included the genus Magnaporthe and its related genera Buergenerula, Clasterosphaeria, Gaeumannomyces, Herbampulla, and Omnidemptus. More recently, additional taxa classified within Magnaporthaceae include Magnaporthiopsis [8], Bussabanomyces, Kohlmeyeriopsis and Slopeiomyces [9], Pseudophhialophora [10], Falciphora [11], Neogaeumanyces [12], Budhanggurabania [13], Falciphoriella and Gaemannomycella [14], and Bifusisporella. Currently, Magnaporthaceae consists of 25 genera and more than 100 species. The genus Bifusisporella was erected by Rejane [15], with B. sorghi designated as the type species. The morphology of Bifusisporella is characterized by septate, branched mycelium with a smooth, hyaline to light brown surface, conidiophores reduced to conidiogenous cells, which can be solitary or aggregated, curved and elongated cylindrical or clavate, and are typically light brown. Conidia are described as dimorphic, with macroconidia slightly more curved than microconidia, and both sickle-shaped, hyaline, and smooth [15].

The Apiosporaceae fungal family belongs to the Ascomycota (Sordariomycetes Amphisphaeriales), with the type genus being Apiospora Sacc. introduced by Saccardo [16] and the type species being A. montagnei Sacc. The sexual morphology of Apiospora is characterized by hyaline ascospores surrounded by thick gelatinous sheaths [17,18,19]. The asexual form of Apiospora is characterized by lenticular conidia that are spherical or subglobose and usually light brown to brown in color [20,21]. Most Apiospora species are associated with plants as endophytes, with some species being economically important plant pathogens [22,23].

In this study, four fungal species, two of which represent new species, found growing on bamboo plants were identified and placed within the Magnaporthaceae, with their taxonomic placement determined based on morphological characteristics and molecular identification. The latter involved multilocus phylogenetic reconstructions using a combined dataset of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), and the translation elongation factor 1-α gene (tef1-α) nucleotide sequences. Similarly, four additional fungal isolates (again, with two representing new species) were identified and placed within the Apiosporaceae based upon morphological characteristics and molecular taxonomic and phylogenetic analyses using the combined marker loci sequence dataset (ITS + LSU + tef1-α + tub2). Our results identify two new species of Bifusisporella, Bifusisporella fujianensis sp. nov. and Bifusisporella bambooensis sp. nov. (Magnaporthaceae), and two new species of Apiospora, Apiospora fujianensis sp. nov., Apiospora fuzhouensis sp. nov. (Apiosporaceae), which are illustrated and described. This study expands the diversity of fungi infecting the economically and environmentally important bamboo plant.

2. Materials and Methods

2.1. Fungal Isolates and Morphology

Specimens were collected from diseased bamboo leaves in groves located in Fujian province, China. Tissue fragments with a total area of about 25 mm2 were removed from the edges of the bamboo leaves in which disease spots, e.g., necrosis, wilting, and/or discoloration/blackening, were apparent. Samples were soaked in 75% ethanol for 45–60 s, then soaked in sterile deionized water for 45 s and washed with sterile water. Tissue fragments were then transferred to a 5% sodium hypochlorite solution for 30 s, followed by three washes in sterile deionized water for 60 s. The fragments were dried with sterilized filter paper and then transferred to the PDA plates which were incubated at 25 °C for 5–7 days following previously established procedures [24]. Growing edges of fungal mycelia were transferred to new PDA plates and plates were incubated for 5–7 d. The procedure was continued until the fungal culture was pure (typically 2–4 times). To promote sporulation and observe the colony morphology, purified isolates were inoculated in the center of PDA and synthetic low-nutrient agar (SNA) plates and cultured at 25 °C under alternating conditions of 12 h near-ultraviolet light and 12 h dark [25]. At 7 and 14 d of growth on PDA, photos of the colonies were taken with a digital camera, and the morphology of conidiomata, conidiophores, and conidiogenous cells was observed using a stereomicroscope (Nikon SMZ74, Tokyo, Japan). Samples were also prepared for analyses by scanning electron microscope (SEM, Nikon Ni-U; HITACHI SU3500) as described [26]. Fungal micromorphology and structure were measured by Digimizer 5.4.4 software. Single colony purified cultures were cut and stored in 10% sterilized glycerin and sterile water at 4 °C for future detailed study.

2.2. DNA Extraction, PCR Amplification, and Sequencing

Genomic DNA was isolated from fresh mycelia using a fungal DNA extraction mini ki, from cells cultured at 25 °C on PDA for 15–30 days as described [27]. Primers ITS5/ITS4 [28], LROR/LR5 [29], RPB1-Ac/RPB1-Cr [30,31], EF1-983F/EF1-2218R [32], EF1-728F/EF-2 [33], and Bt2a/Bt2b [34] were used for amplification of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), the translation elongation factor 1-α gene (tef1-α),and the partial beta-tubulin gene (tub2) by polymerase chain reactions (PCR) as described [27]. Primer sequences are given in Table 1.

Table 1.

The primer sequences and programs in this study.

Locus Primers Sequence (5′–3′) PCR Cycles References
ITS ITS5 GGA AGT AAA AGT CGT AAC AAG G (95 °C: 30 s, 55 °C: 30 s, 72 °C: 1 min) × 35 cycles [28]
ITS4 TCCTCCGCTTATTGATATGC
LSU LROR GTACCC GCTGAACTTAAGC (95 °C: 30 s, 52 °C: 30 s, 72 °C: 1 min) × 35 cycles [29]
LR5 TCCTGAGGGAAACTTCG
rpb1 fRPB1-Ac GAR TGY CCD GGD CAY TTY GG (95 °C: 30 s, From 57 °C to 72 °C at 0.2 °C/s:30 s, 72 °C: 1 min) × 35 cycles [30,31]
fRPB1-Cr CCNGCDATNTCRTTRTCCATRTA
tef1-α EF1-983F GCYCCYGGHCAYCGTGAYTT (95 °C: 30 s, 57/52 °C: 30 s, 72 °C: 1 min) × 35 cycles [32]
EF1-2218R ATGACACCRACRGCRACRGTYTGYAT
EF1-728F CATCGAGAAGTTCGAGAAGG (95°C: 30 s, 51 °C: 30 s, 72 °C: 1 min) × 35 cycles [33]
EF-2 GGARGTACCAGTSATCATGTT
tub2 Bt2a GGTAACCAAATCGGT GCTGCT TTC (95 °C: 30 s, 56 °C: 30 s, 72 °C: 1 min) × 35 cycles [34]
Bt2b ACCCTCAGTGTAGTGACCCTTGGC

PCR amplification of target loci was performed using a Bio-Rad thermal cycler (Hercules, CA, USA) with a 25 μL reaction volume of 12.5 μL 2×Rapid Taq Master Mix (Vazyme, Nanjing, China), with 1 μL (10 μM) for the forward and reverse primers (Sangon, Shanghai, China) and 1 μL for the template genomic DNA in the amplifier, and adjusted with distilled deionized water to a total volume of 25 μL. PCR products were visualized on 1% agarose gel electrophoresis. Bidirectional (both strand) sequencing of PCR products was conducted by the Tsingke Company Limited (Fuzhou, China). Consensus sequences were assembled using MEGA 7.0 [35]. New sequences generated in this study were uploaded to GenBank (https://www.ncbi.nlm.nih.gov, accessed on 19 March 2024, Table 2).

Table 2.

Species names, voucher or culture codes, hosts or substrate, locations, and corresponding GenBank accession numbers of DNA sequences used in this study.

Species Culture/Voucher Host/Substrate Country GenBank Accession Number
ITS LSU tef1-a tub2 rpb1
Barretomyces calatheae CBS 129274 = CPC 18464 Calathea longifolia Brazil KM484831 KM484950 - - KM485045
Bambusicularia brunnea CBS 133599 Sasa sp. Japan KM484830 KM484948 - - KM485043
Bambusicularia brunnea CBS 133600 Phyllostachys bambusoides Japan AB274436 KM484949 - - KM485044
Bifusisporella bambooensis CGMCC3.25653 Bambusoideae sp. China PP159031 PP159039 PP488459 - PP488463
Bifusisporella bambooensis CGMCC3.27207 Bambusoideae sp. China PP477445 PP477439 PP488461 - PP488465
Bifusisporella fujianensis CGMCC3.25651 Bambusoideae sp. China PP159030 PP159038 PP488458 - PP488462
Bifusisporella fujianensis CGMCC3.27206 Bambusoideae sp. China PP477444 PP477438 PP488460 - PP488464
Bifusisporella sorghi URM 7442 Sorghum bicolor endophyte Brazil MK060155 MK060153 MK060157 - MK060159
Bifusisporella sorghi URM 7864 Sorghum bicolorendophyte Brazil MK060156 MK060154 MK060158 - MK060160
Bifusisporella sichuanensis SICAUCC 22-0073 Phyllostachys edulis China ON227097 ON227101 ON244427 - ON244428
Bussabanomyces longisporus CBS 125232 Amomum siamense, leaves Thailand KM484832 KM484951 KM009202 - KM485046
Buergenerula spartinae ATCC 22848 Spartina alterniflora, leaves USA JX134666 DQ341492 JX134692 - JX134720
Falciphora oryzae CBS 125863= R5-6-l Oryza sativa, root, endophyte China EU636699 KJ026705 JN857963 - KJ026706
Falciphoriella solaniterrestris CBS 117.83 Soil in potato field Netherlands KM484842 KM484959 - - KM485058
Gaeumannomycella graminis CPC 26020 = CBS 141384 Cynodon dactylon × C. transvaalensis USA KX306498 KX306568 KX306701 - KX306633
Gaeumannomycella graminicola CPC 26025 = CBS 141381 Stenotaphrum secundatum USA KX306495 KX306565 KX306698 - KX306630
Gaeumannomycella caricis CPC 26262 = CBS 141374 Carex rostrata UK KX306478 KX306548 KX306675 - KX306671
Gaeumannomycella caricis CBS 388.81 Carex rostrata UK KM484843 KM484960 KX306674 - -
Gaeumannomyces floridanus CPC 26037 Stenotaphrum secundatum USA KX306491 KX306561 KX306693 - KX306626
Gaeumannomyces fusiformis CPC 26068 Oryza sativa USA KX306492 KX306562 KX306694 - KX306627
Gaeumannomyces glycinicola CPC 26266 Glycine max USA KX306494 KX306564 KX306696 - KX306629
Gaeumannomyces glycinicola CPC 26057 Glycine max USA KX306493 KX306563 KX306695 - KX306628
Gaeumannomyces graminicola CBS 352.93 - - KM484834 DQ341496 KX306697 - KM485050
Gaeumannomyces graminis CPC 26045 Cynodon dactylon × C. transvaalensis - KX306505 KX306575 KX306708 - KX306640
Gaeumannomyces graminis var. graminis M33 - - JF710374 JF414896 JF710411 - JF710442
Gaeumannomyces graminis var. graminis M54 - - JF414848 JF414898 JF710419 - JF710444
Gaeumannomyces hyphopodioides CBS 350.77 Zea mays, root UK KX306506 KX306576 - - -
Gaeumannomyces hyphopodioides CBS 541.86 Triticum aestivum, seedling Germany KX306507 KX306577 KX306709 - -
Gaeumannomyces oryzicola CPC 26063 Oryza sativa USA KX306516 KX306586 KX306717 - KX306646
Gaeumannomyces oryzinus CPC 26030 Cynodon dactylon × C. transvaalensis Bahamas KX306517 KX306587 KX306718 - KX306647
Gaeumannomyces radicicola CBS 296.53 - Canada KM009170 KM009158 KM009206 - KM009194
Gaeumannomyces setariicola CPC 26059 Setaria italica South Africa KX306524 KX306594 KX306725 - KX306654
Gaeumannomyces tritici CBS 273.36 Triticum aestivum Argentina KX306525 KX306595 KX306729 - KX306655
Gaeumannomyces walkeri CPC 26028 Stenotaphrum secundatum USA KX306543 KX306613 KX306746 - KX306670
Gaeumannomyces wongoonoo BRIP:60376 Stenotaphrum secundatum Australia KP162137 KP162146 - - -
Kohlmeyeriopsis medullaris CBS 117849 = JK5528S Juncus roemerianus USA KM484852 KM484968 - - KM485068
Macgarvieomyces borealis CBS 461.65 Juncus effiisus, leaf spots UK MH858669 DQ341511 KM009198 - KM485070
Macgarvieomyces juncicola CBS 610.82 Juncus effiisus, stem base The Netherlands KM484855 KM484970 KM009201 - KM485071
Magnaporthaceae, incertaesedis CPC 26284 = GP57 Triticum aestivum UK KX306546 KX306616 KX306677 - -
Magnaporthiopsissp. CPC 26038 Cynodon dactylon × C. transvaalensis USA KX306545 - KX306676 - KX306672
Magnaporthiopsis incrustans M35 - - JF414843 JF414892 - - JF710437
Magnaporthiopsis maydis CBS 133165 = ATCC MYA-3356 Zeamays Israel KX306544 KX306614 - - -
Magnaporthiopsis maydis CBS 662.82A Zeamays Egypt KM484856 KM484971 - - KM485072
Magnaporthiopsis cynodontis RS7-2 = CBS 141700 ultradwarf bermudagrass roots USA KJ855508 KM401648 KP282714 - KP268930
Magnaporthiopsis cynodontis RS5-5 roots USA KJ855506 KM401646 KP282712 - KP268928
Magnaporthiopsis cynodontis RS3-1 roots USA KJ855505 KM401645 KP282711 - KP268927
Magnaporthiopsis meyeri-festucae FF2 - - MF178146 MF178151 MF178167 - MF178162
Magnaporthiopsis meyeri-festucae SCR11 - - MF178150 MF178155 MF178171 - MF178166
Magnaporthiopsis panicorum CM2S8 - - KF689643 KF689633 KF689623 - KF689613
Magnaporthiopsis panicorum CM10s2 - - KF689644 KF689634 KF689624 - KF689614
Magnaporthiopsis rhizophila M22 - - JF414833 JF414882 JF710407 - JF710431
Nakataea sp. CBS 332.53 Oryza sativa USA KM484867 KM484981 - - KM485083
Nakataea oryzae CBS 252.34 Oryza sativa Burma KM484862 KM484976 - - KM485078
Nakataea oryzae CBS 288.52 Oryza sativa, stem Japan KM484864 KM484978 - - KM485080
Neogaeumannomyces bambusicola MFLUCC11-0390 Dead culm of bamboo (Bambusae) Thailand KP744449 KP744492 - - -
Neopyricularia commelinicola CBS 128307 = KACC 44083 Commelina communis, leaves Korea FJ850125 KM484984 KM009199 - KM485086
Neopyricularia commelinicola CBS 128308 Commelina communis, leaves Korea FJ850122 KM484985 - - KM485087
Omnidemptus affinis ATCC 200212 Panicum effiisum var. effiisum grass leaves Australia JX134674 KX134686 JX134700 - JX134728
Ophioceras dolichostomum CBS 114926 = HKUCC 3936 = KM 8 Wood China JX134677 JX134689 JX134703 - JX134731
Ophioceras leptosporum CBS 894.70 = ATCC 24161 = HME 2955 Dead stem of dicot plant (probably Urtica dioicd) UK JX134678 JX134690 JX134704 - JX134732
Proxipyricularia zingiberis CBS 132355 Zingiber mioga Japan AB274433 KM484987 - - KM485090
Proxipyricularia zingiberis CBS 133594 Zingiber mioga Japan AB274434 KM484988 - - KM485091
Pseudoph ialophora eragrostis CM12m9 Eragrostis sp. USA KF689648 KF689638 KF689628 - KF689618
Pseudopyricularia cyperi CBS 133595 Cyperus iria Japan KM484872 KM484990 - - AB818013
Pseudopyricularia kyllingae CBS 133597 Kyllinga brevifolia Japan KM484876 KM484992 KT950880 - KM485096
Pyricularia grisea BR0029 Digitaria sanguinalis Brazil KM484880 KM484995 - - KM485100
Pyricularia grisea CR0024 Lolium perenne Korea KM484882 KM484997 - - KM485102
Pyricularia ctenantheicola GR0001 = Ct-4 = ATCC 200218 Ctenanthe oppenheimiana Greece KM484878 KM484994 - KM485098
Pyricularia oryzae CBS 365.52 = MUCL 9451 - Japan KM484890 KM485000 - - KM485110
Slopeiomyces cylindrosporus CBS 609.75 Grass root, associated with Phialophora graminicola UK KM484944 KM485040 JX134693 - KM485158
Utrechtiana cibiessia CBS 128780 = CPC 18916 Phragmites australis, leaves Netherlands JF951153 JF951176 - - KM485047
Xenopyricularia zizaniicola CBS 132356 Zizania latifolia Japan KM484946 KM485042 KM009203 - KM485160
Apiospora acutiapica KUMCC 20-0209 - - MT946342 MT946338 MT947359 MT947365 -
Apiospora acutiapica KUMCC 20-0210 Bambusa bambos China - MT946339 MT947360 MT947366 -
Apiospora agari KUC 21333 Agarum cribrosum Korea - MH498440 MH544663 MH498478 -
Apiospora aquatica MFLU 18-1628 Submerged wood China MK828608 MK835806 - - -
Apiospora arctoscopi KUC 21331 Egg of Arctoscopus japonicus Korea - MH498449 MN868918 MH498487 -
Apiospora arctoscopi KUC 21344 - - MH498528 - MN868919 MH498486 -
Apiospora arctoscopi KUC 21347 - - MH498525 - MN868922 MH498483 -
Apiospora arundinis CBS 114316 Hordeum vulgare Iran KF144884 KF144928 KF145016 KF144974 -
Apiospora arundinis CBS 106.12 - - KF144883 KF144927 KF145015 KF144973 -
Apiospora arundinis CBS 732.71 - - KF144889 KF144934 KF145022 KF144980 -
Apiospora aurea CBS 244.83 Air Spain AB220251 KF144935 KF145023 KF144981 -
Apiospora balearica CBS 145129 Poaceae Spain MK014869 MK014836 MK017946 MK017975 -
Apiospora neobambusae HMAS LC7106 - - KY494718 KY494794 KY806204 KY705186 -
Apiospora bambusicola MFLUCC20-0144 Schizostachyum brachycladum Thailand MW173030 MW173087 MW183262 - -
Apiospora biserialis CGMCC 3.20135 Bambusoideae sp. China MW481708 MW478885 MW522938 MW522955 -
Apiospora camelliae-sinensis LC5007 Camellia sinensis China KY494704 KY494780 KY705103 KY705173 -
Apiospora camelliae-sinensis LC8181 - - KY494761 KY494837 KY705157 KY705229 -
Apiospora chiangraiense MFLU 21-0046 - - MZ542520 MZ542524 - MZ546409 -
Apiospora chromolaenae MFLUCC 17-1505 Chromolaena odorata Thailand MT214342 MT214436 MT235802 - -
Apiospora cordylines GUCC 10027 - - MT040106 - MT040127 MT040148 -
Apiospora cyclobalanopsidis CGMCC 3.20136 Cyclobalanopsis glauca China MW481713 MW478892 MW522945 MW522962 -
Apiospora cyclobalanopsidis GZCC:20-0103 - - MW481714 - MW522946 MW522963 -
Apiospora descalsii CBS 145130 Ampelodesmos mauritanicus Spain MK014870 MK014837 MK017947 MK017976 -
Apiospora dichotomanthi CGMCC 3.18332 Dichotomanthes tristaniiaecarpa China KY494697 KY494773 KY705096 KY705167 -
Apiospora esporlensis CBS 145136 Phyllostachys aurea Spain MK014878 MK014845 MK017954 MK017983 -
Apiospora esporlensis 18TJAM004 - - MT856406 - MT881953 MT881991 -
Apiospora euphorbiae IMI 285638b Bambusoideae sp. Bangladesh AB220241 AB220335 - AB220288 -
Apiospora euphorbiae ZHKUCC 22-0001 - - OM728647 OM486971 OM543543 OM543544 -
Apiospora fermenti KUC 21289 - - MF615226 - MH544667 MF615231 -
Apiospora fermenti KUC 21288 - - MF615230 - MH544668 MF615235 -
Apiospora fujianensis CGMCC3.25647 Bambusoideae sp. China PP159026 PP159034 PP488454 PP488470 -
Apiospora fujianensis CGMCC3.25648 Bambusoideae sp. China PP159027 PP159035 PP488455 PP488471 -
Apiospora fuzhouensis CGMCC3.25649 Bambusoideae sp. China PP159028 PP159036 PP488456 PP488468 -
Apiospora fuzhouensis CGMCC3.25650 Bambusoideae sp. China PP159029 PP159037 PP488457 PP488469 -
Apiospora gaoyouensis CFCC52301 Phragmites australis China MH197124 - MH236793 MH236789 -
Apiospora garethjonesii JHB004 Culms of dead bamboo China KY356086 KY356091 - - -
Apiospora garethjonesii SICAUCC 22-0028 - - ON228606 ON228662 - ON237654 -
Apiospora garethjonesii SICAUCC 22-0027 - - ON228603 ON228659 - ON237651 -
Apiospora gelatinosa HKAS 111962 Culms of dead bamboo China MW481706 MW478888 MW522941 MW522958 -
Apiospora guiyangensis HKAS 102403 Dead culms of Poaceae China MW240647 MW240577 MW759535 MW775604 -
Apiospora guizhouensis CGMCC 3.18334 Air in karst cave China KY494709 KY494785 KY705108 KY705178 -
Apiospora guizhouensis KUMCC 20-0206 - - MT946347 MT946341 MT947364 MT947370 -
Apiospora hainanensis SAUCC 1681 Leaf of bamboo China OP563373 OP572422 OP573262 OP573268 -
Apiospora hispanica IMI 326877 Maritime sand Spain AB220242 AB220336 - AB220289 -
Apiospora hydei CBS 114990 Bambusoideae sp. China KF144890 KF144936 KF145024 KF144982 -
Apiospora hydei LC 7103 - - KY494715 KY494791 KY705114 KY705183 -
Apiospora hyphopodii SICAUCC 22-0034 - - ON228605 ON228661 - ON237653 -
Apiospora hysterina ICMP 6889 Bambusoideae sp. New Zealand MK014874 MK014841 MK017951 MK017980 -
Apiospora hysterina KUC21438 - - ON764019 ON787758 ON806623 ON806633 -
Apiospora iberica CBS 145137 Arundo donax Portugal MK014879 MK014846 MK017955 MK017984 -
Apiospora intestini CBS 135835 Gut of grasshopper India KR011352 KR149063 KR011351 KR011350 -
Apiospora intestini MFLU:21-0045 - - MZ542521 MZ542525 MZ546406 MZ546410 -
Apiospora italica AP29118 - - MK014881 MK014848 MK017957 MK017986 -
Apiospora jatrophae CBS 134262 Jatropha podagrica India JQ246355 - - - -
Apiospora jiangxiensis CGMCC 3.18381 Maesa sp. China KY494693 KY494769 KY705092 KY705163 -
Apiospora jiangxiensis SICAU 22-0070 - - ON227094 ON227098 ON244431 ON244432 -
Apiospora kogelbergensis CBS 113332 Cannomois virgata South Africa KF144891 KF144937 KF145025 KF144983 -
Apiospora kogelbergensis CBS 117206 - - KF144895 KF144941 KF145029 KF144987 -
Apiospora koreana KUC 21332 Egg of Arctoscopus japonicus Korea MH498524 - MH544664 MH498482 -
Apiospora koreana KUC21350 - - MH498521 - MN868929 MH498479 -
Apiospora locuta-pollinis LC11683 Brassica campestris China MF939595 - MF939616 MF939622 -
Apiospora locuta-pollinis KUNCC:22-12409 - - OP377737 OP377744 OP381091 - -
Apiospora longistroma MFLU 15-1184 Culms of decaying bamboo Thailand KU940141 KU863129 - - -
Apiospora malaysiana CBS 102053 Macaranga hullettii Malaysia KF144896 KF144942 KF145030 KF144988 -
Apiospora malaysiana CBS:251.29 - - KF144897 KF144943 KF145031 KF144989 -
Apiospora marianiae AP18219 Dead stems of Phleum pratense Spain ON692406 ON692422 ON677180 ON677186 -
Apiospora marii CBS 497.90 Air Spain MH873913 KF144947 KF145035 KF144993 -
Apiospora marii CBS 200.57 - - KF144900 KF144946 KF145034 KF144992 -
Apiospora marina KUC 21328 Seaweed Korea MH498538 MH498458 MH544669 MH498496 -
Apiospora mediterranea IMI 326875 Air Spain AB220243 AB220337 - AB220290 -
Apiospora minutispora 17E 042 Soil Korea LC517882 - LC518889 LC518888 -
Apiospora montagnei LSU0093 - - MT000394 MT000490 - - -
Apiospora mori MFLU 18-2514 Dead leaves of Morus australis China MW114313 MW114393 - - -
Apiospora mori NCYU 19-0364 - - MW114314 MW114394 - - -
Apiospora mukdahanensis MFLUCC 22-0056 - - OP377735 OP377742 OP381089 - -
Apiospora multiloculata MFLUCC 21-0023 Dead culms of Bambusae Thailand OL873137 OL873138 - OL874718 -
Apiospora mytilomorpha DAOM 214595 Dead blades of Andropogon sp. India KY494685 - - - -
Apiospora neobambusae LC7124 - - KY494727 KY494803 KY806206 KY705195 -
Apiospora neochinense CFCC 53036 Fargesia qinlingensis China MK819291 - MK818545 MK818547 -
Apiospora neogarethjonesii HKAS 102408 Dead culms of Bambusae China MK070897 MK070898 - - -
Apiospora neosubglobosa SICAUCC 22-0039 - - ON228614 ON228670 - ON237662 -
Apiospora obovata CGMCC 3.18331 Lithocarpus sp. China KY494696 KY494772 KY705095 KY705166 -
Apiospora obovata LC8177 - - KY494757 KY494833 KY705153 KY705225 -
Apiospora ovata CBS 115042 Arundinaria hindsii China KF144903 KF144950 KF145037 KF144995 -
Apiospora paraphaeosperma MFLUCC13-0644 Dead clumps of Bambusa sp. Thailand KX822128 KX822124 - - -
Apiospora phragmitis CBS 135458 Phragmites australis Italy KF144909 KF144956 KF145043 KF145001 -
Apiospora phragmitis AP29717A - - MK014892 MK014859 MK017968 MK017997 -
Apiospora phyllostachydis MFLUCC 18-1101 Phyllostachys heteroclada China MK351842 MH368077 MK340918 MK291949 -
Apiospora piptatheri CBS 145149 Piptatherum miliaceum Spain MK014893 MK014860 - - -
Apiospora piptatheri KUC21279 - - MF615229 - MH544671 MF615234 -
Apiospora pseudoparenchymatica CGMCC 3.18336 Bambusoideae sp. China KY494743 - KY705139 KY705211 -
Apiospora pseudorasikravindrae KUMCC 20-0208 - - MT946344 - MT947361 MT947367 -
Apiospora pseudorasikravindrae KUMCC 20-0211 - - MT946345 - MT947362 MT947368 -
Apiospora pseudosinensis CPC 21546 Leaf of bamboo The Netherlands KF144910 KF144957 KF145044 MN868936 -
Apiospora pseudospegazzinii CBS 102052 Macaranga hullettii Malaysia KF144911 KF144958 KF145045 KF145002 -
Apiospora pterosperma CBS 134000 Machaerina sinclairii Australia KF144913 KF144960 KF145046 KF145004 -
Apiospora pusillisperma KUC 21321 Seaweed Korea MH498533 MH498453 MN868930 MH498491 -
Apiospora qinlingensis CFCC 52303 Fargesia qinlingensis China MH197120 - MH236795 MH236791 -
Apiospora rasikravindrae LC5449 Soil in karst cave China KY494713 KY494789 KY705112 KY705182 -
Apiospora rasikravindrae AP10418 - - MK014896 MK014863 - MK017999 -
Apiospora sacchari CBS 212.30 Phragmites australis UK KF144916 KF144962 KF145047 KF145005 -
Apiospora sacchari CBS:664.74 - - KF144919 KF144965 KF145050 KF145008 -
Apiospora saccharicola CBS 191.73 Air The Netherlands KF144920 KF144966 KF145051 KF145009 -
Apiospora sargassi KUC 21228 Sargassum fulvellum Korea KT207746 - MH544677 KT207644 -
Apiospora sasae CBS 146808 Dead culms of Sasa veitchii The Netherlands MW883402 MW883797 MW890104 MW890120 -
Apiospora septata CGMCC 3.20134 Bambusoideae sp. China MW481711 MW478890 MW522943 MW522960 -
Apiospora serenensis IMI 326869 - Spain AB220250 AB220344 - AB220297 -
Apiospora serenensis ATCC 76309 - - AB220240 AB220334 - AB220287 -
Apiospora setariae CFCC 54041 Decaying culms of Setaria viridis China MT492004 - - - -
Apiospora setostroma KUMCC 19-0217 Dead branches of bamboo China MN528012 MN528011 MN527357 - -
Apiospora sichuanensis HKAS 107008 Dead culms of Poaceae China MW240648 MW240578 MW759536 MW775605 -
Apiospora sorghi URMBRA 9300 Sorghum bicolor Brazil MK371706 - - MK348526 -
Apiospora sphaerosperma CBS114314 Leaf of Hordeum vulgare Iran KF144904 KF144951 KF145038 KF144996 -
Apiospora sphaerosperma CBS 142.55 - - KF144908 KF144955 KF145042 AB220303 -
Apiospora stipae CBS 146804 Stipa gigantea Spain MW883403.1 MW883798.1 - MW890121.1 -
Apiospora subglobosa MFLUCC 11-0397 Dead culms of bamboo Thailand KR069112 KR069113 - - -
Apiospora subrosea CGMCC 3.18337 Bambusoideae sp. China KY494752 KY494828 KY705148 KY705220 -
Apiospora subrosea LC 7291 - - KY494751 KY494827 KY705147 KY705219 -
Apiospora taeanensis KUC 21322 Seaweed Korea MH498515 - MH544662 MH498473 -
Apiospora taeanensis KUC 21359 - - MH498513 - MN868935 MH498471 -
Apiospora thailandica MFLUCC 15-0202 - - KU940145 KU863133 - - -
Apiospora thailandica MFLUCC 15-0199 - - KU940146 KU863134 - - -
Apiospora tropica MFLUCC 21–0056 - - OK491657 OK491653 - OK560922 -
Apiospora vietnamensis IMI 99670 Citrus sinensis Vietnam KX986096 KX986111 - KY019466 -
Apiospora xenocordella CBS 478.86 Soil from roadway Zimbabwe KF144925 KF144970 KF145055 KF145013 -
Apiospora xenocordella LC3486 - - KY494687 KY494763 KY705086 KY705158 -
Apiospora yunnana MFLUCC 150002 Culms of Decaying bamboo China KU940147 KU863135 - - -
Apiospora yunnana SICAU 22-0072 - - ON227096 ON227100 ON244425 ON244426 -

Notes: newly generated sequences are in bold.

2.3. Phylogenetic Analyses

Based on maximum likelihood (ML) and Bayesian inference (BI) analyses, phylogenetic trees were constructed to explore the phylogeny relationships of the fungal strains, grouping them into either the Magnaporthaceae or Apiosporaceae families. Corresponding gene loci of the reference sequences were downloaded from GenBank. Ophioceras dolichostomum (CBS 114926) was selected as an outgroup taxonomic unit for the phylogeny of Magnaporthaceae, and Sporocadus trimorphus (CBS 114203) was selected as an outgroup taxonomic unit for the phylogeny of Apiosporaceae. All sequences were aligned using the MAFFT v. 7 online service (http://mafft.cbrc.jp/alignment/server/, accessed on 2 February 2024) [36] and manually adjusted in BioEdit v.7.2.6.1 [37] and MEGA 7.0 [35].

In addition, four simultaneous Markov Chain Monte Carlo (MCMC) chains, starting with 2,000,000 generations of random trees, were sampled every 100th generation, resulting in a total of 20,000 trees. The first 25% of trees were discarded as burn-in of each analysis. Branches with significant Bayesian Posterior Probabilities (BYPP > 0.90) were estimated in the remaining 15,000 trees [38]. Phylogenetic trees were plotted with FigTree v.1.4.4 [39] and embellished with Adobe Illustrator CS6. New sequences generated in this study have been deposited in GenBank (https://www.ncbi.nlm.nih.gov, accessed on 19 March 2024).

3. Results

3.1. Phylogenetic Analyses

Samples of bamboo plants showing obvious fungal growth were collected from the Baizhu Garden of Fujian Agriculture and Forestry University and West Lake Park of Fuzhou City, Fujian Province, China. A total of eight fungal isolates with different morphological appearances were single-colony purified. For each fungal isolate, ~2637 bp of nucleotide sequences corresponding to portions of the ITS, LSU, rpb1, and tef1-αloci (ITS: 1–369; LSU: 370–1146; rpb1: 1147–1893; tef1-α: 1894–2775) were isolated. Based upon initial BLAST results, four of these sequences were isolated, combined with sequences from 68 closely related species as determined by BLAST searches, as well as homologous regions from Ophioceras dolichostomum (CBS 114926) and Ophioceras leptosporum (CBS 894.70) (Ophioceraceae, Magnaporthales) used as the outgroup for phylogenetic analyses. These analyses showed 1297 distinct patterns, with 1349 bp identical, 614 variable, including gaps, and 812 bp which were parsimony-informative. Maximum likelihood phylogenies were inferred using IQ-TREE under the TIM2 + R4 + F model for 5000 ultrafast bootstraps, as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test [nst = 6, rates = invgamma], with an average standard deviation of split frequencies = 0.005812. The topological results obtained from the ML analysis were consistent with the results of the BI analysis connecting the combined datasets. As a result, the ML tree is shown, and the BI posterior probabilities are placed on it (Figure 1). Based on phylogenetic resolution and morphological analysis (given below), we report two of the four isolates as new species of Magnaporthaceae: Bifusisporella fujianensis and Bifusisporella bambooensis. The new species B. fujianensis was most closely related to B. sichuanensis (SICAUCC 22-0073) (ML-BS: 96%, BYPP: 0.76), and B. bambooensis to B. sorghi (URM 7442, URM 7864) (ML-BS: 100%, BYPP: 1).

Figure 1.

Figure 1

ML tree generated from combined ITS, LSU, rpb1, and tef1-α sequence data of Magnaporthaceae and Pyriculariaceae. The maximum likelihood (ML) bootstrap support values and Bayesian posterior probabilities (BYPP) bootstrap support values above 70% and 0.90 are shown at the first and second position. Species with sequences obtained in this study are in boldface and newly generated sequences were indicated in red. Ophioceras dolichostomum (CBS 114926) and O.leptosporum (CBS894.70) (Ophioceraceae) were used as the outgroup. Yellow-green strips represent different neighboring species.

Initial BLAST results of sequences derived from the remaining four isolates indicated placement of these within the Apiosporaceae family. Analyses using sequences derived from the four genetic loci examined, namely the ITS + LSU + tef1-α + tub2 concatenated sequence dataset which had an aligned length of 1941 total characters (ITS: 1–507, LSU: 508–1341, tub2: 1342–1830, tef1-α: 1831–1941), supported the classification of two of the isolates as new species. Based on these and morphological data (below), a new species, Apiospora fujianensis, was identified, related to A. garethjonesii (SICAUCC 22-0028), with good support (ML-BS: 93% and BYPP: 0.98). Designation of the other new species, A. fuzhouensis, was similarly strongly supported (100% ML/1 PP), with the species forming a separate branch within Apiospora. For A. fuzhouensis loci analyses, 924 distinct patterns were identified, with 1186 bp constant, 157 variable and included gaps, and 598 bp which were parsimony-informative. Maximum likelihood phylogenies were inferred using IQ-TREE [40], under the GTR + R3 + F model for 5000 ultrafast bootstraps [41], as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test [nst = 1, rates = invgamma] (Figure 2).

Figure 2.

Figure 2

Phylogram of Apiospora based on combined ITS, LSU, tef1-α, and tub2 genes. ML bootstrap support values (ML-BS ≥ 70%) and Bayesian posterior probability (BYPP ≥ 0.90) are shown as first and second position above nodes, respectively. Strains from this study are shown in red. Some branches were shortened according to the indicated multipliers.

3.2. Taxonomy

Bifusisporella fujianensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 3).

Figure 3.

Figure 3

Bifusisporella fujianensis (HMAS 352712). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia. (ik) Conidia. Scalebar = 10 µm (gk).

MycoBank: MB852815.

Etymology: Named after Fujian Province where the fungus was collected.

Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z. Y. Zhao (holotype HMAS352712; ex-type living culture CGMCC3.25651).

Description: Leaf spots irregularly shaped, sunken in the center, brown or tan in color. Conidiomata elevated on agar, solitary, spherical, gradually transitioning from white hyaline to black, conidiophores reduced to conidiophores cells. Conidiogenous cells were phialidic, solitary or aggregated, curved, elongated, cylindrical or rod-shaped, light brown, 8.9–14.3 × 5.8–8.1 µm. Conidia were dimorphic, falcate or curved moon-shaped, smooth or cracked surface, transparent in color, 0–3 septa, 37.3–56.3 × 3.6–5.7 µm, mean = 45.1 × 4.4 µm. No sexual morphology was observed.

Culture characteristics: Colonies flattened on PDA with feathery margins, white, on SNA surface and reverse, white. The calculated growth rate was 0.6 cm/day at 25 °C.

Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z. Y. Zhao (paratype HMAS352713; ex-paratype living culture CGMCC3.27206).

Notes: The strain of the genus Bifusisporella was identified as a new species; nucleotide comparison of ITS, LSU, tef1-α, and rpb1 (CGMCC3.25651) showed differences with the sequences of B. sichuanensis (SICAUCC 22-0071), similarities are 12.3% (64/522), 4.1% (33/797), 4.1% (36/884), and 8.5% (58/684). In addition, the asexual morph of B. sichuanensis was not observed and the sexual morph of B. fujianensis was not observed.

Bifusisporella bambooensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 4).

Figure 4.

Figure 4

Bifusisporella bambooensis (HMAS 352714). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia.(i,j) Conidia. Scalebar = 10 µm (gj).

MycoBank: MB852816.

Etymology: The epithet “bambooensis” refers to the host, which is bamboo.

Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (holotype HMAS352714; ex-type living culture CGMCC3.25653).

Description: Leaf spots were pike-shaped, color gradually changing from blackish brown to white from outside to inside, Conidiomata bulging on agar, black to hyaline, aggregated and spherical, conidiophores reduced to conidiophores cells. Conidiogenous cells were phialidic, singly or in groups, curved, elongated, cylindrical, 7.2–21.0 × 4.2–6.4 µm, conidia were dimorphic, falcate or curved moon-shaped, smooth or cracked surface, hyaline, 0–3 septa, 10.8–45.0 × 2.8–4.9 µm, mean = 25.0 × 3.7 µm. No sexual morphology was observed.

Culture characteristics: Colonies flattened on PDA, irregular black center, fading to white with white feathery margins, on SNA surface and reverse, white. Calculated growth rate was 1.0–1.4 cm/day at 25 °C. The growth rate was 0.5 cm/day.

Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z.Y. Zhao (paratype HMAS352715; ex-paratype living culture CGMCC3.27207).

Notes: Bifusisporella bambooensis is phylogenetically close (100% ML and 1BYPP), but distinct from B. sorghi (URM 7442). Compared to Bifusisporella sorghi, Bifusisporella bambooensis sp. nov. has larger conidiogenous cells and conidia (7.2–21.0 × 4.2–6.4 vs. 5.0–19.5 × 3.0–4.0 μm; 10.8–45.0 × 2.8–4.9 vs. 19.0–34.0 × 3.0–4.0 μm); nucleotide comparison of ITS, tef1-α and rpb1 (CGMCC3.25653) showed separation from B. sorghi (URM 7442), with differences of 6% (29/487), 5.3% (23/437), and 9.4% (65/693), respectively.

Apiospora fujianensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 5).

Figure 5.

Figure 5

Apiospora fujianensis (HMAS 352716). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fj) Conidiogenous cells and conidia. (k) Conidia. Scale bars = 10 µm (fk).

MycoBank: MB852818.

Etymology: Named after Fujian Province where the fungus was collected.

Holotype: China, Fujian Province, West Lake Park,119°17′47.09″ E,26°5′57.90″ N, from diseased leaves of bamboo in China, October 2022, J.H. Chen (holotype HMAS352716; ex-type living culture CGMCC3.25647).

Description: Leaf spots irregularly shaped, brown or tan in color. Conidiomata on agar were elevated, solitary or aggregated, spherical, black, conidiophores cells were solitary or aggregated, hyaline rounded, 3.5–5.8 × 3.5–5.2 µm. Conidia were rounded or ellipsoidal, contained globular contents, brown, 7.5–17.0 × 5.6–18.2 µm, mean = 14.0 × 11.6 µm. No sexual morphology was observed.

Culture characteristics: Colonies flattened on PDA, fluffy mycelium, black center with white margins over time; calculated growth rate of 1.3 cm/day at 25 °C.

Material examined: China, Fujian Province, West Lake Park, 119°17′47.09″ E, 26°5′57.90″ N, from diseased leaves of bamboo in China, October 2022, J.H. Chen (paratype HMAS352717; ex-paratype living culture CGMCC3.25648).

Notes: In the present study, two strains were obtained from diseased leaves of bamboo and differed from each other with a high degree of statistical support (BYPP = 0.98 and ML-BS = 93%), although overall analyses indicated that both isolates represented different strains of the same species.

Apiospora fuzhouensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 6).

Figure 6.

Figure 6

Apiospora fuzhouensis (HMAS 352718). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fi) Conidiogenous cells and conidia. (j,k) Conidia. Scale bars = 10 µm (fk).

MycoBank: MB852820.

Etymology: Named after Fuzhou, Fujian Province, where the fungus was collected.

Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (holotype HMAS352718; ex-type living culture CGMCC3.25649).

Description: Leaf spots irregular in shape, brown or tan in color. Conidiomata on agar are elevated, solitary or aggregated, spherical, black, Conidiophores hyaline to light brown, smooth, fusiform, subcylindrical, conidiophore cells were solitary or aggregated, hyaline rounded, 1.5–9.1 × 2.4–7.2 µm. Conidia were rounded or ellipsoidal, brownish, 11.3–19.3 × 8.7–19.5 µm, mean = 14.8 × 14.4 µm. No sexual forms were observed.

Culture characteristics: Colonies flattened on PDA; mycelium fluffy, black; calculated growth rate 1.2 cm/day.

Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (paratype HMAS352719; ex-paratype living culture CGMCC3.25650).

Notes: Two strains were obtained from diseased leaves of bamboo and differed from each other with a high degree of statistical support (100% ML/1 PP, Figure 2), although overall analyses indicated that both isolates represented different strains of the same species. The nucleotide comparison of ITS sequences of A. garethjonesii (SICAUCC 22-0028) revealed 39 bp (39/542 bp, 7.2%) nucleotide differences. The nucleotide comparison of tub2 sequences of A. garethjonesii (SICAUCC 22-0028) revealed 20 bp (20/524 bp, 3.8%) nucleotide differences. Morphologically, the conidia of A. fuzhouensis were slightly smaller than those of A. garethjonesii (SICAUCC 22-0028). Therefore, the two strains are proposed as a new species.

4. Discussion

As interest in bamboo has intensified due to its wide range of beneficial environmental effects as well as agricultural, industrial, and even foodstuff uses, identification of pathogens, that can decrease quality and/or yield of the plant has also gained interest. Here, we have identified four new species of fungi from diseased bamboo leaves found in Fujian Province, China. Identification was conducted using morphological and molecular phylogenetic analyses, with the former, i.e., characterization of the conidiomata, conidiophores, and conidiogenous cells used as important lines of evidence supporting species identification [42] and the latter (molecular approaches) allowing for phylogenetic placement and confirmation of new species designations.

Two of new species were identified as belonging to the Bifusisporella genus. Previously, Silva et al. isolated an endophyte, Bifusisporella sorgh, from healthy sorghum leaves in Brazil [15], and another endophyte, B. sichuanensis, has been reported from leaves of Sichuan poplar [43]. Most Bifusisporella species have sickle-shaped ditype conidia and are commonly found in Poaceae. The newly described species in this report, B. fujianensis, grouped with B. sichuanensis, but was distinct from the latter in both morphology and multilocus sequence analyses, whereas B. bambooensis potentially represents a separate clade. Morphological differences between the species were evident, particularly concerning the conidia (Table 3).

Table 3.

The location, hosts or substrate, and main morphological characters of Bifusisporella.

Species Location Host/Substrate Conidiogenous Cells Size of
Conidiophore Cells (µm)
Conidia Size of
Conidia (µm)
References
Bifusisporella bambooensis sp. nov. China Bambusoideae sp. Cylindrical 7.2–21.0 × 4.2–6.4 falcate or curved moon-shaped 10.8–45.0 × 2.8–4.9 In this study
Bifusisporella sorghi Brazil Sorghum bicolor Cylindrical orclavate 5.0–19.5 × 3.0–4.0 falcate Macroconidia
19.0–34.0 × 3.0–4.0
Microconidia
7.0–14.5 × 1.0–2.0
[15]
Bifusisporella fujianensis sp. nov. China Bambusoideae sp. Cylindricalor rod-shaped 8.9–14.3 × 5.8–8.1 falcate or curved moon-shaped 37.3–56.3 × 3.6–5.7 In this study
Bifusisporella sichuanensis China Phyllostachys edulis - - - - [43]

The remaining two new species identified in this report were found to belong to the Apiospora genus. Crous and Groenewald synonymized Apiospora with Arthrinium [44]; however, with additional genetic data from the Arthrinium type species, A. caricicola, Apiospora and Arthrinium were separated into two distinct genera [19]. Biogeographically, most specimen of Arthrinium have been found in temperate and boreal zones, whereas those of Apiospora have been mainly collected in tropical and subtropical regions, with the latter genus displaying a relatively wider distribution area. Currently, therefore, based on the molecular phylogenetic analysis of multigene loci (ITS, LSU, and exon sequences of tef1-α and tub2), Arthrinium and Apiospora are considered to represent independent lineages within the Apiosporaceae [19], confirming that the overall genetic, morphological, and ecological differences between Apiospora and Arthrinium are sufficient to support the taxonomic separation of the two genera. Apiospora are characterized by round/lenticular conidia, which are mainly found in Poaceae. Based on morphology and molecular analyses, Apiospora fujianensis sp. nov. and Apiospora fuzhouensis sp. nov. were described as two new species within Apiospora.

As a neo-tropical region, fungal species diversity in Fujian and surrounding areas appears particularly robust [26,27]. However, thus far, only a few species of fungi have been found in bamboo leaves, with our understanding of the diversity of fungal parasitism on bamboo incomplete. This is likely due to bamboo being particularly hardy and resistant to many microorganisms combined with a lack of specimen and data support [45]. These factors necessitate the collection of diverse specimens [5], as well as exploring the reaction/defense by the plant. Here, we provide candidate fungi, with further genomic and physiological studies aimed towards understanding the nature of these fungi on bamboo warranted.

Acknowledgments

We would like to thank Sen Liu, Chengjie Xiong, Longbin Lin, Weibin Zhang, Jinhui Chen, Pengyu Lai, Zhiang Heng, Ziyi Wu, Ruiya Chen, Chenjie Yang, and Mengjia Zhu for their help with sample collection.

Author Contributions

Conceptualization, Z.Z., X.G. and J.Q.; methodology, Z.Z. and T.M.; software, H.P. and Y.L.; validation, Z.L., J.X. and X.C.; formal analysis, X.Z.; investigation, H.L.; resources, P.J.; data curation, Z.Z., T.M., N.O.K., H.P., Y.L., Z.L., J.X., X.C., X.Z., H.L., M.Y.J.-S., P.J. and S.H.; writing—original draft preparation, Z.Z., T.M. and M.Y.J.-S.; writing—review and editing, Z.Z., N.O.K. and J.Q.; visualization, S.H.; supervision, X.G. and J.Q.; project administration, X.G. and J.Q.; funding acquisition, J.W., X.G. and J.Q. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All newly generated sequences were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 19 March 2024). All new taxa were linked with MycoBank (https://www.mycobank.org/ (accessed on 13 March 2024)).

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the National Natural Science Foundation of China (No. 32270029, U1803232, 31670026), the National Key R & D Program of China (No. 2017YFE0122000), a Social Service Team Support Program Project (No. 11899170165), Science and Technology Innovation Special Fund (Nos. KFB23084, CXZX2019059S, CXZX2019060G) of Fujian Agriculture and Forestry University, a Fujian Provincial Major Science and Technology Project (No. 2022NZ029017), an Investigation and evaluation of biodiversity in the Jiulong River Basin (No. 082·23259-15), and Macrofungal and microbial resource investigation project in Longqishan Nature Reserve (No. SMLH2024(TP)-JL003#).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Manandhar R., Kim J.H., Kim J.T. Environmental, social and economic sustainability of bamboo and bamboo-based construction materials in buildings. J. Asian Archit. Build. Eng. 2019;18:49–59. doi: 10.1080/13467581.2019.1595629. [DOI] [Google Scholar]
  • 2.Binfield L., Britton T.L., Dai C., Innes J. Evidence on the social, economic, and environmental impact of interventions that facilitate bamboo industry development for sustainable livelihoods: A systematic map protocol. Environ. Evid. 2022;11:33. doi: 10.1186/s13750-022-00286-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu W.Y., Hui C.M., Wang F., Wang M., Liu G.L. Review of the Resources and Utilization of Bamboo in China. Bamboo Curr. Future Prospect. 2018;8:133–142. doi: 10.5772/intechopen.76485. [DOI] [Google Scholar]
  • 4.Dlamini L.C., Fakudze S., Makombe G.G., Muse S., Zhu J. Bamboo as a valuable resource and its utilization in historical and modern-day China. BioResources. 2022;17:1926–1938. doi: 10.15376/biores.17.1.Dlamini. [DOI] [Google Scholar]
  • 5.Jiang H.B., Phookamsak R., Hongsanan S., Bhat D.J., Mortimer P.E., Suwannarach N., Kakumyan P., Xu J. A review of bambusicolous Ascomycota in China with an emphasis on species richness in southwest China. Stud. Fungi. 2022;7:20. doi: 10.48130/SIF-2022-0020. [DOI] [Google Scholar]
  • 6.Yu X.D., Zhang S.N., Liu J.K. Additions to Bambusicolous Fungi of Savoryellaceae from Southwest China. J. Fungi. 2023;9:571. doi: 10.3390/jof9050571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Thongkantha S., Jeewon R., Dhanasekaran V., Lumyong S., McKenzie E., Hyde K. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species, Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Divers. 2009;34:157–173. [Google Scholar]
  • 8.Luo J., Zhang N. Magnaporthiopsis, a new genus in Magnaporthaceae (Ascomycota) Mycologia. 2013;105:1019–1029. doi: 10.3852/12-359. [DOI] [PubMed] [Google Scholar]
  • 9.Klaubauf S., Tharreau D., Fournier E., Groenewald J.Z., Crous P.W., Vries R.P., Lebrun M. Resolving the polyphyletic nature of Pyricularia (Pyriculariaceae) Stud. Mycol. 2014;79:85–120. doi: 10.1016/j.simyco.2014.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Luo J., Walsh E., Zhang N. Four new species in Magnaporthaceae from grass roots in New Jersey Pine Barrens. Mycologia. 2014;106:580–588. doi: 10.3852/13-306. [DOI] [PubMed] [Google Scholar]
  • 11.Luo J., Walsh E., Zhang N. Toward monophyletic generic concepts in Magnaporthales: Species with Harpophora asexual states. Mycologia. 2015;107:641–646. doi: 10.3852/14-302. [DOI] [PubMed] [Google Scholar]
  • 12.Liu J.K., Hyde K.D., Jones E.B.G., Ariyawansa H.A., Bhat D.J., Boonmee S., Maharachchikumbura S.S.N., McKenzie E.H.C., Phookamsak R., Phukhamsakda C., et al. Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Divers. 2015;72:1–197. doi: 10.1007/s13225-015-0324-y. [DOI] [Google Scholar]
  • 13.Crous P.W., Wingfield M., Guarro J., Hernández-Restrepo M., Sutton D., Acharya K., Barber P., Boekhout T., Dimitrov R., Dueñas M., et al. Fungal Planet description sheets: 320–370. Persoonia. 2015;34:167–266. doi: 10.3767/003158515X688433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hernández-Restrepo M., Groenewald M., Elliott M.L., Canning G., McMillan V., Crous P.W. Take-all or nothing. Stud. Mycol. 2016;83:19–48. doi: 10.1016/j.simyco.2016.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Silva R.M.F., Oliveira R.J.V., Bezerra J.D.P., Bezerra J.L., Souza-Motta C.M., Silva G.A. Bifusisporella sorghi gen. et sp. nov. (Magnaporthaceae) to accommodate an endophytic fungus from Brazil. Mycol. Prog. 2019;18:847–854. doi: 10.1007/s11557-019-01494-2. [DOI] [Google Scholar]
  • 16.Pintos Á., Alvarado P. New studies on Apiospora (Amphisphaeriales, Apiosporaceae): Epitypification of Sphaeria apiospora, proposal of Ap. marianiae sp. nov. and description of the asexual morph of Ap. sichuanensis. MycoKeys. 2022;92:63–78. doi: 10.3897/mycokeys.92.87593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liao C.F., Senanayake I.C., Dong W., Thilini Chethana K.W., Tangtrakulwanich K., Zhang Y.X., Doilom M.K. Taxonomic and Phylogenetic Updates on Apiospora: Introducing Four New Species from Wurfbainia villosa and Grasses in China. J. Fungi. 2023;9:1087. doi: 10.3390/jof9111087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liu R.Y., Li D.H., Zhang Z.X., Liu S.B., Liu X.Y., Wang Y.X., Zhao H., Liu X.Y., Zhang X.G., Xia J.W., et al. Morphological and phylogenetic analyses reveal two new species and a new record of Apiospora (Amphisphaeriales, Apiosporaceae) in China. MycoKeys. 2023;95:27–45. doi: 10.3897/mycokeys.95.96400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pintos Á., Alvarado P. Phylogenetic delimitation of Apiospora and Arthrinium. Fungal Syst. Evol. 2021;7:197–221. doi: 10.3114/fuse.2021.07.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kwon S.L., Cho M., Lee Y.M., Lee H., Kim C., Kim G.H., Kim J.J. Diversity of the Bambusicolous Fungus Apiospora in Korea: Discovery of New Apiospora Species. Mycobiology. 2022;50:302–316. doi: 10.1080/12298093.2022.2133808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hyde K.D., Frohlich J., Taylor J.E. Fungi from palms. XXXVI. Reflections on unitunicate ascomycetes with apiospores. Sydowia. 1998;50:21–80. [Google Scholar]
  • 22.Zhang J.Y., Chen M.L., Boonmee S., Wang Y.X., Lu Y.Z. Four New Endophytic Apiospora Species Isolated from Three Dicranopteris Species in Guizhou, China. Fungal Divers. 2023;9:1096. doi: 10.3390/jof9111096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Tian X.G., Karunarathna S.C., Mapook A., Promputtha I., Xu J.C., Bao D.F., Tibpromma S. One New Species and Two New Host Records of Apiospora from Bamboo and Maize in Northern Thailand with Thirteen New Combinations. Life. 2021;11:1071. doi: 10.3390/life11101071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Su D., Zhang W.H., Sun R., Zhang Z.T., Lyu G. First Report of Botryosphaeria dothidea Causing Leaf Spot on Kadsura coccinea in China. Plant Dis. 2021;105:2714. doi: 10.1094/PDIS-01-21-0150-PDN. [DOI] [Google Scholar]
  • 25.Zhang Z.X., Liu X.Y., Tao M.F., Liu X.Y., Xia J.W., Zhang X.G., Meng Z. Taxonomy, Phylogeny, Divergence Time Estimation, and Biogeography of the Family Pseudoplagiostomataceae (Ascomycota, Diaporthales) J. Fungi. 2023;9:82. doi: 10.3390/jof9010082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu S., Zhu M., Keyhani N.O., Wu Z., Lv H., Heng Z., Chen R., Dang Y., Yang C., Chen J., et al. Three New Species of Russulaceae (Russulales, Basidiomycota) from Southern China. J. Fungi. 2024;10:70. doi: 10.3390/jof10010070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mu T., Chen J., Zhao Z., Zhang W., Stephenson S.L., Yang C., Zhu M., Su H., Liu P., Guan X., et al. Morphological and phylogenetic analyzes reveal two new species of Melanconiella from Fujian Province, China. Front. Microbiol. 2023;14:1229705. doi: 10.3389/fmicb.2023.1229705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.White T.J., Bruns T.D., Lee S.B., Taylor J.W. Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J., editors. PCR Protocols: A Guide to Methods and Applications. Academic Press; New York, NY, USA: 1990. pp. 315–322. [DOI] [Google Scholar]
  • 29.Vilgalys R., Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990;172:4238–4246. doi: 10.1128/jb.172.8.4238-4246.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Matheny P.B., Liu Y.J., Ammirati J.F., Hall B.D. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales) Am. J. Bot. 2002;89:688–698. doi: 10.3732/ajb.89.4.688. [DOI] [PubMed] [Google Scholar]
  • 31.Castlebury L., Rossman A., Sung G., Hyten A., Spatafora J. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004;108:864–872. doi: 10.1017/S0953756204000607. [DOI] [PubMed] [Google Scholar]
  • 32.Rehner S.A., Buckley E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia. 2005;97:84–98. doi: 10.3852/mycologia.97.1.84. [DOI] [PubMed] [Google Scholar]
  • 33.O’Donnell K., Kistler H.C., Cigelnik E., Ploetz R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA. 1998;95:2044–2049. doi: 10.1073/pnas.95.5.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Glass N.L., Donaldson G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995;61:1323–1330. doi: 10.1128/aem.61.4.1323-1330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kumar S., Stecher G., Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Katoh K., Rozewicki J., Yamada K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019;20:1160–1166. doi: 10.1093/bib/bbx108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.He J., Han X., Luo Z.L., Xian L., Tang S.M., Luo H.M., Niu K.Y., Su X.J., Li S.H. Species diversity of Ganoderma (Ganodermataceae, Polyporales) with three new species and a key to Ganoderma in Yunnan Province, China. Front. Microbiol. 2022;13:1035434. doi: 10.3389/fmicb.2022.1035434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hall T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999;41:95–98. doi: 10.1021/bk-1999-0734.ch008. [DOI] [Google Scholar]
  • 39.Rani A.K., Hina S., Iqbal H., Shabbir Z., Izhar A., Usman M., Khalid A.N. Identification and taxonomic position of a new Pseudoomphalina species from Pakistan based on light, scanning electron microscopy, and molecular analysis. Microsc. Res. Tech. 2023;86:1144–1153. doi: 10.1002/jemt.24387. [DOI] [PubMed] [Google Scholar]
  • 40.Nguyen L.T., Schmidt H., von Haeseler A., Minh B. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2014;32:268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Minh B.Q., Nguyen M.A., von Haeseler A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013;30:1188–1195. doi: 10.1093/molbev/mst024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Hughes S.J. Conidiophores, conidia, and classification. Can. J. Bot. 2011;31:577–659. doi: 10.1139/b53-046. [DOI] [Google Scholar]
  • 43.Zeng Q., Lv Y.C., Xu X.L., Deng Y., Wang F.H., Liu S.Y., Liu L.J., Yang C.J., Liu Y.G. Morpho-Molecular Characterization of Microfungi Associated with Phyllostachys (Poaceae) in Sichuan, China. J. Fungi. 2022;8:702. doi: 10.3390/jof8070702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Crous P.W., Groenewald J.Z. A phylogenetic re-evaluation of Athrinium. IMA Fungus. 2013;4:133–154. doi: 10.5598/imafungus.2013.04.01.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Alves-Silva G., Drechsler-Santos E.R., da Silveira R.M. Bambusicolous Fomitiporia revisited: Multilocus phylogeny reveals a clade of host-exclusive species. Mycologia. 2020;112:633–648. doi: 10.1080/00275514.2020.1741316. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All newly generated sequences were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 19 March 2024). All new taxa were linked with MycoBank (https://www.mycobank.org/ (accessed on 13 March 2024)).


Articles from Journal of Fungi are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES