Skip to main content
NCBI home page
American Journal of Physiology - Lung Cellular and Molecular Physiology logoLink to American Journal of Physiology - Lung Cellular and Molecular Physiology
. 2023 Nov 21;326(1):L19–L28. doi: 10.1152/ajplung.00099.2023

Functional role of glial-derived neurotrophic factor in a mixed allergen murine model of asthma

Li Y Drake 1,✉, Sarah A Wicher 1, Benjamin B Roos 1, Latifa Khalfaoui 1, Lisa Nesbitt 1, Yun Hua Fang 2, Christina M Pabelick 1,2, Y S Prakash 1,2,✉
PMCID: PMC11279745  PMID: 37987758

graphic file with name l-00099-2023r01.jpg

Open in a new tab

Keywords: airway smooth muscle, asthma, GDNF, GFRα1, RET

Abstract

Our previous study showed that glial-derived neurotrophic factor (GDNF) expression is upregulated in asthmatic human lungs, and GDNF regulates calcium responses through its receptor GDNF family receptor α1 (GFRα1) and RET receptor in human airway smooth muscle (ASM) cells. In this study, we tested the hypothesis that airway GDNF contributes to airway hyperreactivity (AHR) and remodeling using a mixed allergen mouse model. Adult C57BL/6J mice were intranasally exposed to mixed allergens (ovalbumin, Aspergillus, Alternaria, house dust mite) over 4 wk with concurrent exposure to recombinant GDNF, or extracellular GDNF chelator GFRα1-Fc. Airway resistance and compliance to methacholine were assessed using FlexiVent. Lung expression of GDNF, GFRα1, RET, collagen, and fibronectin was examined by RT-PCR and histology staining. Allergen exposure increased GDNF expression in bronchial airways including ASM and epithelium. Laser capture microdissection of the ASM layer showed increased mRNA for GDNF, GFRα1, and RET in allergen-treated mice. Allergen exposure increased protein expression of GDNF and RET, but not GFRα1, in ASM. Intranasal administration of GDNF enhanced baseline responses to methacholine but did not consistently potentiate allergen effects. GDNF also induced airway thickening, and collagen deposition in bronchial airways. Chelation of GDNF by GFRα1-Fc attenuated allergen-induced AHR and particularly remodeling. These data suggest that locally produced GDNF, potentially derived from epithelium and/or ASM, contributes to AHR and remodeling relevant to asthma.

NEW & NOTEWORTHY Local production of growth factors within the airway with autocrine/paracrine effects can promote features of asthma. Here, we show that glial-derived neurotrophic factor (GDNF) is a procontractile and proremodeling factor that contributes to allergen-induced airway hyperreactivity and tissue remodeling in a mouse model of asthma. Blocking GDNF signaling attenuates allergen-induced airway hyperreactivity and remodeling, suggesting a novel approach to alleviating structural and functional changes in the asthmatic airway.

INTRODUCTION

Asthma is characterized by airway hyperreactivity (AHR), lung inflammation, and tissue remodeling involving increased epithelial and airway smooth muscle (ASM) proliferation and increased airway fibrosis. Here, ASM cells play an important role in both AHR and remodeling (1–6), being the target of inflammatory mediators. However, there is increasing recognition that both epithelium and ASM can also secrete growth factors and inflammatory mediators with autocrine/paracrine effects that promote and sustain effects of initial exposures toward chronic airway disease (1, 7–14). In this regard, recent studies have identified neurotrophins (NTs) as noncanonical local factors in the airway (15).

Classical NTs such as brain-derived neurotrophic factor (BDNF) and receptors are now known to be expressed and functional in non-neuronal tissues (15–21), contributing to asthma and allergy (16, 18, 20, 22, 23). Such NTs within the lung may be derived from nerves, immune cells, and even ASM (15, 24–26), contributing to AHR and remodeling (27–29). However, beyond these classical NTs, there is now substantial interest in the nervous system regarding a distant member of the TGF-β superfamily that includes glial-derived neurotrophic factor (GDNF), which is the prototypical ligand, acting via its high-affinity receptors GFRα1 in association with the RET receptor (30–39). In the central nervous system (CNS) (35, 40, 41) and in peripheral organs such as the gut (42, 43) or bladder (44), GDNF has been explored toward promoting neuronal survival and function, with only limited exploration of its role in epithelial or mesenchymal cells (42–46). There is currently limited information regarding GDNF in the lung, initially recognized as critical for early lung innervation (47), whereas RET signaling is required for tracheal and primary bronchial innervation (48). GDNF may also influence airway irritability (49) since sensory neurons express RET and GFRα1 (50). However, other airway cell types as GDNF sources and/or targets, particularly in context of AHR and remodeling have not been well explored. We previously reported that human ASM cells express and release GDNF, with greater levels in asthmatic ASM, whereas GDNF enhances intracellular Ca2+ in ASM, thus promoting contractility (51). Whether GDNF contributes to AHR or remodeling particularly in vivo is not known, and this hypothesis was tested in the present study using a mixed allergen mouse model of asthma.

MATERIALS AND METHODS

Mice and Reagents

Animal protocols were approved by the Mayo Clinic Institutional Animal Care and Use Committee and conducted in accordance to guidelines from the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. Mouse colonies were maintained and housed at Mayo Clinic St. Mary’s Hospital vivarium. All mice were provided food and water ad libitum. C57BL/6J mice were purchased from Jackson Laboratory (Bar Harbor, ME) and used at 6–8 wk. Both male and female mice were used for all experiments. Allergen extracts were Alternaria alternata (Greer Laboratories, Lenior, NC), Aspergillus fumigatus (Greer), house dust mite (Greer), and ovalbumin (MilliporeSigma, St. Louis, Missouri). Recombinant human GDNF (No. 212-GD) and GFRα-1 Fc chimera protein (No. 714-GR) were purchased from R&D Systems, Minneapolis, MN.

Mouse Airway Exposure Models

The mixed allergen (MA) model has been previously described (28, 52). The cocktail of allergen extracts includes 10 μg each (total weight) of Alternaria, Aspergillus, HDM, and OVA dissolved in 50 μL of phosphate-buffered saline (PBS). The rationale for using the MA model is: 1) simple sensitization; 2) early, persistent eosinophilic inflammation that is Th2-weighted (52) resembling human asthma; and 3) persistent AHR and airway thickening within 2 wk, allowing for intervention at different time points toward understanding “therapeutic” potential of that intervention. Accordingly, in this study, the goal was to determine the impact of exogenous GDNF in exacerbating ongoing MA-induced AHR or remodeling, and conversely the impact of interfering with endogenous GDNF that may be produced within the airways (via chelation). Therefore, these agents were provided amid the 4-wk MA protocol. GDNF and GFRα1-Fc dosages were chosen based on in vitro experiments and pilot in vivo studies.

Mice were lightly anesthetized with isoflurane and intranasally administered 50 μL MA or PBS three times per week (Mondays, Wednesdays, and Fridays) for 4 wk. In addition, PBS and MA-treated mice were intranasally administered with one of the following GDNF-related reagents for the latter 2 wk of MA treatment: vehicle (0.1% DMSO) 5 times/week (Mondays through Fridays), GDNF (166 ng/kg of body weight) 5 times/week (Mondays through Fridays), or GFRα1-Fc (10 μg/kg) 3 times/week (Mondays, Wednesdays, and Fridays). All treatments were given in the morning. On the days that mice received both MA and GDNF-related reagents, GDNF-related reagents were administered 1 h before MA administration. Twenty-four hours after the last allergen exposure, mice were anesthetized by intraperitoneal injection of ketamine (100 mg/kg) and xylazine (20 mg/kg). Lung function was assessed, and subsequently lung tissues were harvested for histological and molecular analyses. The timeline of mouse treatments is illustrated in Figs. 2A and 4A.

Figure 2.

Figure 2.

Open in a new tab

Effects of exogenous GDNF on airway responses in mice. The protocol for intranasal exposure to PBS or MA or GDNF is illustrated in A, representing a model to explore the impact of GDNF in the context of allergic airway inflammation. Basal or methacholine challenge-induced airway resistance (B) and compliance (C) were measured by FlexiVent. Exogenous GDNF per se potentiated methacholine responses, increasing RL and decreasing CL. GDNF did not consistently potentiate the expected changes in RL or CL following MA. Data are presented as means ± SE (n = 6–8 mice/group). *P < 0.05; **P < 0.01 (two-way ANOVA), significant difference between the groups is indicated by vertical line. GDNF, glial-derived neurotrophic factor; CL, lung compliance; RL, lung dynamic resistance; MA, mixed allergen.

Figure 4.

Figure 4.

Open in a new tab

Effects of GDNF chelation on airway responses in mice. In mice intranasally exposed to PBS or MA, the GDNF chelator GFRα1-Fc was additionally administered as illustrated in A. Methacholine-induced changes in RL enhanced by MA were blunted by GFRα1-Fc which did not significantly influence RL in PBS group (B). Similarly, MA effects on CL were blunted by GFRα1-Fc (C). Symbols represent data from an individual mouse. Data are presented as means ± SE (n = 6–8 mice/group). **P < 0.01 (two-way ANOVA), significant difference between the groups is indicated by vertical line. GDNF, glial-derived neurotrophic factor; GFRα1-Fc, GDNF family receptor α1 chelator; CL, lung compliance; RL, lung dynamic resistance; MA, mixed allergen.

Lung Function Assessment

Mouse lung function was assessed using the FlexiVent (Scireq, Montreal, QC, Canada) as described previously (28, 53). Mice were anesthetized (ketamine/xylazine), placed on a 37°C heated pad, and the trachea was cannulated with a 19-gauge blunt tip cannula. Following vecuronium paralysis, mice were ventilated with positive pressure. Lung dynamic resistance (RL) and compliance (CL) were measured at baseline and after administration of nebulized methacholine at increasing doses (0, 6.3, 12.5, 25, and 50 mg/mL).

Bronchoalveolar Lavage

Following functional measurements, lungs were lavaged with 1 mL PBS. Recovered bronchoalveolar lavage (BAL) fluid was centrifuged (10,000 rpm × 10 min, 4°C). The supernatant was used for ELISA.

ELISA

Lung tissue was homogenized in 0.5 mL PBS with protease inhibitors. Homogenates were centrifuged at 12,000 rpm for 10 min at 4°C, and supernatants were collected. The protein concentrations of lung lysates were determined by Bradford protein assay (Bio-Rad). GDNF levels in BAL and lung lysates were measured using Mouse GDNF ELISA Kit following manufacturer’s instruction (Abcam, No. ab171178). GDNF concentrations were determined from a standard curve and normalized to lung protein concentrations.

Lung Histology

Mouse lungs were inflated with 4% paraformaldehyde at a pressure of 25 cmH2O, and subsequently paraffin-embedded, sectioned at 5 μm, and mounted on glass slides. Tissue slides were randomly selected from two to three independent mouse experiments. Collagen expression was examined by Masson trichrome (MT) staining using standard protocols. Stained slides were scanned using Motic Slide Scanner at ×20 magnification. Five small- to mid-sized bronchial airways from a given mouse lung were randomly selected. Epithelial versus smooth muscle layer borders of bronchial airways were visually identified, and collagen expression in bronchial airways was quantified using Orbit Image Analysis software following protocols established by the software manufacturer (Idorsia Pharmaceuticals Ltd.; Allschwil, Switzerland). Briefly, bronchial airways were analyzed using a pixel-based classification model to differentiate positive staining (inclusion) from the background (exclusion). The amount of positive staining area was expressed as a percentage to the total bronchial airway area. Each data point represents the averaged value from five airways in each mouse.

For immunohistochemistry (IHC) staining, lung sections were processed for deparaffinization, rehydration, and antigen retrieval. The slides were then exposed overnight to polyclonal rabbit antibodies against GDNF (Alomone No. Ant-014; 1:50), GFRα1 (Alomone No. Ant-021; 1:25), RET (Alomone No. Ant-025; 1:50), or fibronectin (Abcam No. ab2413), and costained with a goat anti-α-smooth muscle actin (Abcam No. ab21027; 1:300). After washing, slides were stained using ImmPRESS-AP Horse Anti-Rabbit IgG Polymer Detection Kit (Vector Laboratories, No. MP-5401) or ImmPRESS HRP Horse Anti-Goat IgG Polymer Detection Kit (Vector Laboratories, No. MP-7405). Subsequently, the slides were counterstained with Gill’s II Hematoxylin followed by the standard dehydration steps. Stained tissue sections were digitally scanned. Five small- to mid-sized bronchial airways from a given mouse lung section were randomly selected. The positive staining of fibronectin, GDNF, GFRα1, and RET was quantified using Orbit Image Analysis software as described in the paragraph above.

For airway thickness analysis, three representative bronchial airways were randomly selected from each lung section. The borders of bronchial airways were visually identified and ASM layers in bronchial airways were identified by anti-α-smooth muscle actin staining. The average thickness of the airways and ASM layers were quantified using QuPath software (54).

Laser Capture Microdissection

The techniques for laser capture microdissection (LCM) isolation and analysis of ASM layer have been previously described (28). Under RNase-free conditions, harvested lungs were immediately frozen in liquid nitrogen and stored at −80°C. Frozen lungs were cut into 10 µm sections and processed as previously described (28). LCM was performed using an Arcturus XT microdissection system (Molecular Devices, Sunnyvale, CA). Small airways (300–350 mm diameter) were visualized under light microscopy (3,200 magnification). Using an infrared laser, ASM and epithelial layers were microdissected and captured onto CapSure Macro LCM caps. Total RNA was isolated from caps for cDNA synthesis and quantitative RT-PCR (Roche LightCycler 96 System; Roche Diagnostics, Indianapolis, IN). Expression of mRNA was calculated using the ΔΔCt method, with GAPDH used as the reference gene (Forward: TCGGTGTGAACGGATTTGGCCGTATT. Reverse: CCGTTGATGACAAGCTTCCCATTGTC). mRNA expression of α-smooth muscle actin (Forward: TCCGATAGAACACGGCA. Reverse: CCACATACATGGCGGG) and E-cadherin was used to validate relative purity of ASM versus airway epithelial layers. E-cadherin, GDNF, GFRα1, and RET primers were custom-designed by Integrated DNA Technologies.

Statistical Analysis

Statistical analyses were performed using GraphPad Prism Software (La Jolla, CA). Data were analyzed by one-way ANOVA, two-way ANOVA, or mixed-effects analysis as appropriate. Statistical significance is indicated by P < 0.05, P < 0.01. Values are presented as means ± SE.

RESULTS

Allergen Exposure Increases Expression of GDNF and Receptors in Mouse ASM

Our previous study showed that GDNF is expressed in human lungs and its expression is upregulated by asthma (51). To determine functional relevance in vivo and whether GDNF expression is upregulated by allergic airway inflammation, we used the MA mouse model. We examined GDNF levels in BAL and lung lysates of mice that were intranasally administered with PBS versus MA. ELISA results showed that MA-treated mice had a trend toward higher GDNF levels in both BAL and lungs compared with PBS-treated mice, although the differences were not statistically significant (Fig. 1, A and B).

Figure 1.

Figure 1.

Open in a new tab

Glial-derived neurotrophic factor (GDNF) and its receptors in mouse airways. In C57BL/6J mice intranasally exposed to PBS or mixed allergens (MA; see materials and methods) 3 times/week for 4 wk, GDNF protein levels in BAL (A) and lung homogenates (B) determined by ELISA showed a trend toward increased levels with MA exposure. Gene expression for GDNF and its receptors GFRα1 and RET in mouse ASM was determined by laser capture microdissected samples and qRT-PCR (C) which showed significant increases with MA exposure. D: representative images of chromogenic double staining for GDNF and its receptors (red staining) and smooth muscle actin (brown staining) with cell nuclei counterstained with hematoxylin (blue staining). Analysis of GDNF and its receptor expression in bronchial airways (E) or ASM (F) confirmed increased expression with MA, particularly of GDNF. Symbols represent data from an individual mouse (n = 4–6 mice/group). Data are presented as means ± SE. *P < 0.05; **P < 0.01 (unpaired Student’s t tests or mixed-effects analysis), significant difference between the groups is indicated by horizontal line. ASM, airway smooth muscle; GFRα1, GDNF family receptor α1.

Based on our previous observation that human ASM expresses GDNF and its receptors GFRα1 and RET (51), we specifically examined expression of GDNF and its receptors in the ASM layer by two approaches. First, we studied mRNA changes in LCM samples of the ASM layer. By qRT-PCR, we found that mouse ASM expresses GDNF, GFRα1, and RET mRNA, and MA treatment significantly increased the gene expression of these three proteins (Fig. 1C). Second, we assessed the protein expression of GDNF and its receptors in mouse lungs by IHC staining. In PBS-treated mice, we found that GDNF and its receptors are mainly expressed in bronchial airways that include both epithelium and ASM layer (Fig. 1D). MA exposure significantly increased GDNF protein expression in bronchial airways (Fig. 1, D and E). GFRα1 expression also trended to be increased in MA-treated mouse lungs, whereas RET expression showed no increase after MA exposure (Fig. 1E). In addition to bronchial airways, MA treatment also induced expression of GDNF and its receptors in alveolar epithelial cells and infiltrating immune cells (Fig. 1D). Staining was also noted in the pulmonary vasculature. We further analyzed the expression of GDNF and its receptors specifically in ASM layers of bronchial airways. We found that ASM expression of GDNF and RET, but not GFRα1, were significantly increased in ASM of MA-treated mouse lungs (Fig. 1F).

GDNF Increases AHR and Collagen Deposition in Mouse Airways

Our human ASM study showed that GDNF regulates [Ca2+]i responses with enhanced responses in asthmatic ASM, suggesting that GDNF regulates AHR. To examine whether GDNF regulates ASM function in vivo, we intranasally administered exogenous GDNF (166 ng/kg) to either control mice or to MA-treated mice (Fig. 2A) and then measured airway resistance (RL) and airway compliance (CL) by FlexiVent. GDNF dosage was chosen based on in vitro experiments and pilot in vivo experiments. All treated mice showed normal behavior and maintained weight. In control mice (i.e., not sensitized with MA), exposure to GDNF did not change basal RL, but did decrease basal CL (Fig. 2, B and C). In response to methacholine, GDNF significantly increased RL and decreased CL. In MA-treated mice, exogenous GDNF was administered after the mice were exposed to MA for 2 wk already, addressing the question whether GDNF worsens MA-induced pathological changes in the lung. As expected, MA significantly increased RL and decreased CL by itself. However, exogenous GDNF had no additional effect on RL per se, but further decreased CL in MA-treated mice (Fig. 2, B and C).

Given the findings of GDNF effects on CL in particular, we investigated lung tissue remodeling. First, we analyzed the thickness of bronchial airways that includes both ASM layers and epithelium layers. Furthermore, we specifically analyzed the thickness of ASM layers in bronchial airways. Both MA and exogenous GDNF each induced significant thickening of bronchial airways including ASM layers (Fig. 3, A and B). Coexposure to MA and GDNF did not have synergistic effects. Second, we analyzed collagen expression by Masson trichome (MT) staining and fibronectin expression by IHC staining. MT staining showed that MA or GDNF exposure significantly increased airway collagen protein expression (Fig. 3, C and E). MA slightly increased fibronectin protein expression in bronchial airways, whereas GDNF had no effects on fibronectin expression (Fig. 3, D and F).

Figure 3.

Figure 3.

Open in a new tab

Effects of exogenous GDNF on airway remodeling in mice. Within bronchial airways, overall thickness (A) or that of the ASM layer (B) was quantified using tissue sections stained with anti-α-smooth muscle actin (to highlight the ASM layer). Collagen deposition in bronchial airways was quantified using Masson trichrome (MT) staining (C and E) and fibronectin deposition using IHC staining (D and F). Representative images are shown in (C and D). Dark brown color indicates α-smooth muscle actin staining and red color indicates fibronectin staining (D). Symbols represent data from an individual mouse (n = 6 mice/group). Data are presented as means ± SE. *P < 0.05; **P < 0.01 (one-way ANOVA), significant difference between the groups is indicated by horizontal line. ASM, airway smooth muscle; GDNF, glial-derived neurotrophic factor; IHC, immunohistochemistry.

Blocking GDNF Signaling Decreases Allergen-Induced AHR

To determine the functional roles of GDNF in MA-induced AHR, we intranasally administered extracellular GDNF chelator GFRα1-Fc (10 μg/kg) with or without concurrent MA exposure (Fig. 4A). When lung function was assessed, we found that GFRα1-Fc treatment did not have significant effects on baseline RL or CL in PBS or MA-treated mice. However, GFRα1-Fc significantly decreased methacholine-induced RL in MA-treated mice (Fig. 4, B and C).

Blocking GDNF Signaling Attenuates Allergen-Induced Remodeling

To determine the functional roles of GDNF in MA-induced lung tissue remodeling, we examined bronchial airway thickness and collagen expression in lungs of mice treated with MA and GDNF chelator GFRα1-Fc. We found that GFRα1-Fc treatment significantly attenuated MA-induced ASM thickening in bronchial airways without significant effects on the overall thickness of bronchial airways (Fig. 5, A and B). Moreover, GFRα1-Fc treatment significantly reduced collagen deposition within bronchial airways (Fig. 5, C and D).

Figure 5.

Figure 5.

Open in a new tab

Effects of GDNF chelation on airway remodeling in mice. Thickness of ASM layers (A) or bronchial airways (B) was quantified, which showed a blunting effect of GFRα1-Fc, particularly in the ASM. Collagen deposition in bronchial airways quantified using MT staining (C and D) showed a blunting effect of GFRα1-Fc on collagen expression. Symbols represent data from an individual mouse (n = 4–6 mice/group). Data are presented as means ± SE. *P < 0.05; **P < 0.01 (one-way ANOVA), significant difference between the groups is indicated by horizontal line. ASM, airway smooth muscle; GDNF, glial-derived neurotrophic factor; GFRα1-Fc, GDNF family receptor α1 chelator; MT, Masson trichrome.

DISCUSSION

Limited previous exploration by our group established that GDNF can be secreted by human ASM, contributing to [Ca2+]i regulation, with greater GDNF levels and activity in individuals with asthma. To our knowledge, the present study is the first to demonstrate that GDNF contributes to allergen-induced AHR and tissue remodeling in an in vivo model of allergic asthma. Exogenous GDNF promotes AHR (Fig. 2) and thus highlights a functional GDNF signaling system within the airway. Lung GDNF and its receptors within ASM are indeed increased in the MA model (Fig. 1), correlating with our in vitro human asthmatic ASM data (51). Functionally, GDNF appears to have an autocrine/paracrine effect such that chelation of airway GDNF via GFRα1-Fc blunts MA-induced AHR and remodeling (Figs. 4 and 5). In this regard, it appears that GDNF effects on remodeling are particularly consistent reflected by changes in airway compliance and/or extracellular matrix deposition by histology. Overall, these data point to a functionally relevant GDNF system within airways that is potentially targetable toward alleviating multiple features of asthma.

Classical neurotrophins such as BDNF are well-known growth factors in the nervous system where they are considered protective with effects on development, differentiation, repair, and regeneration (55, 56). As with classical NTs, GDNF is also considered protective as noted in Parkinson’s disease (35, 40, 41). However, with increasing recognition that NTs and their receptors are expressed in non-neural tissues including the lung (15–21), understanding their regulation and influence in peripheral organs becomes significant. We previously demonstrated that ASM produces and is also a target of BDNF in the context of asthma (35, 40, 41). More recently, we found that GDNF is also expressed by ASM and contributes to increased [Ca2+]i (51). Thus, it appears that NTs including BDNF and GDNF have the opposite effect in airways compared with the nervous system. However, there is limited data in vivo regarding the role of NTs. In the present study, we demonstrate the relevance of GDNF in the mouse model.

GDNF and its family members are nonclassical NTs and their receptors (GDNF family receptors; GFLs) are a distant member of the TGF-β superfamily (30–39). GFLs are specific to their ligands, and GDNF signals through GFRα1, often with dimerization to the RET receptor (30–33, 57, 58). There are only limited data on GDNF, GFLs, and RET in the lung outside of the lung cancer field. GDNF and RET signaling are considered important for early lung innervation (35, 40, 41). In guinea pigs, OVA enhances epithelial GDNF, whereas airway neurons show increased TRPV1 in response to GDNF, suggesting that GDNF contributes to airway irritability (49). Vagal sensory neurons also express RET and GFRα1 (50). However, all this previous work is focused on neuronal aspects of GDNF expression or signaling. Potential roles for GDNF in other airway cell types as sources and/or targets in the context of AHR or remodeling are limited. For example, in patients with COPD, studies from bronchial biopsies suggest that GDNF is associated with mucus hypersecretion (59). GDNF expression or function in epithelium could have at least indirect effects on ASM. Our results showing epithelial expression of GDNF is consistent with that idea. Whether smooth muscle GDNF per se is important is not known. Our previous study (51) was the first to highlight both expression and function of GDNF in the context of asthma, showing that GDNF is expressed in human lung including by ASM, and that GDNF expression is increased in individuals with mild-moderate asthma. Consistently, we had also found that ASM GDNF and GFRα1 are increased by proinflammatory cytokines such as TNFα, consistent with the overall idea that if GDNF signaling is persistent within asthmatic airways, they may be detrimental in the airways.

Consistent with previous in vitro work, we found that GDNF is expressed to a substantial extent within mouse lungs including ASM (Fig. 1). LCM-based analysis of the ASM layer in bronchial airways clearly showed a substantial increase in GDNF with MA. This was further confirmed by IHC of both bronchial airways as well as ASM per se. Although we did not explore parenchymal expression, cursory examination of lung sections immunostained for GDNF or its receptors showed expression within macrophages and alveolar type 2 cells in MA animals, overall suggesting that the GDNF system may be particularly relevant to specific areas of the lung. Of note, vascular staining was observed which may have implications in GDNF regulation of vascular tone and/or remodeling. Although MA induces a significant increase of GFRα1 mRNA expression in ASM layer (Fig. 1C), GFRα1 protein expression in ASM is comparable in PBS and MA-treated mice (Fig. 1F). Separately, we noted the expression of GDNF in epithelium in addition to ASM. Although we did not specifically explore changes with MA with this cell type, the IHC does suggest a change. These studies suggest that with epithelium and ASM being sources, and ASM expressing the receptor, ASM could be a source and target for GDNF including under conditions of allergic inflammation. Here it is interesting to note the discrepancies between mRNA and protein levels for the receptor, for example, that may indicate a posttranscription regulation in GFRα1 expression.

In whole lung, there is a trend toward increased levels of GDNF protein following MA administration. Although we would have expected a more substantial increase in whole lung GDNF, it is also important to consider that GDNF expression is likely not uniform across different parts of the lung, as suggested by expression particularly in airways but less so in other areas. Furthermore, as locally produced growth factor, GDNF is rapidly cleaved in the extracellular space to limit its effects. Accordingly, it is possible that the whole lung levels do not necessarily reflect the dynamics of GDNF within the bronchial airways. From a technical perspective, insensitivity of ELISA assays and antibody differences between ELISA and IHC assays may also need to be considered.

Our current and previous study showed the presence of GDNF and its receptors in the airway. Consistent with the finding of receptors within ASM, the current study found that GDNF by itself enhances airway contractility to methacholine influencing airway resistance (RL) (Fig. 2). Of note, our previous studies had used acute (short-term) GDNF exposures to explore changes in [Ca2+]i which should translate into increased contractility (51). However, the results of the present study show that even chronic (2 wk) exposures to GDNF result in sustained effects toward contractility. Interestingly, baseline RL per se was not influenced by exogenous GDNF while responses to methacholine were enhanced, suggesting a more potentiating role for GDNF in the presence of bronchoconstrictor agents. Although we did not specifically examine the mechanisms of sustained GDNF action, upregulation of Ca2+ and contractile machinery or of muscarinic receptors within the airways could be hypothesized. It is possible that exogenous GDNF also promotes neuronal activity or sensitivity, however, the FlexiVent approach would not differentiate between direct versus indirect effects. Interestingly, while MA increased RL as expected, GDNF did not potentiate MA effects, in spite of the recognition that MA upregulates receptor expression within the airways. Whether this reflects a saturation of airway hypercontractile responses due to MA, without additional effect by GDNF, or whether MA somehow blunts GDNF functionality, are not known, and remains to be explored.

The most consistent finding in our study was that GDNF affects airway remodeling. The initial indication was the change in compliance (CL) following exogenous GDNF administration (Fig. 2C). Interestingly, unlike with RL, GDNF somewhat further reduced CL even in the presence of MA which had a substantial impact on CL in the first place. Consistent with these functional findings, GDNF by itself promoted bronchial thickening including that of the ASM layer as revealed by histomorphometry. Such changes were associated with increased collagen staining but surprisingly not fibronectin (Fig. 3).

Although the effects of exogenous GDNF per se are relevant to establishing functionality of the GDNF system within the mouse airway including in the MA model, from a future therapeutic perspective, understanding of endogenous airway GDNF would be most interesting. In this regard, we had previously shown that human ASM produces GDNF, and that GDNF secretion is increased in asthmatic ASM (51). Although the current study did not specifically explore upstream regulation of GDNF or its receptors, the role of inflammation would be a reasonable hypothesis, especially given our previous finding of TNFα effects on GDNF in human ASM (51). Furthermore, in neuronal cells (60–62), GDNF is also increased by proinflammatory cytokines such as TNFα, IL-1β, and IFNγ. Consistent with the overall idea of endogenous airway GDNF, we explored the impact of chelating such secreted GDNF within the airways using GFRα1-Fc. Interestingly, GFRα1-Fc alone blunted airway responses to methacholine underling the idea that airways do produce GDNF that have autocrine/paracrine influences on contractility. In the presence of MA, GFRα1-Fc was particularly effective in blunting AHR, and trended toward improving compliance (Fig. 4). A limitation of our study in this regard is the use of a single concentration of GFRα1-Fc which may not have completely chelated all of the secreted GDNF. Furthermore, we currently do not know whether intratracheally administered GFRα1-Fc has access to the full thickness of the airways, particularly in the presence of MA-induced changes. Regardless, consistent with the functional findings, we noted that GFRα1-Fc reduces MA-enhancement of airway thickness and substantially blunts collagen deposition, again highlighting the role of GDNF in MA effects (Fig. 5).

An interesting finding is that GDNF seems to influence remodeling that is already occurring within the MA airway (since GFRα1-Fc was administered 2 wk into the MA protocol). In exploring other NTs, we had previously found that BDNF may be involved in initiation of airway remodeling but less so once remodeling was established (28). Our GDNF data show that interference with GDNF is effective, particularly on remodeling even later in the process, making it particularly appealing toward future therapeutic targeting in airway disease with ongoing remodeling.

In summary, our novel findings using a MA model of allergic asthma show the importance of endogenous GDNF expression and signaling within bronchial airways toward AHR and particularly remodeling. Interference with GDNF signaling even with established AHR or remodeling may provide an avenue for blunting the impact of inflammation on airway structure and function.

DATA AVAILABILITY

Data will be made available upon reasonable request.

GRANTS

This work was supported by NIH Grants R01 HL088029 (to Y.S.P.) and R01 HL142061 (to C.M.P.).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Y.S.P. conceived and designed research; L.Y.D., S.A.W., B.B.R., L.N., and Y.H.F. performed experiments; L.Y.D., S.A.W., B.B.R., and L.K. analyzed data; L.Y.D. and B.B.R. interpreted results of experiments; L.Y.D., S.A.W., and L.K. prepared figures; L.Y.D. drafted manuscript; C.M.P. and Y.S.P. edited and revised manuscript; L.Y.D., S.A.W., B.B.R., L.K., L.N., Y.H.F., C.M.P., and Y.S.P. approved final version of manuscript.

ACKNOWLEDGMENTS

Graphical abstract was created with a licensed version of BioRender.com.

REFERENCES

  • 1. Holgate ST. Pathogenesis of asthma. Clin Exp Allergy 38: 872–897, 2008. doi: 10.1111/j.1365-2222.2008.02971.x. [DOI] [PubMed] [Google Scholar]
  • 2. Rydell-Törmänen K, Risse PA, Kanabar V, Bagchi R, Czubryt MP, Johnson JR. Smooth muscle in tissue remodeling and hyper-reactivity: airways and arteries. Pulm Pharmacol Ther 26: 13–23, 2012. doi: 10.1016/j.pupt.2012.04.003. [DOI] [PubMed] [Google Scholar]
  • 3. Royce SG, Cheng V, Samuel CS, Tang ML. The regulation of fibrosis in airway remodeling in asthma. Mol Cell Endocrinol 351: 167–175, 2012. doi: 10.1016/j.mce.2012.01.007. [DOI] [PubMed] [Google Scholar]
  • 4. Prakash YS. Airway smooth muscle in airway reactivity and remodeling: what have we learned? Am J Physiol Lung Cell Mol Physiol 305: L912–L933, 2013. doi: 10.1152/ajplung.00259.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Burgess JK, Ceresa C, Johnson SR, Kanabar V, Moir LM, Nguyen TT, Oliver BG, Schuliga M, Ward J. Tissue and matrix influences on airway smooth muscle function. Pulm Pharmacol Ther 22: 379–387, 2009. doi: 10.1016/j.pupt.2008.12.007. [DOI] [PubMed] [Google Scholar]
  • 6. Hirota N, Martin JG. Mechanisms of airway remodeling. Chest 144: 1026–1032, 2013. doi: 10.1378/chest.12-3073. [DOI] [PubMed] [Google Scholar]
  • 7. Churg A, Zhou S, Wright JL. Series “matrix metalloproteinases in lung health and disease”: Matrix metalloproteinases in COPD. Eur Respir J 39: 197–209, 2012. doi: 10.1183/09031936.00121611. [DOI] [PubMed] [Google Scholar]
  • 8. Lagente V, Boichot E. Role of matrix metalloproteinases in the inflammatory process of respiratory diseases. J Mol Cell Cardiol 48: 440–444, 2010. doi: 10.1016/j.yjmcc.2009.09.017. [DOI] [PubMed] [Google Scholar]
  • 9. Halwani R, Al-Muhsen S, Al-Jahdali H, Hamid Q. Role of transforming growth factor-β in airway remodeling in asthma. Am J Respir Cell Mol Biol 44: 127–133, 2011. doi: 10.1165/rcmb.2010-0027TR. [DOI] [PubMed] [Google Scholar]
  • 10. Al-Muhsen S, Johnson JR, Hamid Q. Remodeling in asthma. J Allergy Clin Immunol 128: 451–462, 2011. doi: 10.1016/j.jaci.2011.04.047. [DOI] [PubMed] [Google Scholar]
  • 11. Hamid Q, Tulic M. Immunobiology of asthma. Annu Rev Physiol 71: 489–507, 2009. doi: 10.1146/annurev.physiol.010908.163200. [DOI] [PubMed] [Google Scholar]
  • 12. Dekkers BG, Maarsingh H, Meurs H, Gosens R. Airway structural components drive airway smooth muscle remodeling in asthma. Proc Am Thorac Soc 6: 683–692, 2009. doi: 10.1513/pats.200907-056DP. [DOI] [PubMed] [Google Scholar]
  • 13. Davies DE. The role of the epithelium in airway remodeling in asthma. Proc Am Thorac Soc 6: 678–682, 2009. doi: 10.1513/pats.200907-067DP. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Elshaw SR, Henderson N, Knox AJ, Watson SA, Buttle DJ, Johnson SR. Matrix metalloproteinase expression and activity in human airway smooth muscle cells. Br J Pharmacol 142: 1318–1324, 2004. doi: 10.1038/sj.bjp.0705883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Prakash YS, Martin RJ. Brain-derived neurotrophic factor in the airways. Pharmacol Ther 143: 74–86, 2014. doi: 10.1016/j.pharmthera.2014.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Lommatzsch M, Braun A, Renz H. Neurotrophins in allergic airway dysfunction: what the mouse model is teaching us. Ann NY Acad Sci 992: 241–249, 2003. doi: 10.1111/j.1749-6632.2003.tb03154.x. [DOI] [PubMed] [Google Scholar]
  • 17. Ricci A, Felici L, Mariotta S, Mannino F, Schmid G, Terzano C, Cardillo G, Amenta F, Bronzetti E. Neurotrophin and neurotrophin receptor protein expression in the human lung. Am J Respir Cell Mol Biol 30: 12–19, 2004. doi: 10.1165/rcmb.2002-0110OC. [DOI] [PubMed] [Google Scholar]
  • 18. Yao Q, Haxhiu MA, Zaidi SI, Liu S, Jafri A, Martin RJ. Hyperoxia enhances brain-derived neurotrophic factor and tyrosine kinase B receptor expression in peribronchial smooth muscle of neonatal rats. Am J Physiol Lung Cell Mol Physiol 289: L307–L314, 2005. doi: 10.1152/ajplung.00030.2005. [DOI] [PubMed] [Google Scholar]
  • 19. Prakash YS, Iyanoye A, Ay B, Mantilla CB, Pabelick CM. Neurotrophin effects on intracellular Ca2+ and force in airway smooth muscle. Am J Physiol Lung Cell Mol Physiol 291: L447–L456, 2006. doi: 10.1152/ajplung.00501.2005. [DOI] [PubMed] [Google Scholar]
  • 20. Nassenstein C, Dawbarn D, Pollock K, Allen SJ, Erpenbeck VJ, Spies E, Krug N, Braun A. Pulmonary distribution, regulation, and functional role of Trk receptors in a murine model of asthma. J Allergy Clin Immunol 118: 597–605, 2006. doi: 10.1016/j.jaci.2006.04.052. [DOI] [PubMed] [Google Scholar]
  • 21. Prakash Y, Thompson MA, Meuchel L, Pabelick CM, Mantilla CB, Zaidi S, Martin RJ. Neurotrophins in lung health and disease. Expert Rev Respir Med 4: 395–411, 2010. doi: 10.1586/ers.10.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hoyle GW. Neurotrophins and lung disease. Cytokine Growth Factor Rev 14: 551–558, 2003. doi: 10.1016/s1359-6101(03)00061-3. [DOI] [PubMed] [Google Scholar]
  • 23. Chaudhuri R, McMahon AD, McSharry CP, Macleod KJ, Fraser I, Livingston E, Thomson NC. Serum and sputum neurotrophin levels in chronic persistent cough. Clin Exp Allergy 35: 949–953, 2005. doi: 10.1111/j.1365-2222.2005.02286.x. [DOI] [PubMed] [Google Scholar]
  • 24. Barrios J, Ai X. Neurotrophins in asthma. Curr Allergy Asthma Rep 18: 10, 2018. doi: 10.1007/s11882-018-0765-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Kistemaker LEM, Prakash YS. Airway innervation and plasticity in asthma. Physiology (Bethesda) 34: 283–298, 2019. doi: 10.1152/physiol.00050.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Manti S, Brown P, Perez MK, Piedimonte G. The role of neurotrophins in inflammation and allergy. Vitam Horm 104: 313–341, 2017. doi: 10.1016/bs.vh.2016.10.010. [DOI] [PubMed] [Google Scholar]
  • 27. Aravamudan B, Thompson M, Pabelick C, Prakash YS. Brain-derived neurotrophic factor induces proliferation of human airway smooth muscle cells. J Cell Mol Med 16: 812–823, 2012. doi: 10.1111/j.1582-4934.2011.01356.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Britt RD Jr, Thompson MA, Wicher SA, Manlove LJ, Roesler A, Fang YH, Roos C, Smith L, Miller JD, Pabelick CM, Prakash YS. Smooth muscle brain-derived neurotrophic factor contributes to airway hyperreactivity in a mouse model of allergic asthma. FASEB J 33: 3024–3034, 2019. doi: 10.1096/fj.201801002R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Freeman MR, Sathish V, Manlove L, Wang S, Britt RD Jr, Thompson MA, Pabelick CM, Prakash YS. Brain-derived neurotrophic factor and airway fibrosis in asthma. Am J Physiol Lung Cell Mol Physiol 313: L360–L370, 2017. doi: 10.1152/ajplung.00580.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Cintrón-Colón AF, Almeida-Alves G, Boynton AM, Spitsbergen JM. GDNF synthesis, signaling, and retrograde transport in motor neurons. Cell Tissue Res 382: 47–56, 2020. doi: 10.1007/s00441-020-03287-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Kawai K, Takahashi M. Intracellular RET signaling pathways activated by GDNF. Cell Tissue Res 382: 113–123, 2020. doi: 10.1007/s00441-020-03262-1. [DOI] [PubMed] [Google Scholar]
  • 32. Mahato AK, Sidorova YA. Glial cell line-derived neurotrophic factors (GFLs) and small molecules targeting RET receptor for the treatment of pain and Parkinson's disease. Cell Tissue Res 382: 147–160, 2020. doi: 10.1007/s00441-020-03227-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Durbec P, Marcos-Gutierrez CV, Kilkenny C, Grigoriou M, Wartiowaara K, Suvanto P, Smith D, Ponder B, Costantini F, Saarma M. GDNF signalling through the Ret receptor tyrosine kinase. Nature 381: 789–793, 1996. doi: 10.1038/381789a0. [DOI] [PubMed] [Google Scholar]
  • 34. Airaksinen MS, Saarma M. The GDNF family: signalling, biological functions and therapeutic value. Nat Rev Neurosci 3: 383–394, 2002. doi: 10.1038/nrn812. [DOI] [PubMed] [Google Scholar]
  • 35. Ibáñez CF, Andressoo JO. Biology of GDNF and its receptors - relevance for disorders of the central nervous system. Neurobiol Dis 97: 80–89, 2017. doi: 10.1016/j.nbd.2016.01.021. [DOI] [PubMed] [Google Scholar]
  • 36. Rossi J, Airaksinen MS. GDNF family signalling in exocrine tissues: distinct roles for GDNF and neurturin in parasympathetic neuron development. Adv Exp Med Biol 506: 19–26, 2002. doi: 10.1007/978-1-4615-0717-8_2. [DOI] [PubMed] [Google Scholar]
  • 37. Sariola H. The neurotrophic factors in non-neuronal tissues. Cell Mol Life Sci 58: 1061–1066, 2001. doi: 10.1007/PL00000921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Sariola H, Saarma M. Novel functions and signalling pathways for GDNF. J Cell Sci 116: 3855–3862, 2003. doi: 10.1242/jcs.00786. [DOI] [PubMed] [Google Scholar]
  • 39. Takahashi M. The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev 12: 361–373, 2001. doi: 10.1016/s1359-6101(01)00012-0. [DOI] [PubMed] [Google Scholar]
  • 40. Tome D, Fonseca CP, Campos FL, Baltazar G. Role of neurotrophic factors in Parkinson's disease. Curr Pharm Des 23: 809–838, 2017. doi: 10.2174/1381612822666161208120422. [DOI] [PubMed] [Google Scholar]
  • 41. Sampaio TB, Savall AS, Gutierrez MEZ, Pinton S. Neurotrophic factors in Alzheimer's and Parkinson's diseases: implications for pathogenesis and therapy. Neural Regen Res 12: 549–557, 2017. doi: 10.4103/1673-5374.205084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Schriemer D, Sribudiani Y, A IJ, Natarajan D, MacKenzie KC, Metzger M, Binder E, Burns AJ, Thapar N, Hofstra RMW, Eggen BJL. Regulators of gene expression in enteric neural crest cells are putative Hirschsprung disease genes. Dev Biol 416: 255–265, 2016. doi: 10.1016/j.ydbio.2016.06.004. [DOI] [PubMed] [Google Scholar]
  • 43. Sasselli V, Pachnis V, Burns AJ. The enteric nervous system. Dev Biol 366: 64–73, 2012. doi: 10.1016/j.ydbio.2012.01.012. [DOI] [PubMed] [Google Scholar]
  • 44. Marcotte M, Sharma R, Bouchard M. Gene regulatory network of renal primordium development. Pediatr Nephrol 29: 637–644, 2014. doi: 10.1007/s00467-013-2635-0. [DOI] [PubMed] [Google Scholar]
  • 45. Runeberg-Roos P, Saarma M. Neurotrophic factor receptor RET: structure, cell biology, and inherited diseases. Ann Med 39: 572–580, 2007. doi: 10.1080/07853890701646256. [DOI] [PubMed] [Google Scholar]
  • 46. Costantini F, Shakya R. GDNF/Ret signaling and the development of the kidney. Bioessays 28: 117–127, 2006. doi: 10.1002/bies.20357. [DOI] [PubMed] [Google Scholar]
  • 47. Tollet J, Everett AW, Sparrow MP. Development of neural tissue and airway smooth muscle in fetal mouse lung explants: a role for glial-derived neurotrophic factor in lung innervation. Am J Respir Cell Mol Biol 26: 420–429, 2002. doi: 10.1165/ajrcmb.26.4.4713. [DOI] [PubMed] [Google Scholar]
  • 48. Langsdorf A, Radzikinas K, Kroten A, Jain S, Ai X. Neural crest cell origin and signals for intrinsic neurogenesis in the mammalian respiratory tract. Am J Respir Cell Mol Biol 44: 293–301, 2011. doi: 10.1165/rcmb.2009-0462OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Lieu TM, Myers AC, Meeker S, Undem BJ. TRPV1 induction in airway vagal low-threshold mechanosensory neurons by allergen challenge and neurotrophic factors. Am J Physiol Lung Cell Mol Physiol 302: L941–L948, 2012. doi: 10.1152/ajplung.00366.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Lieu T, Kollarik M, Myers AC, Undem BJ. Neurotrophin and GDNF family ligand receptor expression in vagal sensory nerve subtypes innervating the adult guinea pig respiratory tract. Am J Physiol Lung Cell Mol Physiol 300: L790–L798, 2011. doi: 10.1152/ajplung.00449.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Bhallamudi S, Roos BB, Teske JJ, Wicher SA, McConico A, C MP, Sathish V, Prakash YS. Glial-derived neurotrophic factor in human airway smooth muscle. J Cell Physiol 236: 8184–8196, 2021. doi: 10.1002/jcp.30489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Iijima K, Kobayashi T, Hara K, Kephart GM, Ziegler SF, McKenzie AN, Kita H. IL-33 and thymic stromal lymphopoietin mediate immune pathology in response to chronic airborne allergen exposure. J Immunol 193: 1549–1559, 2014. doi: 10.4049/jimmunol.1302984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Faksh A, Britt RD Jr, Vogel ER, Kuipers I, Thompson MA, Sieck GC, Pabelick CM, Martin RJ, Prakash YS. Effects of antenatal lipopolysaccharide and postnatal hyperoxia on airway reactivity and remodeling in a neonatal mouse model. Pediatr Res 79: 391–400, 2016. doi: 10.1038/pr.2015.232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Bankhead P, Loughrey MB, Fernández JA, Dombrowski Y, McArt DG, Dunne PD, McQuaid S, Gray RT, Murray LJ, Coleman HG, James JA, Salto-Tellez M, Hamilton PW. QuPath: Open source software for digital pathology image analysis. Sci Rep 7: 16878, 2017. doi: 10.1038/s41598-017-17204-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Hennigan A, O'Callaghan RM, Kelly AM. Neurotrophins and their receptors: roles in plasticity, neurodegeneration and neuroprotection. Biochem Soc Trans 35: 424–427, 2007. doi: 10.1042/BST0350424. [DOI] [PubMed] [Google Scholar]
  • 56. Blum R, Konnerth A. Neurotrophin-mediated rapid signaling in the central nervous system: mechanisms and functions. Physiology (Bethesda) 20: 70–78, 2005. doi: 10.1152/physiol.00042.2004. [DOI] [PubMed] [Google Scholar]
  • 57. Trupp M, Arenas E, Fainzilber M, Nilsson AS, Sieber BA, Grigoriou M, Kilkenny C, Salazar-Grueso E, Pachnis V, Arumäe U. Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381: 785–789, 1996. doi: 10.1038/381785a0. [DOI] [PubMed] [Google Scholar]
  • 58. Trupp M, Rydén M, Jörnvall H, Funakoshi H, Timmusk T, Arenas E, Ibanez CF. Peripheral expression and biological activities of GDNF, a new neurotrophic factor for avian and mammalian peripheral neurons. J Cell Biol 130: 137–148, 1995. doi: 10.1083/jcb.130.1.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Dijkstra AE, Boezen HM, van den Berge M, Vonk JM, Hiemstra PS, Barr RG, Burkart KM, Manichaikul A, Pottinger TD, Silverman EK, Cho MH, Crapo JD, Beaty TH, Bakke P, Gulsvik A, Lomas DA, Bossé Y, Nickle DC, Paré PD, de Koning HJ, Lammers JW, Zanen P, Smolonska J, Wijmenga C, Brandsma CA, Groen HJ, Postma DS; LifeLines Cohort Study group. Dissecting the genetics of chronic mucus hypersecretion in smokers with and without COPD. Eur Respir J 45: 60–75, 2015. doi: 10.1183/09031936.00093314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Verity AN, Wyatt TL, Hajos B, Eglen RM, Baecker PA, Johnson RM. Regulation of glial cell line-derived neurotrophic factor release from rat C6 glioblastoma cells. J Neurochem 70: 531–539, 1998. doi: 10.1046/j.1471-4159.1998.70020531.x. [DOI] [PubMed] [Google Scholar]
  • 61. Suter-Crazzolara C, Unsicker K. GDNF mRNA levels are induced by FGF-2 in rat C6 glioblastoma cells. Brain Res Mol Brain Res 41: 175–182, 1996. doi: 10.1016/0169-328x(96)00089-7. [DOI] [PubMed] [Google Scholar]
  • 62. Appel E, Kolman O, Kazimirsky G, Blumberg PM, Brodie C. Regulation of GDNF expression in cultured astrocytes by inflammatory stimuli. Neuroreport 8: 3309–3312, 1997. doi: 10.1097/00001756-199710200-00023. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available upon reasonable request.

Articles from American Journal of Physiology - Lung Cellular and Molecular Physiology are provided here courtesy of American Physiological Society

RESOURCES