Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 May 31;103(9):103908. doi: 10.1016/j.psj.2024.103908

Synergistic effects of oral inoculation with a recombinant Lactobacillus plantarum NC8 strain co-expressing interleukin-2 and interleukin-17B on the efficacy of the infectious bronchitis vaccine in chickens

Shaohua Guo *, Junjie Peng †,‡, Yongle Xiao §, Jianlin Chen #, Rong Gao †,1
PMCID: PMC11279255  PMID: 38981363

Abstract

Mucosal vaccination strategies are easier to implement than others in large-scale poultry farming. However, the adjuvants that are approved for veterinary use, which are predominantly aluminum- and oil-emulsion-based adjuvants, are not suitable for mucosal vaccination and carry a risk of adverse reactions. In this study, we engineered a novel Lactobacillus plantarum NC8 strain that co-expresses chicken interleukin-2 (IL-2) and IL-17B, which we designated NC8-ChIL2-17B, and evaluated its potential as an oral immunoadjuvant. The immunomodulatory properties of NC8-ChIL2-17B were evidenced by its ability to activate macrophages and inhibit the proliferation of infectious bronchitis virus (IBV) in vitro. We then confirmed its immunoadjuvant activity in vivo by orally administering NC8-ChIL2-17B along with a commercial IBV vaccine to chicks. The results indicated that NC8-ChIL2-17B enhanced the immune response elicited by the IBV vaccine and increased the levels of IBV-specific IgG and sIgA antibodies produced in response to IBV infection. Additionally, administration of NC8-ChIL2-17B promoted weight gain and beneficially modulated the gut microbiota, resulting in improved chicken performance. These findings suggest that oral administration of NC8-ChIL2-17B is a promising strategy to enhance the immune efficacy of the IBV vaccine in chickens, offering an efficacious alternative adjuvant.

Key words: Lactobacillus plantarum, cytokine, IBV vaccine, oral administration, chicken

INTRODUCTION

Infectious bronchitis virus (IBV), a major pathogen of commercial poultry, causes respiratory and kidney damage in chicks and adversely affects egg production and the quality of both eggs and chicken meat (Zhao, et al., 2023). Vaccination is one of the most cost-effective strategies for controlling infectious diseases in poultry, and vaccine adjuvants augment and prolong the immune response, thereby bolstering vaccine-induced protection. For large-scale poultry farming, mucosal vaccination strategies, such as nasal drops and vaccine-containing drinking water, are easier to implement than other vaccination routes. However, most traditional adjuvants, such as aluminum- and oil-emulsion-based adjuvants, are not only unsuitable for mucosal vaccines but also carry a risk of adverse reactions, including anaphylaxis, fever, inflammation, and tissue sensitivity, which can compromise meat quality and animal welfare (Deville, et al., 2012; Zhou, et al., 2020). This underscores the urgent need to develop safe and efficient adjuvants for use in mucosal vaccination strategies.

Cytokines are natural immunoregulatory molecules that play crucial roles in regulating cellular and humoral responses to pathogenic challenge. The potential of cytokines as immunoadjuvants to enhance vaccine efficacy has been recognized for decades (Tovey and Lallemand, 2010). Several cytokines, including IL-1β, IFN-γ, TNF α, IL-2, IL-18, GM-CSF, IFN-β, IL-12, IL-7, IL-18, and IL-15, can improve the efficacy of DNA- or subunit-based vaccines when administered via the intramuscular route (Rahman, et al., 2023). Despite the potential of cytokines as mucosal adjuvants, their practical application is limited by their low stability and short half-life. To overcome these limitations, bacteria of the probiotic genus Lactobacillus, which can tolerate gastric acid and bile salts and persist within the intestines for several days, has been considered a promising system for mucosal delivery. The Lactobacillus plantarum strain NC8 (NC8) has been validated as an effective carrier for delivering pathogenic antigens to chickens (Shi, et al., 2016). Our previous study showed the immune-enhancing properties of an NC8 strain expressing the chicken cytokine IL-17B for oral IBV vaccination (Guo, et al., 2020). IL-17B, a member of the IL-17 family that plays a key role in mucosal immunity, is highly expressed in intestinal epithelial cells (Song, et al., 2016). Therefore, IL-17B is a promising adjuvant candidate for chicken mucosal vaccines.

Immune responses are regulated via multiple cytokines, which often have synergistic effects. Researchers have shown that co-expression of 2 cytokines can induce a stronger immunoregulatory efficacy than a single cytokine (Rahman et al., 2023). The present study explored the synergistic immune potential of IL-2 and IL-17B co-expression. The first cloned cytokine, IL-2, is essential for inducing the proliferation of T and NK cells and the generation of effector and memory cells (Abbas, et al., 2018). IL-2 was extensively investigated as an adjuvant for vaccines against numerous pathogens, such as rabies virus (Nunberg, et al., 1989), herpes simplex virus (Inoue, et al., 2002), influenza virus (Henke, et al., 2006), hepatitis B virus (Chow, et al., 1997), human immunodeficiency virus (Barouch, et al., 2000), SARS-CoV (Hu, et al., 2009), and viruses causing foot-and-mouth disease (Zhang, et al., 2011) in mouse, swine, and rhesus macaque models (Abbas et al., 2018). Chicken IL-2 has been confirmed to be an effective adjuvant for vaccines against infectious bursal disease viruses (Huo, et al., 2019), coccidia (Tan, et al., 2024), and IBV (Huo, et al., 2019). However, the adjuvant efficacy of IL-2 combined with IL-17B in the chicken mucosal system remains unclear.

In this study, we constructed a recombinant NC8 strain, designated NC8-ChIL2-17B, which was engineered to express a fusion protein comprising chicken IL-2 and IL-17B. We then tested the effectiveness of NC8-ChIL2-17B as an oral adjuvant to augment the efficacy of the IBV vaccine. Finally, we assessed the immunoregulatory efficacy of NC8-ChIL2-17B in vitro and its immunoadjuvant activities in specific pathogen-free (SPF) chickens immunized with an attenuated IBV vaccine.

MATERIAL AND METHODS

Construction of Recombinant Strain NC8-ChIL2-17B

To construct the recombinant strain NC8-ChIL2-17B, we obtained the coding sequences of chicken Il-2 and Il-17b from GenBank (Accession Nos. AF000631.1 and XM_015293704.1, respectively). The sequence of the signal peptide of Il-2, predicting using SignaIP 6.0 (DTU Health Tech), was removed as were the termination codons for both Il-2 and Il-17b. Codon optimization was performed using JCat (http://jcat.de) to ensure compatibility with the codon usage in L. plantarum. The signal peptide sequence (SPUsp45) from L. lactis MG1363 (accession No. AM406671, site: 2462440–2463825) was added to the 5′ end of the Il2 gene to facilitate surface expression of the fusion protein in L. plantarum. Then, the Il-17b gene was fused to the 3′ terminus of the Il2 gene. Finally, a 6 × His-Tag sequence (CACCACCACCACCACCAC) was added to the 3′ terminus of the Il-17b gene, just before the termination codon, for easy detection of the fusion protein using an anti-His-Tag antibody. A linker gene fragment (GGTTCTGGTGGTTCTGGTTCTGGTGGTTCT) was added to separate each gene segment. The resultant recombinant gene, ChIl2-17b, was synthesized by Genscript Biotechnology Company (Nanjing, China) and cloned into plasmid pMG36e, an E. coli-Lactobacillus shuttle vector (BioVector NTCC Inc., Beijing, China). The recombinant plasmid, pMG36e-ChIl2-17b, was verified through sequencing (Tsingke Biotechnology Company, Chengdu, China) and was subsequently transformed into strain NC8 using a Gene Pulser Xcell (Bio-Rad, Hercules, CA, USA) at 10 kV/cm, 25 µF, and 200 Ω. Positive transformants (named NC8-ChIL2-17B) were selected on de Man, Rogosa and Sharpe (MRS) medium (Solarbio Science & Technology Co., Ltd., Beijing, China) containing 10 µg/mL erythromycin after incubation at 37°C for approximately 24 h. The presence of the ChIl2-17b gene in NC8 was detected by PCR and agarose gel electrophoresis. The primer sequences used for PCR verification were as follows: forward primer: 5′-ATGAAAAAAAAGATTATCTCAGC-3′; reverse primer: 5′-TTAGTGGTGGTGGTGGTGG-3′. The comparative growth kinetics of NC8-ChIL2-17B and wild-type NC8 were assessed over a 48-hour period. Additionally, strains expressing CHIL2 and ChIL17B individually (NC8-ChIL2 and NC8-ChIL17B, respectively) and a control strain containing a nonrecombinant plasmid (NC8-P) were constructed for comparative analysis.

