IL-33 supplementation improves uterine artery resistance and maternal hypertension in response to placental ischemia

Abstract

Preeclampsia (PE), a leading cause of maternal/fetal morbidity and mortality, is a hypertensive pregnancy disorder with end-organ damage that manifests after 20 wk of gestation. PE is characterized by chronic immune activation and endothelial dysfunction. Clinical studies report reduced IL-33 signaling in PE. We use the Reduced Uterine Perfusion Pressure (RUPP) rat model, which mimics many PE characteristics including reduced IL-33, to identify mechanisms mediating PE pathophysiology. We hypothesized that IL-33 supplementation would improve blood pressure (BP), inflammation, and oxidative stress (ROS) during placental ischemia. We implanted intraperitoneal mini-osmotic pumps infusing recombinant rat IL-33 (1 µg/kg/day) into normal pregnant (NP) and RUPP rats from gestation day 14 to 19. We found that IL-33 supplementation in RUPP rats reduces maternal blood pressure and improves the uterine artery resistance index (UARI). In addition to physiological improvements, we found decreased circulating and placental cytolytic Natural Killer cells (cNKs) and decreased circulating, placental, and renal T_H17s in IL-33-treated RUPP rats. cNK cell cytotoxic activity also decreased in IL-33-supplemented RUPP rats. Furthermore, renal ROS and placental preproendothelin-1 (PPET-1) decreased in RUPP rats treated with IL-33. These findings demonstrate a role for IL-33 in controlling vascular function and maternal BP during pregnancy by decreasing inflammation, renal ROS, and PPET-1 expression. These data suggest that IL-33 may have therapeutic potential in managing PE.

NEW & NOTEWORTHY Though decreased IL-33 signaling has been clinically associated with PE, the mechanisms linking this signaling pathway to overall disease pathophysiology are not well understood. This study provides compelling evidence that mechanistically links reduced IL-33 with the inflammatory response and vascular dysfunction observed in response to placental ischemia, such as in PE. Data presented in this study submit the IL-33 signaling pathway as a possible therapeutic target for the treatment of PE.

Listen to this article’s corresponding podcast at https://ajpheart.podbean.com/e/il-33-supplementation-improves-rupp-pathophysiology/.

INTRODUCTION

Preeclampsia (PE) is a hypertensive pregnancy syndrome characterized by a combination of end-organ dysfunction and the development of new-onset hypertension (HTN) after 20 wk of gestation (1). In the United States, PE is one of the leading causes of pregnancy mortality, and unfortunately, rates have continued to rise over the past 20 years (2). Not only is PE a significant factor in maternal and fetal morbidity, it has also been recognized as a significant risk factor for future cardiovascular and renal disease in both the mother and child (3). The only curative treatment has been delivery of the fetal-placental unit, although this does not always result in resolution of PE symptomology (4). The limited treatment options for management of PE are largely due to the fact that PE etiology is still poorly understood (5, 6). However, placental hypoxia resulting from improper spiral artery remodeling or other insult, such as inflammation or placental injury, is proposed to initiate the pathogenesis of PE (7–10).

In addition to overt symptoms such as maternal HTN, patients with PE also demonstrate immunological abnormalities such as the increased release of inflammatory cytokines, anti-angiogenic factors, and increased oxidative stress (7, 11, 12). Immune cell populations also undergo a phenotypic shift from a fetal-tolerant state toward a proinflammatory state, with increased populations of effector cells including T-helper 17 cells (T_H17s) and cytolytic NK cells (cNKs), which are linked to the endothelial dysfunction that underlies PE’s hypertensive symptoms (13–16). For our study, we utilized the reduced uterine perfusion pressure (RUPP) preclinical model of placental ischemia, which recapitulates many PE characteristics (17) and is widely used to study the immunological and pathophysiological changes associated with PE (18–22).

A probable mediating event for these PE immunological changes is activation of the NOD-like receptor and pyrin domain-containing protein 3 (NLRP3) inflammasome. Clinical studies have reported increased NLRP3 expression in PE, other pregnancy-related disorders, and hypertensive diseases; and studies suggest an important role for the NLRP3 inflammasome in mediating the inflammation and vascular dysfunction associated with those conditions (23–27). Recent work from our laboratory has demonstrated that NLRP3 activation mediates activation and expansion of T_H17 and cNK cell populations (28). Work from our laboratory and others in PE and various other inflammatory diseases have suggested that NLRP3 activation may activate T_H17 and cNK cells through inhibition of interleukin-33 (IL-33) signaling (28–30). IL-33 is a pleiotropic cytokine that modulates the immune response and regulates immune cells, including T_H17 and cNK cells, through its binding to membrane-bound interleukin 1 receptor-like 1 (ST2) receptors (31–34). Binding of IL-33 to membrane-bound ST2 receptors activates a type 2 immune response. In other inflammatory diseases as well as our own work, NLRP3 has been implicated in disrupting IL-33 signaling (28, 29, 35). Clinical studies suggesting reduction of IL-33 signaling in PE have differed on whether IL-33 is downregulated or sequestered. A study from Chen et al. showed decreased levels of IL-33 in PE placental tissue but no differences in placental ST2 levels (36). Alternatively, a study by Grenne et al. showed no differences in plasma levels of IL-33 between nonpregnant, normal pregnant, and women with PE throughout pregnancy, but reported that plasma soluble interleukin 1 receptor-like 1 (sST2) levels, which acts as a decoy receptor to block IL-33 activity, increased in plasma of women with PE (37). Importantly, in our previously published study using the RUPP model, we observed both reduced placental IL-33 as well as increased plasma sST2 in the RUPP rat when compared to the Sham control (28). These studies suggest differential regulation of IL-33 signaling in the circulation versus placenta during PE. Thus, IL-33 signaling may be disrupted in PE due to (1) IL-33 antagonism/sequestration by increased sST2 in the circulation and/or (2) by decreased IL-33 protein within the placenta. Based on these prior studies and potential mechanisms driving inhibition of IL-33 signaling, we hypothesized that supplementation of IL-33 will increase circulating and placental IL-33 levels, reduce T_H17 and cNK cell activation, inflammation, and oxidative stress leading to improved vascular function and attenuation of the maternal HTN and fetal growth restriction (FGR) that occurs in response to placental ischemia during pregnancy.

MATERIALS AND METHODS

Animals

Female virgin Sprague-Dawley rats between 10 and 12 wk of age were mated overnight to age-matched males. The presence of a sperm plug the next day was considered a positive pregnancy and deemed gestational day 0 (GD0). Animals were maintained on standard bedding, 2020X Teklad Global Soy Protein-Free Extruded rodent diet (Envigo), a 12-h:12-h light/dark cycle, and allowed ad libitum access to food and water. Animals were group-housed from GD0 until surgeries were performed. Animals were randomly assigned to experimental groups and housed in the Center for Comparative Research at the University of Mississippi Medical Center (UMMC). The UMMC Institutional Animal Care and Use Committee approved the protocols (No. 2021-1162) in this study. Protocols are in accordance with the National Institutes of Health guidelines for the use and care of animals. Randomized allocation and blinded analysis are routinely employed in our laboratory and were employed for all protocols in this study. A schematic detailing the timeline of the study can be found in Supplemental Fig. S7; note: all supplemental material may be found at https://doi.org/10.6084/m9.figshare.25029776.v2).

Reduced Uterine Perfusion Pressure Surgery

On GD14, a subset of pregnant rats underwent RUPP surgery under 3% isoflurane anesthesia (38, 39). Briefly, after a midline incision, the lower abdominal aorta was isolated, and a restrictive silver clip (0.203 mm) was applied superior to the iliac bifurcation to restrict blood flow to the uterine horn. Compensatory ovarian circulation to the uterus was reduced by the placement of restrictive clips (0.100 mm) to branches of the ovarian arteries. Another subset of pregnant rats also underwent a sham surgery of the RUPP in which clips were not placed (NP).

IL-33 Administration

On GD14, a mini osmotic pump (model 2002, Alzet Scientific Corporation) was placed intraperitoneally to infuse either saline vehicle or recombinant rat IL-33 (1 µg/kg/day, NBP2-35248, Novus Biologicals) from GD14 through GD19. Previous studies in rats treated with IL-33 utilized dosing ranging from 1 µg/animal to 0.1 mg/kg (40, 41). We used a lower dose at 1 µg/kg/day, and our data showed antihypertensive and reduced fetal growth restriction effects at this lower dose. Vehicle and IL-33-treated animals demonstrated no differences in body weight (Supplemental Fig. S6).

Mean Arterial Pressure Measurement

On GD18, catheters constructed from V3 tubing (BB21785, Scientific Commodities) were placed into the carotid arteries and tunneled to the back of the neck under 3% isoflurane anesthesia. On GD19, rats were placed in individual restrainers and connected to a pressure transducer. Conscious mean arterial pressure (MAP) was monitored using PowerLab software (AD Instruments) and recorded for 30 min following a 30-min stabilization period.

Uterine Artery Resistance Index Measurement

On GD18, Doppler sonography was performed on rats under 3% isoflurane anesthesia to measure the uterine artery resistance index (UARI). A representative Doppler sonograph is shown in Supplemental Fig. S5. Doppler velocimetry measurements on the uterine arteries were taken on a Vevo 770 unit (Visual Sonics) with a 30-Hz transducer (Model No. 710B). One placenta from each uterine horn was imaged to capture waveforms representing the peak systolic velocity (PSV) and end-diastolic flow velocity (EDV). The placenta visualized was the placenta midway between the ovary and cervix on both sides. Three waveforms were measured for velocities per frame. UARI was calculated using the equation UARI = (PSV − EDV)/PSV.

Sample Collection and Protein Isolation

After MAP measurement on GD19, rats were anesthetized under 3% isoflurane anesthesia for blood and tissue collection. Animals were exsanguinated via blood collection followed by bilateral pneumothorax for euthanasia. Total litter size, number of live fetuses per litter, placental weights, and fetal weights were recorded for each dam and averaged. Reabsorption rates were calculated as the percentage of reabsorbed fetuses over the total number of fetuses in the litter. Randomly selected placenta tissues were immediately frozen in liquid nitrogen and stored at −80°C until analysis. Placenta (including the decidua) and kidney samples were homogenized in T-PER Tissue Protein Extraction Reagent (78510, Thermo Fisher Scientific) containing 1 mM activated vanadate (BP-440, Boston BioProducts), protease inhibitor cocktail (P8340, MilliporeSigma), and 1X HALT protease and phosphatase inhibitor (78441, Thermo Fisher Scientific).

IL-33 and ST2 Quantification

Homogenized placental samples and plasma were tested for IL-33 and ST2 levels using the Rat IL-33 ELISA kit (ab236714, Abcam) and the Rat ST2 ELISA kit (ab255716, Abcam). Undiluted samples were assayed in duplicate and analyzed according to the manufacturer’s instructions. Data are expressed as pg/mL (plasma) and pg/mg (tissue). Placental data were normalized to protein concentration, determined via the Pierce BCA Protein Assay Kit (23225, Thermo Fisher Scientific). Plasma and placenta IL-33 to ST2 ratios were calculated as the IL-33 level divided by the ST2 level.

RNA Isolation and Real-Time Quantitative PCR

Using the Qiagen RNeasy Plus Mini Kit (74134, Qiagen), placental RNA was isolated according to the manufacturer’s protocol. An A₂₆₀/A₂₈₀ ratio of 1.8–2.2 was used to confirm RNA quality of samples on a Take3 multivolume plate (BTTAKE3TRIO, Agilent) with a BioTek Synergy H1 microplate reader (Agilent). Isolated RNA was converted to cDNA with iScript Reverse Transcription Supermix for RT-qPCR (1708841, BioRad). Real-time quantitative PCR (RT-qPCR) was performed with Bio-Rad SYBR Green Supermix (1725271), PPET-1 primers (forward: CTAGGTCTAAGCGATCCTTG and reverse: TCTTTGTCTGCTTGGC) (42), and the PrimePCR SYBR Green Assay for GAPDH (10025636) on a BioRad iCycler under the following conditions: 1 cycle of 95°C for 2 min (activation), 40 cycles of 95°C for 5 s (denaturation), and 60°C for 30 s (extension). With melt curve analysis from 65°C to 95°C in 0.5°C increment at 5 s/step, qPCR products were verified to be single amplicons. PPET-1 expression levels were normalized to GAPDH and quantified using the comparative CT method (^ΔΔCT).

Flow Cytometry

Leukocyte single-cell suspensions from blood, placenta, and kidney were prepared as previously described (38, 43) and blocked with 10% goat and mouse serum prior to staining for flow cytometry. Antibodies used to stain for NK cells (defined as CD3⁻ANK61⁺ cells for total NK cells and CD3⁻ANK61⁺ANK44⁺ cells for activated NK cells) were as follows: adenomatous polyposis coli protein (APC)-conjugated anti-CD3 (1:10, Miltenyi Biotec Cat. No. 130-102-679, RRID:AB_2657097), mouse anti-rat ANK61 (1:50, Abcam Cat. No. ab36392, RRID:AB_776652), mouse anti-rat ANK44 (1:100, Abcam Cat. No. ab36388, RRID:AB_776651), goat anti-mouse IgG FITC (1:50, Abcam Cat. No. ab6785, RRID:AB_955241), and rabbit anti-mouse IgG AlexaFluor405 (1:100, Abcam Cat. No. ab175651, RRID:AB_2923541). Antibodies used to stain for T_H17 cells (defined as CD4⁺CD25^-RORγ⁺) were as follows: FITC-conjugated anti-CD4 antibody (1:10, Miltenyi Biotec Cat. No. 130-107-623, RRID:AB_2657928), phycoerythrin (PE)-conjugated anti-CD25 (1:50, BD Biosciences Cat. No. 554866, RRID:AB_395564), and peridinin-chlorophyll-protein (PerCP)-conjugated anti-RORγt (1:5, R and D Systems Cat. No. IC6006C, RRID:AB_10571437). Flow cytometry was carried out on a Miltenyi MACSQuant Analyzer 10 (Miltenyi Biotec) and underwent analysis using FlowLogic software (Innovai). After dead cell exclusion using Viobility Fixable dye staining (130-109-814, Miltenyi Biotec) and doublet exclusion, lymphocytes were gated in the forward and side scatter plots and analyzed with fluorescence minus one (FMO) controls. Gating strategies for NK cells (Supplemental Fig. S3) and T_H17 cells (Supplemental Fig. S4) are included in Supplemental Data. Data are expressed as the percentage of live cells in the gated lymphocyte population.

NK Cell Cytotoxicity Assay

Fresh NK cells were isolated from placentas on the day of harvest as previously described by our laboratory (44). Four placentas from a single dam were pooled together to represent one animal. Briefly, lymphocytes were subject to MACS magnetic bead cell separation (Miltenyi). NK cells were isolated using biotin-conjugated anti-CD3 antibody (1:10, Miltenyi Biotec Cat. No. 130-123-858, RRID:AB_2904993), PE-conjugated anti-CD161 antibody (1:10, Miltenyi Biotec Cat. No. 130-102-712, RRID:AB_2655445), anti-biotin microbeads (1:10, Miltenyi Biotec Cat. No. 130-090-485, RRID:AB_244365), and anti-PE microbeads (1:5, Miltenyi Biotec Cat. No. 130-048-801, RRID:AB_244373). Isolated CD3⁻CD161⁺NK cells were cultured for 48 h at 37°C, 5% CO₂ in a humidified incubator in culture media [RPMI, 10% FBS, 1% penicillin-streptomycin, and 2 ng/mL recombinant rat IL-2 (502-RL-010, R&D Systems)]. NK cell cytotoxic activity against YAC1 target cells (ATCC) was measured using the Cytotox 96 Non-Radioactive Cytotoxicity Assay kit (Promega). Samples were plated in duplicate at a ratio of 50:1 of NK:YAC1 and incubated for 5 h. Data calculations were performed according to the manufacturer’s instructions and are expressed as fold change in cytotoxic activity, normalized to NP NK cytotoxic activity.

Oxidative Stress Measurement

As previously described by our laboratory, superoxide production was measured in homogenized placenta and kidney samples using lucigenin (38, 39). Homogenized samples and lucigenin (5 µM), with or without NADPH (0.163 M), were incubated together and allowed to equilibrate at 37°C for 15 min in the dark. Ten seconds of luminescence were then measured with a BioTek Plate Reader. An assay blank with only lucigenin was subtracted from the reading. Data were normalized to protein concentration, determined via the Pierce BCA Protein Assay kit (23225, Thermo Fisher Scientific), and expressed as relative light units (RLU) per minute per mg protein.

Circulating AT1-AA Level Determination

As previously described (45, 46), serum IgGs were isolated with affinity chromatography, and AT1-AA activity was analyzed using isolated neonatal cardiomyocytes. Chronotropic responses in response to angiotensin II type 1 receptor-mediated stimulation were measured. Data are expressed as changes in beats per minute (ΔBPM).

Statistical Analysis

Data were analyzed using a two-way ANOVA followed by Tukey’s multiple comparison test if a significant interaction was detected and presented as means ± SD. Statistical analyses were performed in GraphPad Prism 10 (GraphPad Software). For the two-way ANOVA analyses, row factors were defined as NP and RUPP, and column factors were defined as vehicle treatment and IL-33 treatment. Data were evaluated for normality using the Shapiro–Wilk test and for outliers using the ROUT method. A P value < 0.05 was considered statistically significant.

RESULTS

Circulating IL-33 is Increased by IL-33 Supplementation

Plasma IL-33 was 11.8 ± 6.2 pg/mL in NP and 5.0 ± 3.2 pg/mL in RUPP (n.s.). IL-33 supplementation significantly increased circulating IL-33 levels to 26.1 ± 18.9 pg/mL in treated RUPP rats (P = 0.0201 vs. RUPP, Fig. 1A). RUPP rats had elevated circulating sST2 levels at 1,134.8 ± 170.3 pg/mL compared to NP rats at 327.1 ± 71.1 pg/mL (P < 0.0001, Fig. 1B). Plasma IL-33:sST2 ratio was 0.035 ± 0.014 in NP, 0.004 ± 0.002 in RUPP, and 0.021 ± 0.011 in RUPP + IL-33, demonstrating a more than fivefold increase in IL-33:ST2 ratio in treated RUPPs. However, these observed differences were not statistically significant (Fig. 1C). Placental IL-33 was more than twofold higher in NP versus RUPP rats (203.1 ± 165 pg/mg vs. 84.7 ± 34 pg/mg) though this was not statistically significant. Placental IL-33 in RUPP rats after IL-33 supplementation was 191.8 ± 60.1 pg/mg (n.s vs. RUPP) (Fig. 1D). Similarly, IL-33 supplementation also did not significantly alter placenta IL-33, placenta ST2 (Fig. 1E), placenta IL-33:ST2 ratio (Fig. 1F), or renal ST2 levels (Supplemental Fig. S9).

Figure 1.

Circulating IL-33 is increased by IL-33 supplementation. Circulating (A) and placental IL-33 (D) as quantified through a rat IL-33 ELISA kit. Circulating sST2 (B) and placental ST2 levels (E) as quantified through a rat ST2 ELISA kit. C: the ratio of plasma IL-33 to plasma sST2. F: the ratio of placental IL-33 to placental ST2. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on circulating and placental IL-33 and ST2 levels as well as their respective ratios. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on circulating sST2 levels and showed IL-33 supplementation did have a statistically significant effect on circulating IL-33 levels. Simple main effects analysis also showed that surgery type and IL-33 supplementation did not have a statistically significant effect on placental IL33 and ST2 levels. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 7–8 animals. ANOVA, analysis of variance; IL-33, interleukin-33; NP, normal pregnant; RUPP, reduced uterine perfusion pressure; sST2, soluble interleukin 1 receptor-like 1; ST2, interleukin 1 receptor-like 1.

Maternal Blood Pressure and Uterine Vascular Function Improve with IL-33 Supplementation

RUPP rats had higher maternal MAP at 129 ± 8 mmHg compared with NP rats at 102 ± 4 mmHg (P < 0.0001, Fig. 2A). With IL-33 supplementation, treated RUPP MAPs improved to 110 ± 11 mmHg (P = 0.004 vs. RUPP). In addition to maternal MAP, we also assessed uterine vascular function by measuring UARI. RUPP rats had higher UARI compared with NP rats (0.71 ± 0.03 compared with 0.54 ± 0.04, P = 0.0002; Fig. 2B). IL-33 supplementation in RUPPs reduced UARI to 0.57 ± 0.05 (P = 0.0024 vs. RUPP).

Figure 2.

IL-33 supplementation improves maternal hypertension and uterine vascular function in response to placental ischemia. A: maternal MAP as measured through direct carotid catheterization. B: UARI as measured through Doppler sonography. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on maternal MAP and UARI. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on maternal MAP and UARI. Simple main effects analysis also showed that IL-33 supplementation did have a statistically significant effect on MAP and UARI in RUPP animals. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 6–8 animals. ANOVA, analysis of variance; IL-33, interleukin-33; MAP, mean arterial pressure; NP, normal pregnant; RUPP, reduced uterine perfusion pressure; UARI, uterine artery resistance index.

IL-33 Supplementation Decreases Fetal Growth Restriction

Fetal growth is restricted in untreated RUPP versus NP rats (1.45 ± 0.34 g vs. 2.07 ± 0.41 g, P = 0.0366, Fig. 3A), and fetal growth in IL-33-supplemented RUPP rats was improved to 2.14 ± 0.31 g (P = 0.0175). Placental weight is decreased in addition to an increase in fetal reabsorption rate in RUPP versus NP rats, with a placental weight of 0.40 ± 0.05 g in RUPP compared with 0.51 ± 0.08 g in NP rats (P = 0.0144, Fig. 3B) and a fetal reabsorption rate of 48.6 ± 28.6% compared with 1.6 ± 3.0% in NP rats (P = 0.003, Fig. 3C). IL-33 supplementation did not have significantly improve either of these measures in treated RUPP rats. Placental efficiency was similar across all groups in the study.

Figure 3.

Fetal growth restriction is reduced after IL-33 supplementation in placental ischemic rats. A: fetal weight expressed as average pup weight in each litter. B: placental weight expressed as average placental weight in each litter. C: fetal reabsorption calculated as number of reabsorbed fetuses divided by total litter size. D: placental efficiency calculated as average fetal weight divided by average placental weight. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on fetal weight, placental weight, fetal reabsorption, and placental efficiency. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on fetal weight and fetal reabsorption. Simple main effects analysis also showed that IL-33 supplementation did have a statistically significant effect on fetal weight in RUPP animals. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 7–8 litters. ANOVA, analysis of variance; IL-33, interleukin-33; NP, normal pregnant; RUPP, reduced uterine perfusion pressure.

Inflammation and Oxidative Stress Are Reduced in IL-33-Supplemented Rats

RUPP rats had higher populations of activated cNKs and T_H17s in the circulation and placenta compared to NP rats, and IL-33 supplementation decreased these populations in both tissue types. In the circulation, cNK populations were 2.90 ± 1.29% in RUPP compared with 0.91 ± 0.54% in NP (P = 0.0066, Table 1), and IL-33 supplementation decreased RUPP cNK populations to 1.06 ± 1.62% (P = 0.0132). In the placenta, cNK populations were 2.59 ± 0.68% in RUPP compared with 1.34 ± 0.68% in NP (P = 0.0071, Table 1), and IL-33 supplementation decreased RUPP cNK populations to 0.29 ± 0.38% (P < 0.0001). There were no significant differences in renal cNK populations (Table 1). In addition to quantifying cNK population changes, we also examined placental NK cell cytotoxicity in our groups. We observed a fourfold increase in cytotoxic activity of RUPP placental NK cells when compared with cytotoxic activity of NP NK cells (P = 0.0300, Fig. 4). IL-33 supplementation attenuated the RUPP-induced increase in cytotoxicity of placental NK cells (P = 0.0051).

Table 1.

cNK activation in circulation and the placenta reduced after IL-33 supplementation

	Treatment Group
	NP	NP+IL-33	RUPP	RUPP+IL-33
n	8	7	8	8
cNKs
Circulation	0.908 ± 0.543	0.337 ± 0.370	2.889 ± 1.288*	1.064 ± 1.615#
Circulation	0.908 ± 0.543	0.337 ± 0.370	2.889 ± 1.288*	1.064 ± 1.615#
Placenta	1.338 ± 0.680	0.760 ± 0.979	2.585 ± 0.678*	0.293 ± 0.378#
Kidney	0.549 ± 0.454	0.411 ± 0.440	0.639 ± 0.673	0.155 ± 0.330
TH17s
Circulation	1.010 ± 1.755	1.876 ± 1.291	7.183 ± 1.410*	0.754 ± 1.067#
Placenta	3.140 ± 2.620	1.996 ± 1.615	8.810 ± 4.265*	2.253 ± 2.405#
Kidney	2.925 ± 3.073	1.846 ± 1.317	3.830 ± 0.928	0.708 ± 0.637#

Values are means ± SD. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP. T_H17 populations in the circulation, placenta, and kidney also reduced after IL-33 supplementation. cNKs, cytolytic Natural Killer cells; IL-33, interleukin-33; NP, normal pregnant; RUPP, reduced uterine perfusion pressure; TH17s, T-helper 17 cells.

Figure 4.

IL-33 supplementation reduces NK cell cytotoxic activity in placental ischemic rats. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on NK cell cytotoxic activity. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on NK cell cytotoxic activity. Simple main effects analysis also showed that IL-33 supplementation did have a statistically significant effect on NK cell cytotoxic activity in RUPP animals. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 3 animals. ANOVA, analysis of variance; IL-33, interleukin-33; NP, normal pregnant; RUPP, reduced uterine perfusion pressure.

In the circulation, T_H17 populations were 7.18 ± 1.41% in RUPP compared with 1.01 ± 1.76% in NP (P < 0.001, Table 1), and IL-33 supplementation decreased RUPP T_H17 populations to 0.75 ± 1.07% (P < 0.001). In the placenta, T_H17 populations were 8.81 ± 4.27% in RUPP compared with 3.14 ± 2.62% in NP (P = 0.0033, Table 1), and IL-33 supplementation decreased RUPP T_H17 populations to 2.25 ± 2.41% (P = 0.0007). Renal T_H17 populations were similar when comparing RUPP versus NP rats. However, renal T_H17 populations were decreased in RUPP + IL-33 compared with RUPP (0.71 ± 0.64% vs. 3.83 ± 0.93%, P = 0.0081, Table 1).

Placental oxidative stress as measured by quantification of superoxide showed higher oxidative stress in RUPP compared with NP (797.9 ± 218.3 RLU/min/mg protein vs. 357.8 ± 187.1 RLU/min/mg protein, P = 0.0195) though no differences were seen in IL-33-supplemented groups (Fig. 5A). In the kidney, RUPP rats had higher oxidative stress compared with NP (674.6 ± 133.5 RLU/min/mg protein vs. 452.0 ± 74.9 RLU/min/mg protein, P = 0.0067, Fig. 5B). IL-33 supplementation reduced renal ROS in both NP and RUPP rats with 217.8 ± 51.1 RLU/min/mg protein in NP + IL-33 (P = 0.0043) and 257.9 ± 123.8 RLU/min/mg protein in RUPP + IL-33 (P < 0.001).

Figure 5.

IL-33 supplementation significantly reduces renal oxidative stress in placental ischemic rats. Placental ROS (A) and renal ROS (B) were measured via the lucigenin assay. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on placental and renal ROS. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on placental and renal ROS. Simple main effects analysis also showed that IL-33 supplementation did have a statistically significant effect on renal ROS in NP and RUPP animals. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 7 animals. ANOVA, analysis of variance; IL-33, interleukin-33; NP, normal pregnant; ROS, reactive oxygen species; RUPP, reduced uterine perfusion pressure.

We also measured placental levels of the chemokines macrophage inflammatory protein-3 (MIP-3a) and CXC motif chemokine ligand 1 (CXCL1). MIP-3a, a chemoattractant for lymphocytes, showed a trending decrease in RUPP + IL-33 compared with RUPP (79.1 ± 13.2 pg/mg protein compared with 112.2 ± 37.4 pg/mg protein, P = 0.0627, Supplemental Fig. S1A). CXCL1, a chemoattractant for neutrophils, decreased in IL-33-supplemented RUPP rats compared with RUPP rats (2,263 ± 1,528.3 pg/mg protein compared with 4,148.9 ± 1,112.8 pg/mg protein, P = 0.0293, Supplemental Fig. S1B).

IL-33 Supplementation Decreases the Expression of Preproendothelin-1 mRNA and Angiotensin II Type 1 Receptor Agonistic Autoantibody

In the search for other mediators behind the improvements observed in maternal blood pressure and uterine artery resistance, we examined several different factors: VEGF, NO bioavailability, Ser-1177 phosphorylated endothelial nitric oxide synthase (p-eNOS), endothelial nitric oxide synthase (eNOS), preproendothelin-1 (PPET-1) mRNA expression, and angiotensin II type 1 receptor agonistic autoantibody (AT1-AA) levels. Placental VEGF levels (Supplemental Fig. S2A) and circulating nitric oxide (NO) bioavailability (Supplemental Fig. S2B) showed no significant differences with IL-33 supplementation in RUPP rats, though there was a decrease in placental VEGF with IL-33 supplementation in NPs. There were no differences in placenta (Supplemental Fig. S2C) or kidney (Supplemental Fig. S2D) nitrate nitrite levels after IL-33 supplementation in either group. Concurrent with the placental nitrate nitrite results, there were no significant differences in placental p-eNOS or eNOS protein expression as determined by Western blot (Supplemental Fig. S8). There were, however, observed differences in AT1-AA activity and PPET-1 levels. AT1-AA activity was −0.8 ± 3.0 beats per minute (BPM) in NP with an increase to 11.9 ± 5.5 BPM in RUPPs (P = 0.009). IL-33 supplementation in RUPP rats reduced AT1-AA activity to 3.8 ± 8.1 BPM (P = 0.0456, Fig. 6A). PPET-1 levels were 2.4 ± 1.1 folds higher in RUPPs compared with NPs (P = 0.0104), with a trending reduction to 1.2 ± 0.5-fold higher in IL-33-supplemented RUPPs (P = 0.0519, Fig. 6B).

Figure 6.

AT1-AA levels are significantly reduced in IL-33-supplemented placental ischemic rats. PPET-1 levels trended toward a reduction after IL-33 supplementation in placental ischemic rats. A: circulating AT1-AA levels as measured through the cardiomyocyte bioassay. B: PPET-1 levels as measured by RT-PCR. Data are presented as means (SD). A two-way ANOVA was performed to analyze the effect of surgery type and IL-33 supplementation on AT1-AA and PPET-1 levels. A two-way ANOVA revealed that there was a statistically significant interaction between the effects of surgery type and IL-33 supplementation. Simple main effects analysis showed that surgery type did have a statistically significant effect on AT1-AA and PPET-1 levels. Simple main effects analysis also showed that IL-33 supplementation did have a statistically significant effect on AT1-AA in RUPP animals. *P < 0.05 vs. NP, #P < 0.05 vs. RUPP, n = 6–7 animals. ANOVA, analysis of variance; AT1-AA, angiotensin II type 1 receptor agonistic autoantibody; IL-33, interleukin-33; NP, normal pregnant; PPER-1, preproendothelin-1; RT-PCR, real-time polymerase chain reaction; RUPP, reduced uterine perfusion pressure.

DISCUSSION

Excess IL-33 signaling has long been considered an alarmin, and many studies have focused on its pathological role in driving allergic diseases and inflammatory bowel diseases, which are characterized as T-helper type 2 (T_H2 type) immune diseases (47–50). However, we argue that sufficient IL-33 signaling is protective during pregnancy-related conditions, specifically in PE, as the importance of T_H2 dominance over T_H1 populations has been extensively noted in normal pregnancy and there is a predominance of T_H1 over T_H2 populations in PE (51–53). Sufficient regulatory T (T_Reg) and T_H2 cell populations are also needed for maternal–fetal tolerance and are believed to promote this tolerance through their immunosuppressive properties (54). Deficiencies in IL-33 signaling have been observed in clinical PE studies and in our previous study in RUPP rats (28, 37). Moreover, the importance of sufficient IL-33 signaling during early pregnancy was previously demonstrated in mice (55). Studies in preterm labor and in fetal growth restriction (FGR) associated with lipopolysaccharide (LPS) exposure have also shown protective roles for IL-33 during pregnancy (56, 57). A recent study from Ferreira et al. reported a reduction in the IL-33:ST2 ratio postpartum, with implications for postpartum hypertrophy risk (58). There have also been studies showing a protective role for IL-33 in various cardiovascular conditions. IL-33 has been shown to be beneficial in protecting cardiomyocytes from apoptosis during ischemic reperfusion injury and infarction (41). It has also been shown to have anti-atherosclerotic effects, reduce cardiac hypertrophy, and increase survival after aortic constriction (59). In hypertension studies, IL-33 has been shown to normalize blood pressure in obese rats, and increased sST2 levels have been associated with increased blood pressure (60–62). Based on the aforementioned data, we investigated the role of IL-33 signaling in PE pathophysiology.

In our study, circulating IL-33 was increased after IL-33 supplementation in RUPP rats. However, although total placental IL-33 and the placental IL-33:ST2 ratio more than doubled after IL-33 treatment in RUPP rats, the changes were not statistically significant. Nevertheless, we observed that IL-33 supplementation attenuated maternal HTN and improved uterine artery resistance in treated RUPP rats. The improved uterine artery resistance in IL-33-supplemented RUPP rats may reflect beneficial changes in peripheral hemodynamics as previous studies have observed mirroring between uterine artery resistance and other cardiovascular parameters such as cardiac output and systemic vascular resistance (63, 64).

Though previous studies have indicated there may be a role for IL-33 in promoting angiogenesis and vascular permeability through endothelial nitric oxide production (65, 66), we did not see any changes in eNOS or nitrate nitrite levels in our animals. This indicates to us that IL-33 is not affecting peripheral hemodynamics via the eNOS/NO pathway. Rather, our data suggest that these changes may be due to the observed decreases in inflammation, renal ROS, PPET-1 levels, and AT1-AA activity. In our IL-33-supplemented RUPP rats, we see significant reduction in circulating and placental levels of cNK and T_H17 cells. IL-33 signaling has been inversely linked to the activation of these cell populations in other diseases (67, 68). Studies from our laboratory and others have associated increased cNK and T_H17 populations with increased oxidative stress and increased AT1-AA production during pregnancy, which cause vasoconstriction and increases in blood pressure (14, 15, 69). Amor et al. established that IL-33 signaling promotes tumor development in squamous cell carcinoma by decreasing NK cell cytotoxicity (70), which corresponds with our observation of decreased placental NK cell cytotoxicity in RUPP + IL-33 rats. We also believe that the reduction in renal ROS observed with IL-33 supplementation in RUPP rats is largely attributable to the reduction in renal T_H17s in that group, similar to what has been reported in classical hypertension (71, 72), to further drive decreases in maternal HTN. The trending decreases in PPET-1 levels in IL-33-supplemented RUPP rats are indicative of a likely decrease in endothelin-1 (ET-1) levels. Research from our laboratory and others has previously linked ET-1 as a mediator for maternal HTN in PE (73, 74).

The changes we report in placental MIP-3a and CXCL1 levels may also be driven by the changes in T_H17 populations and may be linked to further immunological changes that were not characterized in this study. MIP-3a is a strong chemoattractant for lymphocytes including immature dendritic cells and CD4⁺ T-cells (including T_H17s) (75). Thus, it is possible that the subtle changes in MIP-3a are a driving factor in the decreased placental T_H17s in RUPP + IL-33 rats. CXCL1, a strong chemoattractant for neutrophils (76), is stabilized by interleukin-17 (IL-17) (77), which is the main cytokine produced by T_H17s. Neutrophil infiltration has been linked to vascular inflammation in PE, and neutrophil populations are increased in patients with severe PE (78, 79). The observed reduction in PPET-1 levels may also help drive changes in CXCL1 as ET-1 induces neutrophil recruitment through CXCL1 signaling (80). Furthermore, we speculate that there are likely changes in neutrophil populations in response to IL-33 supplementation due to a study from Frisbee et al. showing an IL-33-mediated reduction in neutrophil and monocyte populations to drive a T_H2 type protection during Clostridium difficile infection (81). We believe an exploration into IL-33-mediated effects on neutrophil (and other innate cell) populations would be an interesting avenue of further study. There are also potential effects from the changes in MIP-3a and CXCL1 levels that may be driving changes in NK cell cytotoxicity in the study as well. A previous study from Al-Aoukaty et al. demonstrated that MIP-3a induces NK cell chemotaxis, and Yu et al. demonstrated that CXCL1 inhibition suppressed NK cell recruitment in the context of diffuse large B cell lymphoma (82, 83).

Several studies have defined a role for IL-33 signaling in promoting expansion of T_Reg populations. In lean mice, the visceral adipose tissue T_Reg population is expanded by IL-33 (84). In allergen-induced inflammation, T_Reg cells respond to IL-33 to suppress γδ T-cells resulting in reduced inflammation (85). A recent study from Mok et al. demonstrated the immunoregulatory roles of IL-33 on alternatively activated macrophage and T_Reg populations (86). In cancer and intestinal inflammation studies, the promotion of T_Reg populations by IL-33 has been linked to a dependence on amphiregulin (AREG) expression (87–89). Arpaia et al. reported that IL-33 stimulates T_Reg expansion and T_Reg production of AREG to promote an AREG-dependent tissue repair functionality (90). Furthermore, decreased AREG production from macrophages has been reported in clinical PE samples (91, 92), providing another potential pathway for IL-33 signaling to promote immunological tolerance in PE. However, explorations into this are beyond the scope of the current study and should be conducted in the future.

In this study, we establish that IL-33 supplementation reduces PE-associated pathophysiological characteristics such as maternal HTN, increased uterine artery resistance, and inflammation in an animal model of placental ischemia. We believe that the IL-33 signaling pathway could be a viable option for pharmaceutical targeting for the treatment of PE.

DATA AVAILABILITY

Data from this study is readily available from the authors upon reasonable request.

SUPPLEMENTAL DATA

Supplemental Figs. S1–S9: https://doi.org/10.6084/m9.figshare.25029776.v2.

GRANTS

This work was supported by National Institutes of Health Grants F31-HL-165851 (to X. Wang), T32-HL-105324 (to C. Shields), R01-DK-109133 (to J. M. Williams), P20-GM-121334 and R01-HL-151407 (to D. C. Cornelius).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

D.C.C. conceived and designed research; X.W., C.S., G.T., G.P., E.H., M.A., J.M.W., and D.C.C. performed experiments; X.W., C.S., G.T., G.P., E.H., M.A., J.M.W., and D.C.C. analyzed data; X.W., C.S., G.T., G.P., E.H., M.A., J.M.W., and D.C.C. interpreted results of experiments; X.W. and D.C.C. prepared figures; X.W. drafted manuscript; X.W. and D.C.C. edited and revised manuscript; X.W., C.S., G.T., G.P., E.H., M.A., J.M.W., and D.C.C. approved final version of manuscript.