Analysis of ChIL2-17B Expression in NC8 by Western Blotting and ELISA

Expression of the ChIL2-17B fusion protein within NC8 cells was quantitatively evaluated using western blotting and a whole cell enzyme-linked immunosorbent assay (ELISA) with an anti-His-Tag monoclonal antibody (Abcam, Cambridge, MA). Briefly, the bacterial cells (NC8-ChIL2-17B and controls) were harvested by centrifuging 1 mL of fresh culture. Then, the cells were resuspended in PBS containing 1 mg/mL lysozyme. After freezing, thawing, and disruption using a high-performance ultrasonic sample-processing system (Covaris S220; Covaris, Woburn, MA), cell-free extracts were collected for western blotting and ELISA. For western blotting, the cell-free extract was separated using 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a 0.22 μm PVDF membrane (Biosharp, Beijing, China). The membrane was blocked with 10% defatted milk in buffer to avoid non-specific binding, and first incubated with the anti-His-Tag monoclonal antibody, and then with horseradish peroxidase (HRP)-labeled goat anti-mouse immunoglobulin G with heavy and light chains [IgG (H + L)] (Proteintech, Wuhan, China). Detection was performed using a ChemiDoc Touch system (Bio-Rad, Hercules, CA, USA). For whole-cell ELISA (Lin, et al., 2012), live recombinant NC8-ChIL2-17B cells were fixed with polyformaldehyde solution and blocked with 5% BSA at room temperature. The fixed cells were incubated with a diluted primary anti-His-Tag mouse IgG monoclonal antibody, and then with HRP-conjugated anti-mouse IgG (H+L) as the secondary antibody. The bacterial cells were resuspended in a blank ELISA plate, and TMB chromogenic substrate was added. The optical density was measured at a wavelength of 650 nm using a Spectramax i3X microplate reader (Molecular Devices, Sunnyvale, CA), and the data were analyzed using Softmax Pro software. NC8-P served as a negative control. The expression level of rChIL-2-17B in cell-free extracts was determined using a His-Tag ELISA Detection Kit (GenScript Biotech, Nanjing, China) according to the manufacturer's instructions.

Quantitative PCR Analysis of Macrophage Activation Following Stimulation With NC8-Chil2-17B

The chicken macrophage cell line HD11 was utilized to assess the in vitro activation activity of recombinant ChIL2-17B, ChIL2, and ChIL17B expressed in NC8 cells. Briefly, HD11 cells were cultured in Dulbecco's modified eagle medium (DMEM; HyClone, Logan, UT) containing 10% heat-inactivated fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) in a 5% CO2 incubator at 41°C. Then, the cells were seeded in 6-well plates (Corning, Corning, NY) at a density of 105 cells/well and allowed to adhere overnight, when they reached approximately 75% confluence. Cultures of NC8-ChIL2-17B, NC8-ChIL2, NC8-ChIL17B, and control NC8-P cells were subjected to ultrasonic disruption and filtration through sterile 0.45 µm filters to eliminate bacterial debris. The protein concentration in the filtrates was quantified using a NanoDrop 2000 spectrophotometer, and each was diluted to a final concentration of 200 ng/mL protein in DMEM supplemented with 2% FBS. These preparations were then applied to the HD11 cells in the 6-well plates. PBS was used as a control. At 12, 24, and 48 h post-stimulation, the cells were harvested and lysed with TRIzol reagent for total RNA extraction according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). The extracted RNA was reverse-transcribed to cDNA using TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit (Transgen, Beijing, China). Primers for qPCR were designed based on the relevant gene sequences in GenBank (Table S1). Reactions were performed on a Bio-Rad CFX Connect Real-Time PCR System (Bio-Rad, Hercules, USA) using iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA). Each reaction mixture contained 5 µL of 20-fold diluted cDNA, 10 µL of SYBR Green Supermix, 0.5 µL of each primer (10 µM concentration), and 4 µL of nuclease-free water. β-Actin was included as an internal reference gene. The comparative Cq (2-ΔΔCT) method was employed to calculate the fold changes in mRNA expression levels, with PBS-treated cells used as a baseline for comparison.

Evaluating the Impact of NC8-ChIL2-17B on the Proliferation of IBV In Vitro

To assess the effect of NC8-ChIL2-17B, ChIL2, and ChIL17B on the proliferation of IBV in vitro, HD11 cells were seeded in 6-well plates, incubated until they reached approximately 75% confluence, and then pretreated with filtrates of cells expressing the respective constructs at a standardized dose for 2 h. Subsequently, the cells were exposed to the IBV Beaudette strain at a multiplicity of infection (MOI) of 2. The IBV Beaudette strain uniquely replicates in HD11 cells, providing a robust model for studying viral dynamics. Cells treated with PBS served as the negative control, and cells exposed to IBV only served as the positive control. Each treatment was repeated in 6 wells to ensure statistical robustness. Following treatment, the cultures were collected to determine the median tissue culture infective dose (TCID50) using the Reed-Muench method until a cytopathic effect (CPE) was observed in the IBV control wells.

Animals and Ethical Considerations

Specific pathogen-free (SPF) White Leghorn chicken embryos were procured from Beijing Boehringer Ingelheim Vital Biotechnology Co., Ltd. (Beijing, China) and hatched in our laboratory. Newly hatched chicks were housed in isolators under pathogen-free conditions in an animal biosafety level-2 (ABSL2) facility at the Experimental Animal Center of Sichuan University (Chengdu, China). The animal experiments conducted in this study were approved by the Animal Ethics Committee (ACE) of Sichuan University. All experimental procedures strictly adhered to animal welfare standards and were conducted in accordance with the animal management guidelines of Sichuan University.

Animal Experiments

Sixty 3-day-old chicks of similar weight were randomly divided into 6 groups, with 10 chicks in each group. The groups were orally inoculated with the following treatments: NC8-ChIL2-17B+vaccine, NC8-ChIL2+vaccine, NC8-ChIL17B+vaccine, NC8-P+vaccine, vaccine, and PBS. The dose of recombinant NC8 was 1 × 109 colony-forming units (CFU) in 200 μL of PBS. Concurrently, all treatment groups, except the PBS control, were orally administered 200 μL of attenuated IBV H120 (1 × 108 EID50/mL), which was supplied by Sichuan Hua Pai Bio-Pharmaceutical Co., Ltd. (Chengdu, China). The PBS group was administered 400 µL of PBS. A repeat dose of recombinant NC8 was administered on the following day to reinforce the initial inoculation. Following the initial protocol, a booster dose was administered at 14 d post inoculation (dpi). At 28 dpi, 5 chickens from each group were randomly selected and humanely euthanized to collect the tracheal, thymic, cecal tonsil, small intestine, and cecal content samples for pre-challenge analysis. The remaining chickens were orally challenged with 200 μL of IBV M41 (106 EID50), which was provided by Chengdu TECH-BANK Biological Products Co., Ltd. (Chengdu, China). At 7 d post-challenge (dpc), all chickens were euthanized to collect tissue samples, including the trachea, lungs, spleen, kidneys, bursae, and liver. During the experiment, the weight of each chicken was monitored weekly, and peripheral blood samples were collected at corresponding intervals.

Analysis of IBV-Specific IgG Antibodies and Secretory Immunoglobulin A by ELISA

Serum IBV-specific antibodies were detected using the IBV Antibody Test Kit (IDEXX, Westbrook, ME), according to the manufacturer's guidelines. The cutoff was set at 0.2. The sample-to-positive (S/P) ratio was calculated using the following formula: (Sample A650 – Negative control A650)/(Positive control A650 – Negative control A650). where A650 is the absorbance at 650 nm. To quantify sIgA within the respiratory and digestive tracts, the trachea and a 10 cm section of the small intestine were washed with 1 mL of cold PBS containing protease inhibitor to collect tracheal and intestinal lavage fluid. Total sIgA levels were determined using the Chicken Secretory IgA ELISA Kit (SinoBest Biological Technology Co., Shanghai, China), according to the manufacturer's instructions. To detect IBV-specific sIgA, 96-well ELISA plates were pre-coated with IBV-specific proteins and processed according to standard indirect ELISA protocols. HRP-conjugated goat anti-chicken IgA (Abcam, Cambridge, MA), at a dilution of 1:2000, was used as the secondary antibody. After adding the TMB substrate, the optical density was measured using a Spectramax i3X microplate reader at wavelengths of 650 or 450 nm.

Analysis of Immune-Related Gene Expression in Vaccinated Chickens by RT-qPCR

Tissue samples from the thymus and cecum tonsils were collected at 28 dpi and immediately frozen in liquid nitrogen. Tissue samples, each weighing 0.1 g, were homogenized in 1 mL of cold RNase-free PBS using gentleMACS M Tubes and a gentleMACS Octo Dissociator (Miltenyi Biotec, Bergisch Gladbach, Germany). RNA was extracted from 200 µL aliquots of the obtained homogenates using TRIzol reagent. The extracted RNA was then reverse-transcribed into cDNA, which was analyzed using RT-qPCR, with β-actin as the internal control. RT-qPCR was performed as described previously. The comparative Cq (2-ΔΔCT) method was used to quantify the fold changes in mRNA expression, with the PBS-treated group used as the baseline.

Quantification of IBV M41 Copies in the Tissues of Vaccinated Chickens Post Challenge

At 7 d post-IBV M41 challenge, tissues from the trachea, lungs, liver, spleen, kidneys, and bursa were homogenized, and RNA was extracted using TRIzol reagent. Tissue samples weighing 0.1 g each were used. Copies of IBV M41 were analyzed by absolute quantification using real-time PCR. Primers (Forward: 5′-TCTGAGAAATCAGTTGAGGGT-3′ and Reverse: 5′-ACTCATCAACCTCTTCTGCTG-3′) were designed and synthesized based on the genome sequence of IBV M41 in GenBank (Accession No.: AY851295.1), which is distinct from the sequence of IBV H120 (Accession No.: FJ888351.1). Real-time PCR was performed using a Bio-Rad CFX connect PCR system in a 20 µL reaction containing 1 µL of cDNA, 10 µL of AceQfi qPCR SYBR Green Master Mix, 0.5 µL of each forward and reverse primer (10 µmol/L), and 8 µL of sterile ddH2O. Six replicates of each sample were analyzed. To create a standard curve for quantifying the levels of IBV M41 RNA in different tissues, a DNA fragment from the IBV M41 genome (nucleotides 2870–3420) was cloned into the pUC57 plasmid.

DNA Extraction and 16S rDNA V3-V4 Sequencing for Gut Microbiota Analysis

Samples from the NC8-P+vaccine, vaccine, NC8-ChIL2-17B+vaccine, and PBS groups (n = 4 chickens per group) were selected for intestinal 16S rDNA V3/V4 sequencing. Fresh cecal content samples, weighing 0.1 g, were collected from chickens at 28 dpi and immediately frozen in liquid nitrogen to preserve sample integrity. Total DNA was extracted from the cecal contents using the E.Z.N.A. Stool DNA Kit (Omega Bio-Tek, Norcross, GA), according to the manufacturer's guidelines. Library construction and sequencing were performed on the Illumina NovaSeq platform according to the manufacturer's protocols (LC-Bio Technology Co., Ltd., Hangzhou, China). During this process, the V3-V4 region of the bacterial 16S ribosomal RNA (rRNA) gene was amplified by PCR with the bar-code-indexed primers 341F (5′-CCTACGGGNGGCWGCAG-3′) and 805R (5′-GACTACHVGGGTATCTAATCC-3′) using Phusion Hot start flex 2 × Master Mix. Amplicons were purified using AMPure XT beads (Beckman Coulter Genomics, California, USA) and quantified using a Qubit (Invitrogen, CA). The amplicon pool was sized and quantified using library quantification kits for the Agilent 2100 Bioanalyzer and Illumina (Kapa Biosciences, Boston, MA). Libraries were sorted on the NovaSeqPE250 platform.

Microbial Analysis

The paired-end reads were assigned to their respective samples based on unique barcodes and then truncated to remove the barcode and primer sequences. Subsequently, the paired-end reads were merged using FLASH software. To ensure high-quality data, the raw reads were subjected to quality filtering under specific conditions using fqtrim (v0.94). Chimeric sequences were identified and eliminated using Vsearch software (v2.3.4). DADA2 was used for dereplication to yield a feature table and sequences. For normalization, sequences were randomly adjusted for both alpha and beta diversity calculations. The relative abundance of each sample was used to normalize feature abundance according to the SILVA (Release 132) classifier. Alpha diversity was determined to assess the species complexity in each sample using 5 indices: the Chao1, Observed species, Goods coverage, Shannon, and Simpson indices. These indices were calculated using QIIME2. Beta diversity was computed using QIIME2, and graphs were generated using the R package. The feature sequences were subjected to sequence alignment using BLAST and annotated using the SILVA database for representative sequence identification. Additional visualizations were generated using the R package (v3.5.2).

Statistical Analysis

Statistical analyses and graphical representations were performed using GraphPad Prism 9 (GraphPad Software, San Diego, CA). Unpaired t-test was utilized to assess the statistical significance of comparisons between 2 groups, while one-way analysis of variance (ANOVA) was employed for comparisons between multiple groups. Additionally, 2-way ANOVA was performed for subgroup comparisons. In the graphical representations, different letters indicate significant differences (P < 0.05), whereas the same letter indicates no significant difference (P > 0.05). Uppercase letters denote significance at a higher threshold (P < 0.01).

RESULTS

Construction of Recombinant NC8-ChIL2-17B Strain

A recombinant NC8 strain was engineered to co-express a fusion protein composed of chicken IL-2 and IL-17B (Figure 1A). Growth curve analysis indicated that introduction of the fusion gene did not adversely affect cell proliferation in the selected culture medium, demonstrating that the genetic modification was well tolerated by the host strain (Figure 1B). To verify expression of the rChIL2-17B fusion protein, whole-cell ELISA and western blotting were performed using a mouse anti-His-Tag monoclonal antibody. These assays confirmed successful expression of rChIL2-IL17B in NC8-ChIL2-17B (Figures 1C and 1D). Quantitative analysis using a commercial ELISA kit determined that 1 × 109 CFUs of NC8-ChIL2-17B yielded 1.5 ng of rChIL2-IL17B protein. As expected, lysates from NC8-P cells did not contain detectable levels of the fusion protein, underscoring the effectiveness and specificity of the recombinant protein expression system.

Figure 1.

Figure 1

Open in a new tab

Construction of recombinant strain NC8-ChIL2-17B. (A) Schematic diagram illustrating the construction of the ChIL2-17B gene (SPUsp45–ChIL2-linker–ChIL17B-6–His-tag). (B) Growth curve of NC8-ChIL2-17B and NC8. (C) Whole cell ELISA of NC8-ChIL2-17B and NC8. (D) Expression of rChIL2-IL17B in NC8-ChIL2-17B as analyzed by western blotting. The data in (C) are the mean ± SD (n=3). Statistical analysis was performed using an unpaired Student's t-test. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

NC8-ChIL2-17B Induces Macrophages Activation In Vitro

The ability of the rChIL2-17B protein expressed by the NC8 strain (NC8-ChIL2-17B) to activate macrophages was evaluated using the HD11 chicken macrophage cell line. HD11 cells were treated with a bacteria-free lysate of NC8-ChIL2-17B, and the resultant changes in the mRNA expression levels of key genes in the NF-κB and JAK-STAT signaling pathways, as well as several effector molecules, including IL-12, IL-1β, and IL-6, were quantitatively assessed using RT-qPCR. Cell lysates of NC8-IL2, NC8-17B, and NC8-P cells were used as controls. The data revealed that NC8-ChIL2-17B significantly upregulated the expression levels of key genes in the NF-κB (JAK1, STAT3, and TYK2) and JAK-STAT (TAK1, Myd88, and NF-κB) pathways, as well as the effector molecules IL-12, IL-1β, and IL-6, compared to the corresponding levels in the control groups (Figure 2). Analysis of the individual cytokine-expressing strains showed that NC8-ChIL2 specifically enhanced IL-12 expression, whereas NC8-ChIL17B more broadly increased the expression of JAK1, STAT3, TYK2, Myd88, NF-κB, and IL-6 at 24 hours post stimulation. At 48 h post stimulation, this pattern persisted, with NC8-ChIL2 primarily boosting the expression of JAK1, IL-12, IL-1β, and IL-6, and NC8-ChIL17B elevating STAT3, NF-κB, and IL-6 levels. These findings highlight the synergistic immunomodulatory effects of IL-2 and IL-17B co-expression in NC8-ChIL2-17B cells on macrophage activation.

Figure 2.

Figure 2

Open in a new tab

NC8-ChIL2-17B activates macrophages in vitro. HD11 macrophages were stimulated with lysates of recombinant NC8 strains for 12, 24, and 48 hours. The expression level of genes associated with the NF-κB (JAK1, STAT3, and TYK2) and JAK-STAT (TAK1, Myd88, and NF-κB) signal pathways and the effector molecules IL-12, IL-1β, and IL-6 were analyzed using RT-qPCR. Data are representative means ± SD of 3 duplicates. Statistical analysis was performed using two-way ANOVA with multiple comparison test. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

NC8-ChIL2-17B Inhibits IBV Proliferation In Vitro

We evaluated the ability of NC8-ChIL2-17B to suppress IBV proliferation in HD11 cells. As shown in Figure 3A, NC8-ChIL2-17B-treated HD11 cells exhibited the lowest IBV titer (104.56±0.08 TCID50/mL) after 48 h of treatment, which coincided with the appearance of CPE in the IBV only positive control. Cells treated with NC8-ChIL17B had lower IBV titers than cell treated with NC8-ChIL2, indicating the differential effect of IL17B and IL2 on viral proliferation. Interestingly, lysates from NC8-P cells also attenuated IBV proliferation when compared to the level in the positive control. We also analyzed the mRNA level of the IFN-γ gene in IBV-infected HD11 cells. As shown in Figure 3B, IBV-infected macrophages had higher levels of IFN-γ expression than the PBS control, suggesting an enhanced antiviral response. Notably, macrophages treated with NC8-ChIL2-17B showed significantly higher levels of IFN-γ expression following IBV infection than macrophages with the other treatments, highlighting the enhanced immunomodulatory effect of the NC8-ChIL2-17B treatment.

Figure 3.

Figure 3

Open in a new tab

NC8-ChIL2-17B inhibits IBV proliferation in vitro. (A) IBV titers in HD11 cells at 48 hours after treating with NC8-P, NC8-ChIL2-17B, NC8-ChIL2, or NC8- ChIL17B. (B) The mRNA level of IFN-γ in IBV-infected HD11 cells, analyzed via RT-qPCR, with PBS-treated HD11 cells as the negative control. Data are representative means ± SD of 3 duplicates. Statistical analysis was performed using two-way ANOVA with multiple comparison test. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

NC8-ChIL2-17B Promotes Weight Gain in IBV Vaccine-Immunized Chickens

To assess the effects of NC8-ChIL2-17B on the growth performance of IBV-vaccinated chickens, live recombinant NC8 strains and IBV vaccine were orally administered to 3-day-old chicks. The weights of the chickens were recorded over a 28-d period post vaccination. The initial and final weights, along with the net weight gains, are presented in Table 1. Our statistical analysis revealed negligible differences in initial weights across all groups. Remarkably, chickens treated with NC8-ChIL2-17B, as well as those treated with NC8-ChIL2 and NC8-ChIL17B, had significantly higher weight gains than the chickens in the NC8-P, IBV, and PBS groups at 28 dpi. No significant differences in weight gain were observed among the NC8-ChIL2-17B, NC8-ChIL2, and NC8-ChIL17B groups. These findings suggest that the recombinant NC8 strains, particularly NC8-ChIL2-17B, effectively promoted weight gain in chickens immunized with the IBV vaccine, highlighting their potential beneficial effect on poultry growth performance following vaccination.

Table 1.

Weight gain of chicken at 28 d post vaccination.

Group Initial weight (g) n=10 End weight (g) n=10 Net gain (g) n = 10
NC8-ChIL2-IL17B 64.00 ± 0.42 398.0 ± 5.52 334.0 ± 3.76****
NC8-ChIL2 62.00 ± 0.76 390.0 ± 5.83 333.0 ± 3.67****
NC8-ChIL17B 63.00 ± 0.29 380.0 ± 7.26 325.0 ± 2.97***
NC8-P 62.00 ± 0.76 380.0 ± 4.29 318.0 ± 3.89
IBV 64.00 ± 0.43 380.0 ± 6.38 316.0 ± 4.93
PBS 62.00 ± 0.76 360.0 ± 5.79 298.0 ± 4.63
Open in a new tab

n = 10 chickens in each group. The data are shown as mean ± SEM and analysed using unpaired t-test. ***P < 0.001 ****P < 0.0001.

NC8-ChIL2-17B Promotes an IBV Vaccine-Induced Humoral Immune Response in Chickens

To assess the immunoadjuvant activities of recombinant NC8-ChIL2-17B on the IBV vaccine-induced humoral immune response, chickens were orally administered the IBV vaccine H120 along with live NC8-ChIL2-17B at 0 and 14 dpi. Subsequently, a booster of live NC8-ChIL2-17B was administered at 1 and 15 dpi. The control group was administered equivalent doses of NC8-ChIL2, NC8-ChIL17B, or NC8-P. Serum samples were collected weekly to evaluate IBV-specific IgG levels. Tracheal and intestinal samples were obtained at 28 dpi to evaluate IBV-specific and total sIgA levels (Figure 4A). IBV-specific IgG levels were quantified and expressed as ratios of sample vs. positive control (S/P), and an effective antibody induction threshold was defined as S/P > 0.2. NC8-ChIL2-17B significantly enhanced the production of IBV-specific IgG in serum at 7 dpi compared to that in the other groups (Figure 4B). At 14 and 28 dpi, the NC8-ChIL2-17B, NC8-ChIL2, and NC8-ChIL17B groups exhibited higher serum IgG levels than the NC8-P, IBV vaccine, and PBS groups. Particularly, the NC8-ChIL2-17B group maintained significantly higher IgG levels at 28 dpi. Further assessment of mucosal immune responses revealed that administration of NC8-ChIL2-17B, NC8-ChIL2, and NC8-ChIL17B significantly increased the levels of both total sIgA and IBV-specific sIgA in the tracheal and intestinal lavage fluids at 28 dpi. (Figures 4C and 4D). Notably, the NC8-ChIL2-17B group showed markedly higher levels of total sIgA and IBV-specific sIgA levels than the control group, indicating the potent synergistic effects of NC8-ChIL2-17B on both the serum and mucosal antibody responses to the IBV vaccine.

Figure 4.

Figure 4

Open in a new tab

NC8-ChIL2-17B promotes the IBV vaccine-induced humoral immune response in chickens. (A) Experimental outline for oral inoculation of chickens with recombinant NC8 (rNC8) strains and IBV H120. The rNC8 strains include NC8-ChIL2-17B, NC8-ChIL2, NC8-ChIL17B, and NC8-P. Three-day-old chicks were orally inoculated with IBV H120 and rNC8 at 0 d post inoculation (dpi), followed by a boost at 14 dpi. Additional doses of rNC8 were administered orally at 0 and 15 dpi. Blood samples were collected from the pterygoid vein at 0, 7, 14, 21, and 28 dpi. Chickens were sacrificed, and the trachea and intestine were collected at 28 dpi. (B) IBV-specific IgG antibodies in serum. Antibody levels are presented as the mean ratio of each sample to the positive control (S/P). The cut-off value was set at 0.2. (C) and (D) Levels of total sIgA and IBV-specific sIgA in the trachea and intestine, respectively, as detected by ELISA. The data in (B) are presented as the mean ± SD (n = 10 chickens in each group). Data were analyzed using two-way ANOVA with multiple comparison. In (C) and (D), the concentrations and optical density at 450 nm (OD450) are shown as the mean ± SD (n=5 chickens in each group). Data were analyzed using one-way ANOVA with Tukey's multiple comparison test. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

NC8-Chil2-17B Enhances IBV Vaccine-Induced Immune-Related Gene Expression in Chickens

To better understand the influence of NC8-ChIL2-17B on the IBV vaccine-induced immune response in chickens, we collected the thymus and cecal tonsils from chickens at 28 dpi and measured the expression levels of immune-related genes using RT-qPCR. As shown in Figure 5, the mRNA levels of IL-1β, IL-22, TLR-3, TLR-7, and BCL6 in both the thymus and cecal tonsil tissues were significant upregulated in chickens treated with NC8-ChIL2-17B compared to the corresponding levels in the control groups. Treatment with NC8-ChIL17B induced higher expression levels of IL-1β, TLR-7, and BCL6 in the thymus than treatment with NC8-ChIL2, as well as higher levels of IL-22, TLR-3, TLR-7, and BCL6 in the cecal tonsils, indicating a distinct immunostimulatory profile. These findings show that NC8-ChIL2-17B exerts a synergistic effect in bolstering the expression of critical immune-related genes in chickens, suggesting induction of enhanced, broad-spectrum immunological engagement.

Figure 5.

Figure 5

Open in a new tab

NC8-ChIL2-17B enhances IBV vaccine-induced immune-related gene expression in chickens. (A) and (B) The mRNA levels of IL-1β, IL-22, TLR-3, TLR-7, and BCL6 genes in the thymus (A) and cecal tonsils (B) of vaccinated chickens at 28 dpi, as measured using RT-qPCR. Data are the mean ± SD (n=5 chickens in each group). Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparison test. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

NC8-ChIL2-17B Facilitates Clearance of IBV M41 in Vaccinated Chickens

To investigate the immunoadjuvant effects of NC8-ChIL2-17B on protection against IBV infection, chickens were challenged with IBV strain M41 at 28 dpi and necropsied to collect tissue samples at 7 dpc (Figure 6A). We measured IBV M41 viral loads in various tissues, including the trachea, lungs, liver, spleen, bursa, and kidneys, using RT-qPCR. The IBV M41 RNA copy numbers in different tissues are presented in Figure 6B. Notably, the group treated with NC8-ChIL2-17B had significantly lower viral loads in the tracheal lymph nodes, lungs, liver, spleen, bursa, and kidneys than the other groups, indicating a pronounced reduction in viral burden. Comparison of the efficacy of the single cytokine-expressing strains showed that the NC8-ChIL17B group had lower IBV RNA counts in the lungs, liver, and bursa than the NC8-ChIL2 group (P < 0.05), highlighting the differential protective effects of the 2 cytokines.

Figure 6.

Figure 6

Open in a new tab

NC8-ChIL2-17B enhances IBV vaccination in chickens and reduces IBV M41 burden. (A) Experimental outline. Vaccinated and unvaccinated chickens were challenged with IBV M41 at 28 dpi and subsequently sacrificed at 7 d post challenge (dpc) to measure the IBV M41 burden. (B) Analysis of the number of IBV M41 RNA copies in the tissues of IBV M41-challenged chickens using absolute qPCR. Data are the mean ± SD (n=5 chickens in each group). Statistical analysis was performed using multiple t-tests. Values labeled with different letters are significantly different (P < 0.05), and values with the same letter are not significantly different (P > 0.05). Uppercase letters indicate P < 0.01.

Impact of NC8-ChIL2-17B on the Intestinal Microflora of Chickens Vaccinated With the IBV Vaccine

Probiotics have long been recognized for their benefits in balancing the gut microbiota, bolstering pathogen resistance, and modulating immune responses. To further investigate the mechanism of action of NC8-ChIL2-17B as an oral adjuvant for IBV vaccines, we analyzed the gut (cecal) microbial communities of vaccinated chickens using 16s rRNA sequencing. We achieved a 100% validity rate for our data, with an average of 349 features identified per sample (range, 205–449). PCoA analysis demonstrated that chickens treated with NC8-ChIL2-17B had a microbial composition and structure that was distinct from those in the control groups (NC8-P, IBV vaccine, and PBS) (Figure 7A). The microbial species composition and abundance in NC8-ChIL2-17B-inoculated chickens were clearly different from those in the other groups, as shown in Figure 7B. The dominant genus in NC8-ChIL2-17B-inoculated chickens was Alistipes, which accounted for 32.24% of all genera. In contrast, the proportion of Alistipes in the PBS, NC8-P, and IBV vaccine groups was lower, at 23.21, 21.81, and 28.96%, respectively. Akkermansia was significantly lower (7.83%) in the NC8-ChIL2-17B group than in the PBS (27.65%), NC8-P (30.94%), and IBV vaccine (22.66%) groups. Next, we identified the differential species (biomarkers) between the NC8-ChIL2-17B and IBV vaccine groups using linear discriminant analysis effect size (LEfSe) analysis (Figure 7C). The NC8-ChIL2-17B group had an increased abundance of beneficial microbial families and genera, including Lactobacillus and Fecalibacterium, indicating a healthy gut microbiota profile. In contrast, the IBV vaccine group exhibited a higher prevalence of other genera, such as Akkermansia. Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt2) and subsequent Statistical Analysis of Metagenomic Profiles (STAMP) revealed significant functional enhancements in the microbiota of the NC8-ChIL2-17B group, including pathways related to amino acid synthesis, starch degradation, and glycogen metabolism (Figure 7D). These findings suggest that NC8-ChIL2-17B not only alters the microbial composition in the cecum of vaccinated chickens, but also induces beneficial functional shifts in the gut microbiota, which may contribute to improved health and stronger immune responses against IBV.

Figure 7.

Figure 7

Open in a new tab

NC8-ChIL2-17B alters the intestinal microflora of IBV vaccine-immunized chickens. (A) Analysis of the differences between samples was conducted using principal coordinates analysis (PCoA) with unweighted UniFrac. The proximity of samples indicates similarity in microbial composition and structure, with closer samples having smaller differences. (B) The relative abundances of the dominant bacteria at the genus level. Each taxon is in a different color, and the vertical coordinate represents the relative abundance of each taxon. Longer columns indicate higher relative abundances in corresponding samples. (C) Cladogram presenting the results of the LEfSe differential analysis of cecum flora. The circular layers represent 7 classification levels, with nodes representing species classifications. Nodes with different colors indicate significant differences in species abundance between groups. (D) Functional abundance of KEGG pathways in samples as predicted by PICRUSt and analyzed by STAMP. Differential functional genes were analyzed using t-test, with a significance threshold of P < 0.05. The functional abundance data presented in the results show significant statistical differences with a 95% confidence interval.

DISCUSSION

For large-scale poultry farms, oral administration of vaccines is a practical approach to safeguard against pathogenic infections. However, the approved adjuvants for poultry vaccines are not useful for oral vaccination. In this study, we constructed a novel recombinant L. plantarum NC8-ChIL2-17B strain engineered to co-express chicken IL-2 and IL-17B as an oral immunoadjuvant for the IBV vaccine. This innovative approach not only enhanced the humoral and mucosal immune responses to the IBV vaccine but also promoted growth and enhanced the gut microbiota profile in vaccinated chickens.

In this study, L. plantarum was used as a carrier for transporting ChIL2-17B into the digestive tract of chickens. L. plantarum is a food-grade microorganism that can survive the harsh gastrointestinal conditions and thus protect the activity of the proteins it carries (De Angelis and Gobbetti, 2004). In this and previous studies, we separated live recombinant NC8 from the feces of chickens that were orally administered the strain. Delivering cytokine adjuvants with live recombinant L. plantarum solves the problem of their short half-life. Steinler et al. showed that recombinant Lactobacillus could secrete biologically active mouse IL-2 (Steidler, et al., 1995). In a previous study, a recombinant Lactobacillus strain that expressed human IL-10 was administered to patients with chronic enteritis, which demonstrated its clinical safety and efficacy (Braat, et al., 2006). The data in this study also indicate that recombinant Lactobacillus can express active cytokines. Whole-cell ELISA and western blot analyses showed that the ChIL2-17B fusion protein could be successfully anchored to the surface of the NC8 cells using a surface-display expression strategy, which is beneficial for augmenting the concentration and bioactivity of foreign proteins (Norton, et al., 1996; Bermudez-Humaran, et al., 2004). However, the dynamics of cytokine synthesis and secretion by NC8-ChIL2-17B remain to be fully elucidated. Additionally, some components of Lactobacillus also exhibit adjuvant properties. For instance, muramyl dipeptide, a cytoskeletal peptidoglycan component, can activate macrophages and enhance nonspecific immunity. Consequently, the NC8 control group exhibited moderate immunostimulatory effects.

NC8-ChIL2-17B showed the synergistic effects of IL-2 and IL-17B on macrophage activation through the activation of JAK-STAT and NF-κB signaling pathway. The JAK-STAT signaling pathway is a major pathway downstream of cytokine receptors, leading to rapid signaling from the cell surface to the nucleus (Banerjee, et al., 2017). Here, the expression levels of JAK1, TYK2, and STAT3, which are involved in the JAK-STAT signaling pathway, were higher in NC8-ChIL2-17B-stimulated HD11 macrophages than in NC8-ChIL2- or NC8-ChIL17B-stimulated cells. JAK1 has broad functions in cytokine signaling, as it mediates signaling by IL-2 and other cytokines. TYK2 mediates interferon signaling, which is closely associated with susceptibility to viral infection. STAT3, which is downstream of IL-2, mediates Th2 T cell differentiation (O'Shea and Plenge, 2012) and directly influences Th17 cell differentiation by targeting the IL-17 gene (Zhong, et al., 1994; Durant, et al., 2010). Additionally, stimulation of cells with NC8-ChIL2-17B significantly increased the mRNA levels of TAK1, Myd88, and NF-κB in the NF-κB signaling pathway, as well as the production of the effector molecules IL-12, IL-1β, and IL-6. These proteins play critical roles in immune responses and other physiological and pathological processes (Guo, et al., 2024). The enhanced immunogenicity induced by NC8-ChIL17B stimulation not only inhibited IBV proliferation but also induced a marked increase in IFN-γ expression, a pivotal cytokine of type I helper T cells (Th1 cells) that possesses antiviral, immunomodulatory, and anti-tumor capabilities. Our study results align with previous research showing that IL-2 enhanced immune responses against pathogens such as human respiratory syncytial virus (RSV) and chicken Newcastle disease virus (NDV) (Susta, et al., 2015; Pyle, et al., 2021).

IBV-specific antibodies serve as critical indicators for evaluating the humoral immune response to IBV vaccines. Following immunization, administration of NC8-ChIL2-17B markedly elevated IBV-specific antibody levels. These antibodies were detectable at 7 dpi and peaked at 14 dpi. The presence and levels of sIgA in the mucosa are important for evaluating the efficacy of oral vaccines. This study revealed that oral delivery of the IBV vaccine along with NC8-ChIL2-17B significantly stimulated the production of both total and IBV-specific sIgA in the tracheal and intestinal mucosa. The induction of mucosal antibodies plays a vital role in eliminating IBV infection, potentially explaining the observed decrease in serum IBV-specific IgG levels after a second oral dose of the vaccine. Typically, oral live attenuated vaccines are used in the primary immunization strategy, which is supplemented by subsequent intramuscularly administered doses of inactivated vaccines to boost immune responses. In this avian model, NC8-ChIL2-17B significantly promoted sIgA production within mucosal compartments. Interaction between NC8-ChIL2-17B and the IL-17B receptor, which is predominantly expressed on mucosal epithelial cells, may trigger immune activation, thereby enhancing antigen presentation and specific immune defense mechanisms against IBV.

The mRNA levels of TLR-3, TLR-7, IL-22, IL-1β, and BCL-6 were significantly upregulated in the thymus and cecal tonsils of NC8-ChIL2-17B immunized chickens. TLR-3 and TLR-7 specifically recognize RNA viruses, such as IBV, and function as crucial enhancers of the innate immune responses against RNA viruses, by effectively priming the adaptive immune response. TLR-3 recognizes the viral replication product dsRNA, which is a common intermediate in many viral replication processes (Ribes, et al., 2020). TLR-7 recognizes single-stranded RNA viruses, such as SARS-CoV-2, and activates antiviral immune responses (Bertoletti and Le Bert, 2019; Khalifa and Ghoneim, 2021). Importantly, activation of TLR-7 has been shown to facilitate the expansion of memory T and B cells, contributing to sustained protective immunity (McGowan, 2019). IL-22 notably enhances mucosal defense by promoting the secretion of antimicrobial peptides from epithelial cells, thereby promoting cell proliferation and tissue repair (Keir, et al., 2020). In this study, upregulation of IL-22 significantly contributed to the local mucosal immune response against viral infection. IL-22 is considered one of the most promising cytokines for mucosal tissue protective therapy, especially in the treatment of acute diseases of the epithelial tissue, such as ulcerative colitis and hepatitis (Muhl, et al., 2013). Furthermore, BCL-6 is an essential transcriptional repressor in the development of follicular T helper (Tfh) cells, which are crucial for the selection of B cells within germinal centers (Liu et al., 2021). The elevated expression of these genes underscores the comprehensive immune response elicited by oral administration of NC8-ChIL2-17B, which enhanced the overall efficacy of the IBV vaccine against viral infection.

Effective immunoadjuvants should enhance the immune capacity of vaccines to confer protection against pathogens. In this study, NC8-ChIL2-17B improved the efficacy of the IBV vaccine in chickens by eliminating IBV M41 after challenge. It is generally believed that strong humoral and cellular immunity can suppress IBV replication. Previous studies have shown that IL-2 promotes the clearance of NDV from the blood, spleen, oral secretions, and cloacal excreta (Susta, et al., 2015). Our study confirmed that IL-2 and IL-17B not only synergistically enhance the innate and mucosal immune responses of vaccinated chickens but also significantly enhanced the specific humoral immune response, which was manifested by a significant improvement in the immune response to clear IBV infection.

In chickens, the gastrointestinal microbiota plays a pivotal role in optimizing production efficiency (egg and meat yields) and maintaining overall health by facilitating digestion, nutrient uptake, formation of mucosal immune barriers, and detoxification processes within the intestines. Among the various gut regions, the cecum harbors the densest bacterial populations, with concentrations ranging from to 1010 to 1011 CFU/g (Cencic and Chingwaru, 2010). Consequently, we conducted 16S rRNA sequencing of the cecal contents to analyze the gut microbiota composition. Following oral administration of NC8-ChIL2-17B along with the IBV vaccine to SPF chickens, we observed a notable increase in the populations of Lactobacillus and Fecalibacterium within the cecum, surpassing the levels found in the control groups receiving only the IBV vaccine. The genera Lactobacillus and Fecalibacterium facilitate glucose metabolism and muscle development, likely contributing to the observed enhancement in weight gain. This study also revealed upregulation of bacterial glycolytic enzymes and starch hydrolases in the NC8-ChIL2-17B-IBV vaccinated group, suggesting a direct link between the enriched gut microbiota and improved sugar metabolism, growth, and development. Additionally, certain Firmicutes and Bacillus strains present in the cecum can metabolize uric acid to ammonia and short-chain fatty acids (SCFAs), providing precursors for amino acid synthesis. SCFAs have been implicated in the modulation of antibacterial community effects, regulation of bile and pancreatic secretions, and production of mucus (Sergeant, et al., 2014). Moreover, an increased presence of Clostridia is associated with induction of CD4+Foxp3+ regulatory T cells and strengthening of the intestinal mucosal barrier through SCFA production (Geva-Zatorsky, et al., 2017). Increased levels of Lactobacillus may promote intestinal synthesis of IL-22, thereby preserving the microbial equilibrium at mucosal surfaces and mitigating inflammation (Lamas, et al., 2016). The proliferation of Lactobacillus strains also plays a critical role in modulating T-cell proliferation and differentiation, enhancing mucosal immune defense, and providing a protective benefit (Tang, et al., 2015). Overall, oral delivery of NC8-ChIL2-17B resulted in significant enrichment of beneficial bacterial communities, such as Lactobacillus and Clostridia, which are instrumental in enhancing the immune responsiveness of vaccinated chickens, particularly mucosal immune mechanisms.

This study has some limitations that require further research and improvement. First, plasmid pMG36e, which harbors the erythromycin resistance gene, was selected to deliver the recombinant gene rChIL2-17B into L. plantarum. Subsequent applications will require modification of the plasmid vector or homologous recombination to eliminate the risk of carrying an antibiotic resistance gene. Second, the scope of this study was limited to evaluating the immunomodulatory efficacy of NC8-ChIL2-17B in conjunction with a specific live vaccine (IBV H120) and subsequent challenge with the IBV M41 strain. To fully elucidate the applicability and effectiveness of NC8-ChIL2-17B as an immunoadjuvant, further studies should include a diverse array of vaccine formulations and be conducted in chickens of different breeds and ages. In addition, its efficacy against various IBV serotypes and under different vaccination schedules should be explored.

CONCLUSIONS

In this study, we constructed NC8-ChIL2-17B, which expresses the fusion cytokine protein ChIL2-17B, with an aim to develop a safe and cost-effective oral adjuvant for IBV vaccines. Stimulation with NC8-ChIL2-17B promoted macrophage activation and inhibited IBV proliferation. Oral administration of NC8-ChIL2-17B enhanced the immune response induced by the IBV vaccine in chickens, thereby protecting flocks from IBV M41 challenge, and altering the intestinal microflora of the vaccinated chickens to improve weight gain. Although the NC8-ChIL2-17B strain was specifically designed as an adjuvant for IBV vaccines, further research is needed to explore its potential as an adjuvant for other types of vaccines or as an alternative to antibiotics.

DISCLOSURES

The authors declare no conflict of interest.

ACKNOWLEDGMENTS

The research was supported by National Key R & D program of China [2017YFD500703].

Author Contributions: Rong Gao conceptualized the experiment, Shaohua Guo and Junjie Peng wrote the manuscript. Shaohua Guo, Junjie Peng, Jianlin Chen, Yongle Xiao and Rong Gao participated in the experiment and analyzed the data. Yongle Xiao and Rong Gao revised the manuscript. All authors have read and agreed to publish this manuscript.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2024.103908.

Appendix. Supplementary materials

mmc1.docx (18.9KB, docx)

REFERENCES

  1. Abbas A.K., Trotta E., Marson A., Bluestone J.A., R. S. D, Revisiting IL-2: biology and therapeutic prospects. Sci. Immunol. 2018;3 doi: 10.1126/sciimmunol.aat1482. [DOI] [PubMed] [Google Scholar]
  2. Banerjee S., Biehl A., Gadina M., Hasni S., Schwartz D.M. JAK-STAT Signaling as a target for inflammatory and autoimmune diseases: current and future prospects. Drugs. 2017;77:521–546. doi: 10.1007/s40265-017-0701-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barouch D.H., Craiu A., Kuroda M.J., Schmitz J.E., Zheng X.X., Santra S., Frost J.D., Krivulka G.R., Lifton M.A., Crabbs C.L., Heidecker G., Perry H.C., Davies M.E., Xie H., Nickerson C.E., Steenbeke T.D., Lord C.I., Montefiori D.C., Strom T.B., Shiver J.W., Lewis M.G., Letvin N.L. Augmentation of immune responses to HIV-1 and simian immunodeficiency virus DNA vaccines by IL-2/Ig plasmid administration in rhesus monkeys. Proc. Natl. Acad. Sci. U S A. 2000;97:4192–4197. doi: 10.1073/pnas.050417697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bermudez-Humaran L.G., Cortes-Perez N.G., Loir Y.L.e, Alcocer-Gonzalez J.M., Tamez-Guerra R.S., de Oca-Luna R.M., Langella P. An inducible surface presentation system improves cellular immunity against human papillomavirus type 16 E7 antigen in mice after nasal administration with recombinant lactococci. J. Med. Microbiol. 2004;53:427–433. doi: 10.1099/jmm.0.05472-0. [DOI] [PubMed] [Google Scholar]
  5. Bertoletti A., Bert N.L.e. Fine-tuning TLR-7-based therapy for functional HBV cure. Hepatol. Commun. 2019;3:1289–1292. doi: 10.1002/hep4.1420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Braat H., Rottiers P., Hommes D.W., Huyghebaert N., Remaut E., Remon J.P., van Deventer S.J., Neirynck S., Peppelenbosch M.P., Steidler L. A phase I trial with transgenic bacteria expressing interleukin-10 in Crohn's disease. Clin. Gastroenterol. Hepatol. 2006;4:754–759. doi: 10.1016/j.cgh.2006.03.028. [DOI] [PubMed] [Google Scholar]
  7. Cencic A., Chingwaru W. The role of functional foods, nutraceuticals, and food supplements in intestinal health. Nutrients. 2010;2:611–625. doi: 10.3390/nu2060611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chow Y.H., Huang W.L., Chi W.K., Chu Y.D., Tao M.H. Improvement of hepatitis B virus DNA vaccines by plasmids coexpressing hepatitis B surface antigen and interleukin-2. J. Virol. 1997;71:169–178. doi: 10.1128/jvi.71.1.169-178.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. De Angelis M., Gobbetti M. Environmental stress responses in Lactobacillus: a review. Proteomics. 2004;4:106–122. doi: 10.1002/pmic.200300497. [DOI] [PubMed] [Google Scholar]
  10. Deville S., Arous J.B., Bertrand F., Borisov V., Dupuis L. Efficacy of intranasal and spray delivery of adjuvanted live vaccine against infectious bronchitis virus in experimentally infected poultry. Procedia Vaccinol. 2012;6:85–92. doi: 10.1016/j.provac.2012.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Durant L., Watford W.T., Ramos H.L., Laurence A., Vahedi G., Wei L., Takahashi H., Sun H.W., Kanno Y., Powrie F., O'Shea J.J. Diverse targets of the transcription factor STAT3 contribute to T cell pathogenicity and homeostasis. Immunity. 2010;32:605–615. doi: 10.1016/j.immuni.2010.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Geva-Zatorsky N., Sefik E., Kua L., Pasman L., Tan T.G., Ortiz-Lopez A., Yanortsang T.B., Yang L., Jupp R., Mathis D., Benoist C., Kasper D.L. Mining the human gut microbiota for immunomodulatory organisms. Cell. 2017;168 doi: 10.1016/j.cell.2017.01.022. 928–943 e911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Guo Q., Jin Y., Chen X., Ye X., Shen X., Lin M., Zeng C., Zhou T., Zhang J. NF-kappaB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024;9:53. doi: 10.1038/s41392-024-01757-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Guo S., Peng J., Xiao Y., Liu Y., Hao W., Yang X., Wang H., Gao R. The construction and immunoadjuvant activities of the oral interleukin-17B expressed by Lactobacillus plantarum NC8 strain in the infectious bronchitis virus vaccination of chickens. Vaccines (Basel) 2020;8:282. doi: 10.3390/vaccines8020282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Henke A., Rohland N., Zell R., Wutzler P. Co-expression of interleukin-2 by a bicistronic plasmid increases the efficacy of DNA immunization to prevent influenza virus infections. Intervirology. 2006;49:249–252. doi: 10.1159/000092487. [DOI] [PubMed] [Google Scholar]
  16. Hu H., Tao L., Wang Y., Chen L., Yang J., Wang H. Enhancing immune responses against SARS-CoV nucleocapsid DNA vaccine by co-inoculating interleukin-2 expressing vector in mice. Biotechnol Lett. 2009;31:1685–1693. doi: 10.1007/s10529-009-0061-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Huo S., Zhang J., Fan J., Wang X., Wu F., Zuo Y., Zhong F. Co-expression of chicken IL-2 and IL-7 enhances the immunogenicity and protective efficacy of a VP2-expressing DNA vaccine against IBDV in chickens. Viruses. 2019;11 doi: 10.3390/v11050476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Inoue T., Inoue Y., Hayashi K., Yoshida A., Nishida K., Shimomura Y., Fujisawa Y., Aono A., Tano Y. Topical administration of HSV gD-IL-2 DNA is highly protective against murine herpetic stromal keratitis. Cornea. 2002;21:106–110. doi: 10.1097/00003226-200201000-00022. [DOI] [PubMed] [Google Scholar]
  19. Keir M., Yi Y., Lu T., Ghilardi N. The role of IL-22 in intestinal health and disease. J Exp Med. 2020;217 doi: 10.1084/jem.20192195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Khalifa A.E., Ghoneim A.I. Potential value of pharmacological agents acting on toll-like receptor (TLR) 7 and/or TLR8 in COVID-19. Curr Res Pharmacol Drug Discov. 2021;2 doi: 10.1016/j.crphar.2021.100068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lamas B., Richard M.L., Leducq V., Pham H.P., Michel M.L., Da Costa G., Bridonneau C., Jegou S., Hoffmann T.W., Natividad J.M., Brot L., Taleb S., Couturier-Maillard A., Nion-Larmurier I., Merabtene F., Seksik P., Bourrier A., Cosnes J., Ryffel B., Beaugerie L., Launay J.M., Langella P., Xavier R.J., Sokol H. CARD9 impacts colitis by altering gut microbiota metabolism of tryptophan into aryl hydrocarbon receptor ligands. Nat Med. 2016;22:598–605. doi: 10.1038/nm.4102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lin K.H., Hsu A.P., Shien J.H., Chang T.J., Liao J.W., Chen J.R., Lin C.F., Hsu W.L. Avian reovirus sigma C enhances the mucosal and systemic immune responses elicited by antigen-conjugated lactic acid bacteria. Vaccine. 2012;30:5019–5029. doi: 10.1016/j.vaccine.2012.04.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu D., Yan J., Sun J., Liu B., Ma W., Li Y., Shao X., Qi H. BCL6 controls contact-dependent help delivery during follicular T-B cell interactions. Immunity. 2021;54 doi: 10.1016/j.immuni.2021.08.003. 2245–2255 e2244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. McGowan D.C. Latest advances in small molecule TLR 7/8 agonist drug research. Curr Top Med Chem. 2019;19:2228–2238. doi: 10.2174/1568026619666191009165418. [DOI] [PubMed] [Google Scholar]
  25. Muhl H., Scheiermann P., Bachmann M., Hardle L., Heinrichs A., Pfeilschifter J. IL-22 in tissue-protective therapy. Br J Pharmacol. 2013;169:761–771. doi: 10.1111/bph.12196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Norton P.M., Brown H.W., Wells J.M., Macpherson A.M., Wilson P.W., Le Page R.W. Factors affecting the immunogenicity of tetanus toxin fragment C expressed in Lactococcus lactis. FEMS Immunol Med Microbiol. 1996;14:167–177. doi: 10.1111/j.1574-695X.1996.tb00284.x. [DOI] [PubMed] [Google Scholar]
  27. Nunberg J.H., Doyle M.V., York S.M., York C.J. Interleukin 2 acts as an adjuvant to increase the potency of inactivated rabies virus vaccine. Proc Natl Acad Sci U S A. 1989;86:4240–4243. doi: 10.1073/pnas.86.11.4240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. O'Shea J.J., Plenge R. JAK and STAT signaling molecules in immunoregulation and immune-mediated disease. Immunity. 2012;36:542–550. doi: 10.1016/j.immuni.2012.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Pyle C.J., Labeur-Iurman L., Groves H.T., Puttur F., Lloyd C.M., Tregoning J.S., Harker J.A. Enhanced IL-2 in early life limits the development of TFH and protective antiviral immunity. J Exp Med. 2021;218:1–17. doi: 10.1084/jem.20201555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rahman T., Das A., Abir M.H., Nafiz I.H., Mahmud A.R., Sarker M.R., Emran T.B., Hassan M.M. Cytokines and their role as immunotherapeutics and vaccine adjuvants: the emerging concepts. Cytokine. 2023;169 doi: 10.1016/j.cyto.2023.156268. [DOI] [PubMed] [Google Scholar]
  31. Ribes S., Arcilla C., Ott M., Schutze S., Hanisch U.K., Nessler S., Nau R. Pre-treatment with the viral toll-like receptor 3 agonist poly(I:C) modulates innate immunity and protects neutropenic mice infected intracerebrally with Escherichia coli. J. Neuroinflammation. 2020;17:24. doi: 10.1186/s12974-020-1700-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sergeant M.J., Constantinidou C., Cogan T.A., Bedford M.R., Penn C.W., Pallen M.J. Extensive microbial and functional diversity within the chicken cecal microbiome. PLoS One. 2014;9:e91941. doi: 10.1371/journal.pone.0091941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shi S.H., Yang W.T., Yang G.L., Zhang X.K., Liu Y.Y., Zhang L.J., Ye L.P., Hu J.T., Xing X., Qi C., Li Y., Wang C.F. Lactobacillus plantarum vaccine vector expressing hemagglutinin provides protection against H9N2 challenge infection. Virus Res. 2016;211:46–57. doi: 10.1016/j.virusres.2015.09.005. [DOI] [PubMed] [Google Scholar]
  34. Song X., He X., Li X., Qian Y. The roles and functional mechanisms of interleukin-17 family cytokines in mucosal immunity. Cell Mol. Immunol. 2016;13:418–431. doi: 10.1038/cmi.2015.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Steidler L., Wells J.M., Raeymaekers A., Vandekerckhove J., Fiers W., Remaut E. Secretion of biologically active murine interleukin-2 by Lactococcus lactis subsp. Lactis Appl. Environ. Microbiol. 1995;61:1627–1629. doi: 10.1128/aem.61.4.1627-1629.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Susta L., Diel D.G., Courtney S., Cardenas-Garcia S., Sundick R.S., Miller P.J., Brown C.C., Afonso C.L. Expression of chicken interleukin-2 by a highly virulent strain of Newcastle disease virus leads to decreased systemic viral load but does not significantly affect mortality in chickens. Virol. J. 2015;12:122. doi: 10.1186/s12985-015-0353-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tan F., Zhang L., Yin L., Wang L., Zhang H., Zheng L., Cui X., Lv X., Bai R., Zheng M. Immune synergistic mechanism of recombinant plasmid adjuvant containing chicken IL-4 and IL-2 fusion genes on chicken coccidia live vaccine. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tang C., Kamiya T., Liu Y., Kadoki M., Kakuta S., Oshima K., Hattori M., Takeshita K., Kanai T., Saijo S., Ohno N., Iwakura Y. Inhibition of Dectin-1 signaling ameliorates colitis by inducing Lactobacillus-mediated regulatory T cell expansion in the intestine. Cell Host Microbe. 2015;18:183–197. doi: 10.1016/j.chom.2015.07.003. [DOI] [PubMed] [Google Scholar]
  39. Tovey M.G., Lallemand C. Adjuvant activity of cytokines. Methods Mol. Biol. 2010;626:287–309. doi: 10.1007/978-1-60761-585-9_19. [DOI] [PubMed] [Google Scholar]
  40. Zhang C., Wang B., Wang M. GM-CSF and IL-2 as adjuvant enhance the immune effect of protein vaccine against foot-and-mouth disease. Virol J. 2011;8:7. doi: 10.1186/1743-422X-8-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zhao J., Zhao Y., Zhang G. Key aspects of coronavirus avian infectious bronchitis virus. Pathogens. 2023;12:1–14. doi: 10.3390/pathogens12050698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhong Z., Wen Z., Darnell J.E., Jr Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994;264:95–98. doi: 10.1126/science.8140422. [DOI] [PubMed] [Google Scholar]
  43. Zhou Y., Zhou M., Mao S. Adjuvant effects of platycodin D on immune responses to infectious bronchitis vaccine in chickens. J Poult Sci. 2020;57:160–167. doi: 10.2141/jpsa.0180089. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (18.9KB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES