Human Herpesvirus 6B Genome Sequence: Coding Content and Comparison with Human Herpesvirus 6A

Abstract

Human herpesvirus 6 variants A and B (HHV-6A and HHV-6B) are closely related viruses that can be readily distinguished by comparison of restriction endonuclease profiles and nucleotide sequences. The viruses are similar with respect to genomic and genetic organization, and their genomes cross-hybridize extensively, but they differ in biological and epidemiologic features. Differences include infectivity of T-cell lines, patterns of reactivity with monoclonal antibodies, and disease associations. Here we report the complete genome sequence of HHV-6B strain Z29 [HHV-6B(Z29)], describe its genetic content, and present an analysis of the relationships between HHV-6A and HHV-6B. As sequenced, the HHV-6B(Z29) genome is 162,114 bp long and is composed of a 144,528-bp unique segment (U) bracketed by 8,793-bp direct repeats (DR). The genomic sequence allows prediction of a total of 119 unique open reading frames (ORFs), 9 of which are present only in HHV-6B. Splicing is predicted in 11 genes, resulting in the 119 ORFs composing 97 unique genes. The overall nucleotide sequence identity between HHV-6A and HHV-6B is 90%. The most divergent regions are DR and the right end of U, spanning ORFs U86 to U100. These regions have 85 and 72% nucleotide sequence identity, respectively. The amino acid sequences of 13 of the 17 ORFs at the right end of U differ by more than 10%, with the notable exception of U94, the adeno-associated virus type 2 rep homolog, which differs by only 2.4%. This region also includes putative cis-acting sequences that are likely to be involved in transcriptional regulation of the major immediate-early locus. The catalog of variant-specific genetic differences resulting from our comparison of the genome sequences adds support to previous data indicating that HHV-6A and HHV-6B are distinct herpesvirus species.

Sequence-based information is an essential precursor to many molecular, biological, and epidemiologic studies. In addition, sequences are important for confirming or clarifying biological and taxonomic classifications, as illustrated for herpesviruses by experiences with Marek’s disease virus, channel catfish virus, and human herpesvirus 6 (HHV-6) (4, 9, 19). While the wealth of information obtained from smaller DNA segments is useful, genetic descriptions of viruses revealed through the determination and analysis of complete genome sequences are uniquely valuable. Thus, the analysis of 17 complete herpesvirus genome sequences has provided detailed information about their coding capacity and genetic architecture, revealing various permutations of conserved gene blocks and clusters of unique genes. This information yielded numerous insights into evolutionary paths within the herpesvirus family.

HHV-6 variants A and B (HHV-6A and HHV-6B) are classified as members of the Betaherpesvirinae subfamily, in the Roseolovirus genus along with human herpesvirus 7 (HHV-7) (47). These viruses share extensive domains of similar genetic organization with other betaherpesviruses, such as human cytomegalovirus (HCMV) (14, 19, 30, 40, 41, 48). The complete genome sequence for HHV-6A strain U1102 [HHV-6A(U1102)] was described by Gompels et al. (19).

HHV-6 was first described by Salahuddin and coworkers as a novel human herpesvirus isolated from the blood of patients with AIDS and other lymphoproliferative diseases (49). Reports describing the isolation of similar viruses soon followed (reviewed in reference 3), including from patients during the acute phase of the common childhood illness roseola or exanthem subitum (60). Characteristics shared by all of these viruses include infection of activated primary CD4⁺ T cells (33, 34, 54, 55), cross-reactive antigens (6, 43), and similar genomic organizations (30, 32, 36). As the cellular and molecular biologic properties of these viruses were investigated, it became evident that they segregate into two groups that differ with respect to several genetic and biological properties. To recognize the differences between these viruses, a system was established that classified them as either variant A or B. Classification was based on differences in nucleotide sequences, reactivity with panels of monoclonal antibodies, and cell tropism (1). The question of whether the HHV-6 variants should be recognized as distinct viral species was deferred pending the accumulation of additional information.

Although the viruses are closely related, there is no genetic gradient between HHV-6A and HHV6B, and recombinant viruses have never been detected. This situation is in contrast to that seen with the Epstein-Barr virus types, for which concentration of variant-specific changes in a small number of loci does not preclude intervariant recombination (25, 50). To understand the differences that may play a role in segregating the HHV-6 variants into discrete viral species, their genome sequences must be compared. In previous comparisons between subsets of HHV-6A and HHV-6B amino acid sequences, differences ranged from 1 to 5% in the set of genes shared by all herpesviruses (herpesvirus core genes), 19% in the gene encoding a strongly immunoreactive virion protein (U11), and 25% in the IE1 (U89) gene (8, 17, 29, 43, 59). In this report we present the genome sequence of HHV-6B strain Z29 [(HHV-6B(Z29)]. We describe its general organization, protein-coding potential, and relationship with the HHV-6A sequence.

MATERIALS AND METHODS

Sequencing strategy.

A previously described library of clones containing HHV-6B(Z29) restriction endonuclease fragments was used to determine the genome sequence (30). Several regions that were uncloned or cloned as part of a larger insert were amplified by using primers derived from terminal nucleotide sequences of bordering clones or the HHV-6A(U1102) genome sequence (19) (Table 1). The junctions between adjacent genomic restriction endonuclease fragments were confirmed by sequencing junction-spanning PCR amplicons.

TABLE 1.

Oligonucleotides used for amplification of HHV-6B genome segments

Name	Type	Primer coordinatesa	Sequence	Annealing temp (°C)	Size of amplimer (kb)
TL	cPCRc	P1, 3–28	5′TCGCGTTTCAAAAATTACTTTAAAC	60	1.5
		P2, 1456–1480	5′TGCGTACACGGCCACCCGCGTCTCC
DRL/U	PCRd	P1, 4941–4965	5′GTAAGAGAGAGGCCCCGGTCCACAT	68	5.2
		P2, 10140–10162	5′ATGAGTGGAGTTGACGACGCCCTG
U-1	cPCR	P1, 22633–22653	5′GAGATGGACACTGTCATTGAG	55	6.8
		P2, 29458–29475	5′GTGGTCGGCGGATTAAAT
U-2	cPCR	P1, 34599–34618	5′CCGCTTCTCCAATTTCTGTA	55	1.5
		P2, 36092–36111	5′TGCCTCAATTGCGTCTAAAA
U-3	PCR	P1, 35928–35923	5′CACGGCTAGCGTAGAGGTCACCATAG	60	11.5
		P2, 47479–47504	5′TGTAAATCAAGAGGATGTCCAGATTG
U-4	PCR	P1, 52486–52510	5′TTTGTATCTGTAACATTCGACACAC	60	6.2
		P2, 58698–58722	5′CTCGCTCTCAAAACAACATGTAACT
U-5	PCR	P1, 58624–58641	5′AAGACAGGTTACAGAAGC	50	5.5
		P2, 64143–64160	5′AGGAAGATGAGGTTCAAC
U-6	cPCR	P1, 125916–125934	5′CATGTTGAATCATAGGTCGb	50	1.6
		P2, 127510–127530	5′ATGATAATTTACGCCGCTACGb
U-7	PCR	P1, 127413–127433	5′CACCGTCGATGATTGAACACAb	48	2.3
		P2, 129765–129785	5′ACAGGAAACCTAACTGCAATTb
U-8	PCR	P1, 129765–129785	5′AATTGCAGTTAGGTTTCCTGTb	48	2.0
		P2, 131811–131829	5′GATCCCATATCTTCTCAAGb
U-9	cPCR	P1, 131811–131829	5′CTTGAGAAGATATGGCATCb	50	1.5
		P2, 133342–133359	5′TCAGCAATTTCAACTCCAb

^aCoordinates refer to the HHV-6B genome sequence. TL primer sequences are also located at coordinates 153325 to 153349 and 154577 to 154801. 

^bBased on HHV-6A genome sequence (19). Differences between HHV-6A and HHV-6B are in boldface. 

^ccPCR denotes that the PCR product was cloned into a pCR-Blunt vector by using a Zero Blunt PCR cloning kit (Invitrogen, San Diego, Calif.). 

^dPCR conditions differ from those described in Materials and Methods as follows: 94°C for 15 s and 68°C for 9 min (16 cycles); 94°C for 15 s and 68°C for 9 min, with an increase of 20 s every cycle (12 cycles); and 72°C for 10 min (2 cycles). 

PCR.

PCR was performed with a proofreading enzyme (Taq Precision Plus; Stratagene, La Jolla, Calif.) on HHV-6B(Z29) nucleocapsid DNA prepared as previously described (32). In most cases, cycles (30) consisted of denaturation (94°C for 45 s), annealing (60 s), and extension (72°C) of 1 min per kb. Primer sequences, genomic coordinates, annealing temperatures, and amplimer sizes are listed in Table 1. PCR amplimers were affinity purified by using standard methods (Qiagen, Santa Clarita, Calif.) prior to direct sequencing. A subset of PCR amplimers was cloned into a pCR-Blunt vector (Invitrogen, San Diego, Calif.) prior to sequencing.

Sequence determination.

Nucleotide sequences were determined with a fourfold or greater redundancy using commercially available primers or by primer walking using custom primers. Double-stranded coverage was not possible in two regions of the direct repeat (DR) because of the presence of repeats or homopolymeric stretches. These regions include a 454-bp segment within the unique region of DR (DR_L coordinates 5734 to 6188) and a 694-bp region extending across the (TAACCC)₇₈ repeat array at the right end of DR to the junction of the right end of DR with the left end of the unique segment (U). These regions were sequenced multiple times from different templates, including other PCR amplimers and a lambda phage clone (λH6Z-851) (30) with various primers. In addition, double-stranded information was not obtained for two small regions (totaling 118 bases) at the boundaries of the internal repeat R1 (Fig. 1A).

FIG. 1.

(A) HHV-6B genomic and genetic architecture. The upper portion shows the positions and arrangements of the major repeat elements R0, R1, R2A, R2B, and R3, the origin of replication (oriLyt), and the structure of the DR termini. ORF sizes, orientation, and location are indicated. HHV-6B unique ORFs are labeled B1 through B9. The orientation and order of the seven conserved herpesvirus core gene blocks are indicated, as is the block (U2 to U19) found only in betaherpesviruses. 101K, antigenic virion protein 101K; PA, polymerase processivity factor; RR, large ribonucleotide reductase; Teg, large tegument protein; Pol, DNA polymerase; gB, glycoprotein B; MDBP, major DNA binding protein; HP, helicase/primase complex; gH, glycoprotein H; MCP, major capsid protein; Exo, alkaline exonuclease; OBP, origin binding protein; IE1, major immediate-early gene; Rep, parvovirus rep homolog. (B) Nucleotide sequence comparison between HHV-6A and HHV-6B genomes. Genomes were aligned in segments by using GAP with gap and length weights of 50 and 3, respectively, except for the region spanning residues 124000 through 144500 (dashed line), for which weights of 25 and 1, respectively, were used to maximize the alignment. After concatenation of the aligned segments, identities between the aligned sequences were plotted by using PLOTSIMILARITY with a window of 1,000 residues. The horizontal dashed line represents mean identity of 88% across the whole alignment. Several regions with scores less than the mean are labeled; variable intergenic regions are identified by their flanking genes, e.g., U10/U11; the region spanning R2A and R2B is indicated as R2A-R2B. Nucleotide identity (NI) for the indicated regions was determined using GAP for aligned degapped sequences, with gap and length weights of 50 and 3, respectively, except for the segment spanning the right end of U, where weights 250 and 25, respectively, were used in order to omit gaps.

R3 determination.

Repeat R3 is contained within HindIII fragment C, cloned as pH6Z-204 (30). Two complementary sets of nested deletion clones with termini spaced at approximately 200-bp intervals were generated from subclones of pH6Z-204 with exonuclease III (Erase-a-Base; Promega, Wis.). These subclones were then used to sequence both strands of the repeat.

Sequence analysis.

Sequences were assembled and analyzed by using the Wisconsin Package, version 9.0 (Genetics Computer Group, Madison, Wis.). Database searches were done with nonredundant versions of GenBank posted on February 9, 10, and 15, 1999.

Nucleotide sequence accession number.

The sequence reported has been deposited with GenBank under accession no. AF157706.

RESULTS

The HHV-6B genetic content described below is presented in the context of elegant descriptions of HHV-6A and HHV-7 genetic architecture by others (19, 37, 41). Thus, we will not describe coding content in detail but will expand on issues that are unique to HHV-6B. The focus will be on a comparative description between the HHV-6B and HHV-6A genomes. In any such analysis of herpesvirus genomes, it must be remembered that the reported sequences represent a snapshot of a single example from the heterogeneous population of molecules that might be present in an individual or that might have varied on passage in cell culture. Such variation is frequently seen in regions containing repetitive elements (e.g., the het region in DR) (32) but is not necessarily limited to these regions (5).

Sequence assembly.

Over 98% of the sequence was determined on both strands, with an average of fourfold redundancy; the exceptions were three highly repetitive regions described in Materials and Methods. A representative complete genome sequence was compiled by assembling a representative DR element and grafting it to the termini of U. The junctions of U with DR_L and DR_R were confirmed independently. The DR sequence was assembled by using the following sequences, from left to right: a 1.5-kb cloned PCR amplimer mapping to the 5′ end of DR (TL in Table 1), a 3.8-kb BamHI genomic clone (pH6Z-109, BamHI fragment L) (30), a 5.2-kb PCR amplimer that extends from BamHI L across the DR_L-U junction (DRL/U in Table 1), plus clones that span the junctions of DR-DR (from circular or concatemeric genomes) and U-DR_R. We previously described three segments that are included in the complete genome sequence (29, 31, 43). One 20-kb segment spans U40 to U57 (GenBank accession no. L16947) and includes the origin of lytic replication (oriLyt). Another 20-kb segment spans U69 to U84 (GenBank accession no. L14772) and includes the homolog of the herpes simplex virus type 1 UL9 origin binding protein. The third is a smaller 3.2-kb segment encoding the antigenic virion protein 101K, which is the product of the U11 gene (GenBank accession no. L13162).

Global features.

The HHV-6B(Z29) genome sequence as assembled is 162,114 bp long. This is in close agreement with values of 159 to 164 kb determined by summation of restriction endonuclease fragment lengths (30, 32). The genome is composed of a 144,528-bp U flanked by 8,793-bp DR segments, DR_L and DR_R (Fig. 1A).

G+C contents are 40.8 and 59.1% in U and DR, respectively, with an overall G+C content of 42.8%. Nearly identical uneven base distributions between U and DR are also observed in HHV-6A and HHV-7 (19, 37, 41). Similar distributions of low and high G+C content have been described between U segments and long repeats that are present at either genomic termini or termini of long invertible segments of other herpesviruses (2, 7). As previously described, a region with unusually low G+C content (32.2%) is the 1,367-bp region between U41 and U42 that contains the HHV-6B oriLyt (12).

A shared characteristic of betaherpesviruses is CpG suppression with a concomitant increase in TpG in the major immediate-early (IE-A) locus; this feature is in contrast to the global CpG suppression in most gammaherpesvirus genomes and the lack of apparent CpG suppression in alphaherpesviruses (19, 21). Like HHV-6A, HHV-6B is CpG deficient, with a corresponding increase in TpG frequency in the IE-A locus (coordinates 127342 to 139167). CpG deficits in the IE regions of betaherpesviruses have been hypothesized to reflect localized methylation by the host cell during latency (19, 21).

DR structure and genomic termini.

HHV-6B, HHV-6A, and HHV-7 have similarly organized DR segments, which are composed of terminal, unique, and junctional regions. The coding content of the unique region of DR is described in the section on gene content. The assembled HHV-6B DR is 8% longer than that described for HHV-6A as a result of small insertions in the unique region and differences in the copy number of repeats found near the termini (Table 2). The terminal repeats are composed of perfect and imperfect copies of the hexanucleotide TAACCC (telomeric repeat sequence [TRS]). This sequence is also present in repeat arrays at the termini of vertebrate chromosomes (38), near the termini of HHV-6A and HHV-7 (14, 18, 19, 52), and at the junction region between the internal inverted repeats IR_S and IR_L of Marek’s disease virus (26). Additionally, scattered single copies of TRS are also present in U, distributed with a polarity similar to that of HHV-6A, in which TAACCC is found to the left of oriLyt and the complementary sequence, GGGTTA, to the right of oriLyt (18, 19). This arrangement confers an overall dyad symmetry to the genome, radiating from oriLyt.

TABLE 2.

Coordinates and copy number of repeat arrays in the HHV-6A and HHV-6B genomes^a

Name	Coordinates		No. of repeat arrays
	HHV-6A	HHV-6B	HHV-6A	HHV-6B
DRL
htTRS	56–307	59–353	42	50
TRS	7655–8008	8250–8711	59	78
DRR
htTRS	151290–151541	153380–153674	42	50
TRS	158889–159242	161571–162032	59	78
R0	Not present	9315–9510		13
R1	127497–128181	129046–129681	51	54
R2A	130797–130950	133501–133863	2	5
R2B	131022–132254	133982–134076	1,233 ntb	8
R3	137994–140897	140082–142691	28	26

^aHHV-6B(Z29) sequences are: htTRS, TARSYC; TRS, TAACCC; RO, YACACACAAAAAAA; R1, RGCYCTGCTGGA; R2A, ATTATATGATA(N)_6-7GTTT(N)₃GTAGACTAGTT(N)₃TTATGTTT; and R2B, TTTGTGTGTGTG. For R3 see Fig. 3. Symbols as in the legend to Fig. 3. 

^bHHV-6A R2 is composed of TpG dinucleotide repeats spanning 1,233 nt. 

Sequences near the termini of the HHV-6B DR were described previously (57). We confirmed and extended these results by sequencing across the TRS arrays into the adjacent unique DR sequences, by sequencing additional clones that span the junction between the termini of circularized or concatemerized genomes, and by sequencing across the junction between the right end of DR and the left end of U. In summary, DR termini are composed of copies of TRS that are flanked on their left by pac1 at the left terminus and on their right by pac2 at the right terminus (Fig. 2A); pac1 and pac2 are conserved cis-acting herpesvirus packaging signals. At the left terminus of DR, a pac1 cleavage sequence is located 18 nucleotides (nt) from the predicted genomic terminus; adjacent to it are multiple copies of TRS interspersed with the related hexamers TAGGTC and TAGCCC. The right terminus of DR consists of 78 perfectly reiterated copies of TRS, followed by a pac2 signal located 29 nt from the predicted genomic terminus (Fig. 2B and C).

FIG. 2.

(A) DR_L and DR_R in linear and concatemeric genomes. The locations of terminal sequences from this and other works are indicated relative to the pac1-het(TAACCC)_n and (TAACCC)_n-pac2 elements at the left and right termini of DR, respectively. The dashed lines inside DR indicate the relative lengths of the TRS arrays. The black bars below the DRs represent the relative location of the sequences aligned in panel B; sequence designations are as shown below the lines. Sources for the sequences are as follows: B2L_DR and B2R_DR are from this work and were generated from amplimers TL and DRL/U, respectively (Table 1); P3, P10, P15, P4, P9, P1, P7 are DR_L-DR_R junction-spanning clones derived by PCR using 5′gcggatccTAACCCATCCCCCAACGCGC as the rightward primer (RP) and 5′cggaattcTTAGGGTTAATACCCCCCTTT as the leftward primer (LP) (the BamHI and EcoRI sites used in cloning are in lowercase) on template from HHV- 6B(Z29)-infected Molt-3 cells. The locations of primers RP and LP are indicated in panel B; A1L_DR, A1R_DR, and A1 (GenBank accession no. X79798, X79799, and X79800, respectively) are from Gompels and Macaulay (18); B1L_DR, B1R_DR, B1, and B2 (GenBank accession numbers L22337, L23336, and L22335, respectively) are from Thomson et al. (57). (B) Alignment of terminal sequences. Sequences were aligned by using PILEUP with gap creation and extension penalties of 5 and 1, respectively. Sequences A1, A1R_DR, and A1L_DR are from HHV-6A(U1102); the rest are from HHV-6B(Z29). Differences between the variants are shown in lowercase, and differences between HHV-6B sequences are underlined. Nucleotides found only in DR_R-DR_L junction-spanning clones are italicized. Putative terminal nucleotides are in bold. (C) Summary diagram of the DR termini. Designations are as for panel A; N indicates any nucleotide.

There were copy number differences in the heterogeneous TRS arrays between the sequence described here and the previously reported left terminal sequence of HHV-6B(Z29) obtained independently by Thomson et al. (57). This copy number variability was also present in different clones obtained from the same PCR amplification (15). Additionally, in electrophoretic analyses, the left terminal BamHI and SalI restriction endonuclease fragments were determined to be 2.7 and 2.0 kb long, respectively (30, 32), compared with 1,389 and 656 bp, respectively, predicted from the sequence. This difference suggests that smaller segments were selectively amplified by PCR from the pool of heterogeneous versions of the region. These results are consistent with the observations of Lindquester and Pellett (32), who found that the length of DR changed from 13 to 10 kb on viral passage in cell culture. The length heterogeneity mapped to the left end of the DR elements. On the basis of the restriction mapping and sequence data described above, it is likely that the variable regions correspond to the heterogeneous TRS arrays. Sequence analysis of uncultured virus will be required to more completely understand the structure of this region in wild-type virus.

The precise genomic termini of HHV-6B have not been directly determined but can be inferred from the sequences of fragments from at or near the genomic termini and that span DR-U boundaries, in the context of motifs conserved at the termini of other herpesvirus genomes. An alignment of our sequences with all previously published HHV-6A and HHV-6B sequences from the terminal region is shown in Fig. 2B. As can be seen in the alignment, terminal and DR_R-DR_L junction sequences are highly conserved between linear and concatemeric or circular genomes. Additionally, HHV-6B and HHV-6A sequences are highly conserved in this region. Interestingly, of the seven DR_R-DR_L junction clones that we analyzed, all except P4 had one to eight additional nucleotides at the junction. The mechanism for inserting these nucleotides is not obvious, although the variability is unlikely to be an artifact since it was observed in independently derived clones from different viral stocks and HHV-6A. Similar heterogeneity was also observed in clones derived from plasmid concatemers that had been packaged into extracellular virions or intracellular nucleocapsids (11).

Internal repeats.

In addition to the TRS arrays, five major repeat elements are located in U: R0, R1, R2A, R2B, and R3 (Fig. 1A). Copy number and coordinates for these arrays in both HHV-6A and HHV-6B genomes are given in Table 2. These repeat elements are located in regions of the HHV-6B genome that have lower nucleotide sequence identity with HHV-6A (Fig. 1B). R0 is unique to HHV-6B and is located near the junction of DR_L and U and is contained within the putative HHV-6B open reading frame (ORF) B4. R1 is located near the 3′ end of the U86 ORF. Translation of R1 results in a series of serine and arginine (SR) repeats at the carboxy terminus of the U86 protein, the HCMV IE2 (UL122) homolog (19, 42). HHV-6B R1 has greater sequence variation than does HHV-6A R1; the HHV-6B repeat array is assembled from 10 different units, while HHV-6A R1 is assembled from 3 different units. The SR repeats are unique to the HHV-6 version of the protein and reflect divergence from other betaherpesviruses (19).

R2A and R2B are located in the region between U86 and U90 (coordinates 131902 to 138003). This region has only 57.5% nucleotide identity between HHV-6A and HHV-6B. R2A is not unique to HHV-6B; two, rather than five, copies are present in HHV-6A, and they are more divergent than in HHV-6B. R2B is related to HHV-6A R2 but is much shorter. R2B is 94 nt long, compared with the 1.2-kb R2. R2A contains several TATA-like sequences, while R2B has multiple potential binding sites for the transcription factor HNF-5 (TRTTTGY) (16), suggesting a possible role for these sequences in transcription regulation. A point of interest is that a plasmid clone (pH6Z-231) (30) was used as the sequencing template for the region encompassing R2A and R2B; the corresponding region in HHV-6A was refractory to cloning and was sequenced from a PCR-derived template. However, no large deletion is present in pH6Z-231 since the sequenced plasmid had a length similar to the predicted length of the corresponding HHV-6B restriction endonuclease fragment. In addition, R2A and R2B are present in HHV-6B(HST) (27).

R3 is located upstream of the IE-A locus that spans U86 to U91 and is hypothesized to contain cis-acting regulatory sequences that might play a role in transcription regulation of this locus. HHV-6B R3 is composed of 26 copies of 103-, 104-, or 105-bp imperfect repeat units. Individual units from HHV-6B vary considerably in sequence. An alignment of R3 consensus sequences for HHV-6B strains Z29 and HST (27) and HHV-6A (19) is shown in Fig. 3. Sequence variation is scattered throughout individual units of HHV-6B R3, with conserved pockets at positions 32 to 52 and 94 to 96 of the consensus sequence. One of the conserved pockets in all of the individual units of both variants is a potential binding site for the transcription factor PEA3 (AGGAA[A/G]). The PEA3 motif has been found in other viral genomes, including the polyomavirus enhancer and the adenovirus enhancer core element (20, 35). The presence of multiple PEA3 binding sites in R3 is intriguing, as they may represent primary targets of signal transduction in HHV-6A and HHV-6B. Other potential transcription factor binding sites identified in HHV-6A R3 include NF-κB and AP2 (58). In contrast, HHV-6B(Z29) R3 has no NF-κB sites and AP2 sites (CCC[A/C]NG/C[G/C][G/C]) in 11 of the 26 repeat units.

FIG. 3.

Alignment of HHV-6B and HHV-6A consensus R3 sequences. Individual R3 units of HHV-6A (28 copies) (19) and HHV-6B strains HST (24 copies) (27) and Z29 (26 copies) were aligned. Alignments were done by using PILEUP with gap creation and extension penalties of 5 and 1, respectively. Each consensus sequence represents 80% plurality between the aligned units of each virus. Sequences common to all three viruses are in uppercase. Conserved pockets are underlined, and the binding site for the transcription factor PEA3 is in bold. Symbols: Y, C or T; R, A or G; S, C or G; W, A or T; M, A or C; K, G or T; H, A or C or T; V, A or C or G.

HHV-6B gene content.

HHV-6B protein-encoding ORFs were first considered as significant if the translated proteins had sequence counterparts in HHV-6A. Proteins with similarity to HHV-6B-encoded proteins were identified by searching GenBank with the BLAST family of programs. Also, ATG-initiated ORFs as small as 177 nt (59 amino acids) that had no significant overlap with other ORFs and appropriately located polyadenylation signals were also considered as possibly significant. Using these criteria, we identified 127 ORFs; 8 are diploid because they are present in each copy of DR, leaving 119 that are unique (Table 3). These 119 unique ORFs compose 97 genes, based on the predicted splicing patterns for 11 genes. Of the 119 ORFs analyzed, 110 (92%) had their highest similarity score with the set of HHV-6A ORFs initially described by Gompels et al. (19) and modified by Megaw et al. (37). The remaining nine do not have HHV-6A counterparts and are unique to HHV-6B. With the exception of the acceptor site of U91EX2, exon boundaries were in agreement with previously published acceptor and donor splice sites for HHV-6A (37). The nomenclature used is based on that previously employed for HHV-6A and HHV-7 (19, 37, 41). ORFs with HHV-6A counterparts were given the same name; ORFs unique to HHV-6B are designated B1 through B9. Spliced genes are identified by the 5′-proximal exon as was done for HHV-7 (RK) (37). The deduced protein-coding capacity of the HHV-6B genome is listed in Table 3, and the arrangement of the ORFs is shown in Fig. 1A.

TABLE 3.

Locations of HHV-6B ORFs and relative similarities of HHV-6B genes with their HHV-6A and HHV-7 homologs

ORFa	S	Startb	Endc	% DNA identity with HHV-6A homologd	Codons	%S/%/I with HHV-6A homologe	Substitutionsf		%S/%I with HHV-7 homologg	Implied functionh
							Ka	Ks
DR1EX1		583	841	88.4	86	90.7/87.2	0.092	0.146	50.9/47.6	HCMV US22 gene family
DR1EX2		955	2972	90.0	672	84.0/82.4			50.7/45.4
DR3	Ci	3325	2726	90.8	200	87.0/86.4	0.072	0.174
B1		3022	3498		159
B2		3536	3772		79
DR6EX1		5027	5330	89.1	101	86.1/84.1	0.112	0.223	55.4/53.5	HCMV US22 gene family, transactivator
DR6EX2		6329	7200	88.8	290	84.3/82.2			69.1/62.6
B3		7349	7525		59
B4	C	9492	8914		193					Membrane protein?
B5		9522	9758		79
U2	C	10715	9627	92.4	363	92.1/91.5	0.048	0.199	54.7/47.8	HCMV US22 gene family
U3	C	12205	11048	92.4	386	89.8/89.3	0.064	0.211	56.1/46.8	HCMV US22 gene family, transactivator
U4	C	14040	12436	96.9	535	98.9/98.7	0.006	0.101	68.8/58.9
U7EX1	C	16959	15890	94.9	356	98.4/97.5	0.020	0.141	74.7/61.6	HCMV US22 gene family
U7EX2	C	15800	14162	94.7	546	95.2/94.5	0.026	0.150	61.0/51.1
U6		15603	15806	95.1	68	97.1/97.1	0.017	0.113
U8	C	18198	16966	95.0	411	96.4/95.5	0.023	0.130	62.1/50.8	HCMV US22 gene family
U9	C	18493	18182	95.5	104	94.2/94.2	0.026	0.083
U10		18543	20051	92.9	503	96.6/94.0	0.033	0.194	61.9/49.4
U11	C	22534	19961	89.2	858	85.6/81.2	0.110	0.134	40.9/29.8	Antigenic virion protein 101K
U12EX1		22636	22668	97.0	11	100/100	0.040	0.135	72.7/54.5	G-protein-coupled receptor
U12EX2		22746	23327	93.4	194	93.8/92.2			60.6/46.6
U13		23856	24176	96.2	107	93.4/92.5	0.037	0.061	44.9/35.7
U14		24277	26106	90.5	610	89.3/85.7	0.082	0.150	56.7/49.9
U15EX1	C	27048	26731	94.0	106	91.4/86.7	0.047	0.088	76.4/67.9	HCMV UL25/UL35 gene family
U15EX2	C	26752	26500	94.5	24	100/95.8			83.3/75.0
U15EX3	C	26328	26146	95.1	61	96.7/91.7			82.0/75.4
U17EX1	C	28421	28193	95.2	76	94.7/94.7	0.026	0.133	54.9/43.7	HCMV US22 gene family, IE-B
U17EX2	C	28105	27333	94.6	257	96.1/94.9			66.7/56.5
U18	C	30485	29604	93.7	294	90.8/88.7	0.055	0.070	57.5/47.0	IE-B
U19	C	31920	30754	94.2	389	92.0/91.5	0.043	0.098	41.5/35.1	IE-B
U20	C	33449	32148	94.2	434	95.6/95.6	0.045	0.121	31.8/22.2
U21	C	34954	33455	93.2	500	91.0/89.8	0.050	0.121	42.8/31.6
U22	C	35459	34854	95.4	202	91.2/89.6	0.028	0.097
U23	C	36386	35490	92.6	299	94.6/94.1	0.063	0.116	26.9/20.9
U24	C	36777	36514	92.7	88	88.3/82.7	0.080	0.054	46.2/31.2
U24A	C	36969	36799	93.5	57	94.7/91.2	0.042	0.133	40.3/28.1
U25	C	37936	36989	97.4	316	99.4/98.1	0.009	0.075	45.0/31.2	HCMV US22 gene family
U26	C	38931	38047	95.1	295	93.8/92.9	0.033	0.092	60.5/47.4
U27	C	40019	38922	95.5	366	97.3/95.6	0.021	0.112	45.7/31.1	Polymerase processivity factor
U28	C	42549	40138	95.8	804	97.1/95.9	0.019	0.106	57.7/46.6	Large ribonucleotide reductase
U29	C	43471	42575	96.0	299	97.6/96.1	0.020	0.103	66.3/51.9	Capsid assembly and DNA maturation
U30		42999	46244	94.8	1082	95.2/93.2	0.033	0.106	58.4/46.3
U31		46265	52495	94.8	2077	95.3/93.4	0.032	0.107	57.4/46.5	Large tegument protein
U32	C	52841	52575	95.8	89	96.6/96.6	0.017	0.120	71.9/65.2
U33	C	54255	52846	97.1	470	98.3/98.1	0.009	0.082	70.6/59.4
U34	C	55036	54209	95.2	276	95.3/94.2	0.028	0.097	65.1/57.0
U35	C	55373	55056	97.8	106	98.1/98.1	0.009	0.046	68.9/59.2
U36		55372	56823	96.7	484	97.9/97.5	0.012	0.087	68.9/58.1
U37		56830	57621	97.0	264	98.1/97.0	0.014	0.074	71.8/61.8
U38	C	60708	57673	96.2	1012	98.7/97.9	0.010	0.118	75.9/67.0	DNA polymerase
U39	C	63200	60711	96.4	830	97.0/96.1	0.019	0.109	65.8/56.7	Glycoprotein B
U40	C	65334	63157	96.9	726	99.2/98.8	0.008	0.093	67.8/55.9	Transport/capsid assembly
U41	C	68740	65345	97.3	1132	99.3/98.8	0.006	0.070	78.7/68.5	Major DNA binding protein
U42	C	71653	70106	95.5	516	96.1/95.5	0.024	0.105	66.6/56.0	Transactivator
U43	C	74460	71881	97.3	860	98.8/97.7	0.010	0.068	70.9/61.0	Helicase/primase complex
U44		74501	75193	95.9	231	98.1/96.7	0.014	0.121	70.4/58.6
U45	C	76273	75146	95.8	376	95.5/94.4	0.032	0.074	59.2/50.5
U46		76346	76597	95.2	84	94.1/94.1	0.033	0.086	61.9/51.2
U47	C	78999	76786	93.4	738	89.5/87.2	0.065	0.080	31.8/23.9	Glycoprotein 0
U48	C	81349	79268	95.3	694	95.8/94.2	0.028	0.103	52.2/39.0	Glycoprotein H
U49		81508	82263	96.9	252	97.6/97.2	0.015	0.059	60.7/52.7
U50		82043	83707	96.3	555	98.9/97.3	0.015	0.090	65.4/54.7	Virion protein
U51		83808	84710	94.9	301	95.7/94.0	0.031	0.096	48.6/36.1	G-protein-coupled receptor
U52	C	85508	84735	96.6	258	98.1/97.3	0.012	0.081	68.1/56.3
U53		85515	87098	96.2	528	97.4/96.8	0.017	0.098	59.6/51.1	Proteinase
U54	C	88715	87339	88.6	459	84.5/79.7	0.120	0.118	55.3/44.5	Virion transactivator
U55	C	90271	88796	95.1	492	94.9/93.6	0.032	0.108	(A)44.2/32.4
									(B)33.9/21.2
U56	C	91162	90275	98.1	296	99.0/98.0	0.010	0.052	74.7/65/2	Capsid protein
U57	C	95201	91167	96.6	1345	98.1/97.8	0.011	0.087	77.9/68.6	Major capsid protein
U58		95213	97528	95.8	772	97.5/96.9	0.015	0.109	69.8/61.4
U59		97528	98577	95.7	350	96.0/95.1	0.022	0.100	50.9/39.9
U62		99716	99976	98.0	87	96.5/96.5	0.019	0.062	65.8/52.1
U63		99921	100574	97.5	218	99.1/99.1	0.004	0.090	73.9/67.3
U64		100555	101880	95.5	442	94.1/93.7	0.031	0.093	52.6/40.0
U65		101840	102844	92.8	335	89.0/85.7	0.073	0.074	69.1/60.0
U66EX1	C	103784	102912	97.5	291	99.0/99.0	0.002	0.080	72.1/63.8	Putative terminase
U66EX2	C	99704	98580	97.9	375	100/100			86.3/78.3
U67		103756	104814	96.7	353	97.5/96.6	0.016	0.073	63.7/53.2
U68		104817	105158	95.9	114	96.5/94.7	0.026	0.120	62.3/49.1
U69		105164	106852	94.8	563	96.4/94.7	0.027	0.114	63.6/53.7	Phosphotransferase; ganciclovir kinase
U70		106863	108326	95.9	488	97.1/96.1	0.020	0.100	64.6/51.8	Alkaline exonuclease
U71		108266	108508	92.6	81	90.9/89.6	0.060	0.136	56.2/52.1	Myristylated virion protein
U72	C	109627	108596	96.6	344	98.3/97.1	0.013	0.082	72.4/58.7	Glycoprotein M
U73		109640	111979	97.3	780	98.6/97.6	0.014	0.067	67.3/57.9	Origin binding protein
U74		111951	113936	96.1	662	97.6/96.2	0.019	0.088	54.6/41.3	Helicase/primase complex
U75	C	114723	113977	96.1	249	97.2/96.0	0.021	0.103	55.8/45.8
U76	C	116620	114635	97.1	661	98.9/98.6	0.007	0.096	70.4/58.9
U77		116415	118886	97.3	824	99.3/98.9	0.005	0.083	82.7/75.5	Helicase/primase complex
B6		119139	119375		79
B7		120836	121060		75
U79EX1		121486	122116	87.5	210	84.8/76.7	0.094	0.103	69.3/52.7	Role in DNA replication
U79EX2		122213	122412	92.4	66	89.2/84.6			57.1/47.6
U79EX3		122495	123103	93.8	203	88.9/86.9			45.4/37.9
U81	C	123917	123153	95.2	255	95.7/94.5	0.030	0.109	69.2/58.9	Uracil-DNA glycosylase
U82	C	124745	123996	95.5	250	95.2/94.0	0.029	0.077	49.6/37.4	Glycoprotein L
U83		124821	125159	92.4	113	87.6/85.6	0.071	0.098		Intercrine cytokine
U84	C	126296	125271	94.2	342	92.4/90.6	0.048	0.081	51.7/42.4
U85	C	127202	126327	94.7	291	93.1/91.7	0.044	0.083	46.9/36.8	OX-2 homology, glycoprotein
U86	C	131901	127342	85.9	1520	79.2/74.5	0.151	0.198	35.3/29.5	IE-A
U90EX1	C	138436	138342	81.3	75	73.7/68.4	0.171	0.127	42.8/35.7	IE-A (IE1), transactivator
U90EX2	C	138254	138043	80.9	70	70.3/67.2			67.1/57.1
U90EX3	C	137932	135006	85.8	975	76.7/71.5			32.9/25.2
U91EX1		138591	138816	76.3	75	67.8/57.1	0.301	0.246	33.3/25.0	IE-A
U91EX2		138926	139167	82.0	80	69.2/67.9			45.6/40.0
B8	C	142766	141972		265
U94	C	144565	143096	96.5	490	98.4/97.6	0.011	0.089		Parvovirus rep homolog
U95		144640	148275	84.0	1212	72.9/69.0	0.188	0.150	33.4/26.7	HCMV US22 gene family
U100EX1	C	152325	151940	83.4	128	78.1/73.4	0.115	0.178	27.2/19.7	Spliced envelope glycoprotein
U100EX2	C	151807	151526	87.6	93	84.9/81.7			53.8/38.7
U100EX3	C	151121	150786	88.7	111	82.9/79.3			40.9/32.7
U100EX4	C	150664	150587	88.5	25	96.0/88.0			44.0/40.0
U100EX5	C	150476	150369	92.6	35	88.6/80.0			34.3/28.6
U100EX6	C	150272	150159	95.6	37	91.9/91.9			48.6/37.8
U100EX7	C	150008	149848	89.4	53	88.7/83.0			35.3/27.4
U100EX8	C	149341	149332	100.0	3	100/100
U100EX9	C	149169	149041	94.6	42	92.8/90.5			35.7/23.8
U100EX10	C	148911	148668	86.5	81	83.9/76.5			24.0/13.3
B9	C	153252	152935		106
DR1EX1		153904	154162	88.4	86	90.7/87.2	0.092	0.146	50.0/47.6	HCMV US22 gene family
DR1EX2		154276	156293	90.0	672	84.0/82.4			50.7/45.4
DR3	C	156646	156047	90.8	200	87.0/86.4
B1		156343	156819		159
B2		156857	157093		79
DR6EX1		158348	158651	89.1	101	86.1/84.1	0.112	0.223	55.4/53.5	HCMV US22 gene family
DR6EX2		159650	160521	88.8	290	84.3/82.2			69.1/62.6
B3		160670	160846		59

^aHHV-6B ORFs are named after their HHV-6A counterparts (19), except for spliced genes where the ORF is given the name of the 5′-proximal ORF. Based on the interpretation of the HHV-7 sequence by Megaw et al. (37), some of the ORFs described by Gompels et al. (19) are predicted to be exons: DR2 as DR1EX2; DR7 as DR6EX2; U5 as U7EX2; U16 as U17EX2; U60 as U66EX2; U80 as U79EX3; U89 as U90EX3; and U96, U97, U98, and U99 as U100EX10, EX7, EX3, and EX2, respectively. ORFs B1 to B9 are unique to HHV-6B. 

^bFirst N-terminal methionine or in spliced genes first nucleotide of predicted exon. 

^cLast nucleotide of the last codon of ORF or exon. 

^dDetermined by using GAP with gap and length weights of 50 and 3, respectively. 

^ePercent amino acid similarity (%S) and percent amino acid identity (%I) were determined by using GAP with gap and length weights of 12 and 4, respectively. 

^fNonsynonymous (Ka) and synonymous (Ks) substitutions between HHV-6B and HHV-6A coding regions were estimated by using DIVERGE. Ka and Ks values given for spliced genes were determined by using the spliced coding sequence and listed in the first exon. 

^gHHV-7 ORFs used in the alignments are from HHV-7(JI) as described by Nicholas (41) plus additional exons described by Megaw et al. (37). Prefixes (A) and (B) denote HHV-7 ORFs U55A and U55B, respectively. 

^hFunctions of analogous genes were inferred from previous analyses (8, 19, 22, 37, 41). 

ⁱORFs encoded on the complementary strand are indicated by C. 

Nine ORFs (DR4, DR5, DR8, U1, U61, U78, U88, U92, and U93) described by Gompels et al. (19) do not have counterparts in the HHV-6B genome, as a result of either the lack of an initiation codon, truncation, or frameshift mutations. HHV-6B encodes positional counterparts of HHV-6A ORFs LT1, LJ1, and RJ1, but these were excluded from consideration as candidates for being expressed as proteins because they are composed almost entirely of TRS arrays, the large variations in TRS copy number described above, and the lack of amino acid sequence conservation between the variants. Interestingly, DR3, U6, U9, U22, U83, and U94 are present in HHV-6A and HHV-6B but not in HHV-7 and thus are unique to the HHV-6 variants.

The nine putative unique HHV-6B ORFs, B1 through B9, are predicted to encode proteins of 265 amino acids or less (Table 3). B4 and B9 are located near the junctions of U and DR, a region of sequence divergence between the variants (see below). B4 spans R0, while B9 spans a region composed of four copies of an imperfect 62- or 63-bp element. None of the ORFs unique to HHV-6B had significant similarity with any other proteins in GenBank. Experimental data must be obtained to determine if any of the these ORFs encode functional proteins.

Relationships between HHV-6A and HHV-6B amino acid sequences.

Amino acid identity of HHV-6B proteins with their HHV-6A counterparts ranged from 99.5% in the spliced U66 gene to 61.8% for the spliced U91 gene (Table 3). U66 is a highly conserved herpesvirus protein involved in DNA packaging (46). U91 is located in the genomic region that is most divergent between the variants. The function of U91 is not known, but it is likely to be involved in gene regulation since it is part of the IE-A locus (51).

Several HHV-6B ORFs give rise to proteins longer than their HHV-6A counterparts as a result of differences near either their 5′ or 3′ ends. U8, U21, U23, U55, and U83 have 5′ extensions, while U10 and U44 have 3′ extensions. In addition, HHV-6B U47 has a 3′ extension and a 5′ truncation. These ORFs are dispersed in the genome, and none are homologs of conserved herpesvirus genes. In fact, U47 and U55 are located between conserved herpesvirus gene blocks (Fig. 1A). Interestingly, HHV-6B(Z29) U12, which encodes one of the G-protein-coupled receptor homologs, is truncated because of an in-frame termination codon at amino acid 195 of U12EX2. The termination codon lies within transmembrane region 5 of the seven predicted membrane-spanning domains and creates a protein that is 146 amino acids shorter than HHV-6A U12 (19). The HHV-6B(Z29) alteration is not likely to be a cloning or sequencing artifact or error because it was present in plasmid clones derived nearly a decade ago from purified viral DNA and in PCR amplimers derived directly from more recent viral DNA preparations. Nonetheless, the termination codon present in HHV-6B(Z29) is not present in two HHV-6B clinical isolates; translation of the ORF from these viruses should lead to a protein corresponding to the HHV-6A protein (15). Additionally, Isegawa et al. (24) reported that expression of HHV-6B(HST) U12 results in a full-length protein that functions as a β-chemokine receptor. These results indicate that expression of full-length U12 is not required for viral replication in cell culture.

Global variation between HHV-6A and HHV-6B.

The HHV-6A and HHV-6B genomic sequences were aligned in several pieces by using GAP, and the segments were then assembled into complete genomes containing alignment gaps. The resulting alignment was visualized with PLOTSIMILARITY (Fig. 1B). Most of the narrow valleys of low identity, e.g., in the vicinity of U41/U42 and U47, correspond to regions of multiple insertions in one variant relative to the other. The baseline identity level in these and other regions can be easily discerned. Some of the valleys are augmented by differences in copy number of a repeat element between the two genomes, e.g., TRS and R3.

As can be seen, there is high similarity across the middle of the alignment (positions 30000 through 128000), with regions of extensive dissimilarity toward the genomic ends. Highly variable regions are localized to the DR_L-U junction, the left end of U, the region spanning U86 to U100, and all of DR. The most variable region is the region between U86 and U90, where there is only 63.2% nucleotide identity between HHV-6B and HHV-6A. Interestingly, the right end of U, spanning ORFs U86 to U100, differs by more than 10%, with the exception of the region encoding U94 (the adeno-associated virus type 2 rep homolog), which has 96.5% nucleotide sequence identity between the variants. In addition, concatemers of HHV-6A and HHV-6B ORFs U75, U76, U77, U79, U81, U82, U83, U84, U85, U86, U90, U91, U94, U95, and U100 that had been aligned codon by codon to correspond to the amino acid sequence alignments used to determine Ks and Ka values (described below) were assembled, and the resulting alignment was visualized as for Fig. 1B. Similar results were observed; i.e., U86, U90, U91, U95, and U100 had the greatest amount of sequence variation (not shown). Three notable areas of low sequence identity located in the region spanning the herpesvirus core genes are the U41-U42 intergenic region (which includes oriLyt), U47, and U54. As noted by others, genes at the junction of conserved herpesvirus gene blocks, e.g., U47 and U54, are frequently more divergent than their conserved neighbors (19); however as discussed later, the basis for variation at these positions in lineages of colinear genomes is not clear.

Genetic variation between HHV-6A and HHV-6B was further examined by determining the distribution of nucleotide substitutions within coding sequences. Estimates of the number of nucleotide substitutions per synonymous site (Ks) or per nonsynonymous site (Ka), that is, substitutions that are silent or result in amino acid changes, were computed for the 88 genes present in both HHV-6A and HHV-6B (Table 3). The expected outcome is that Ka will be smaller than Ks, unless positive selective pressure is being exerted on that particular sequence (13, 28). A Ka/Ks ratio of greater than 1 can be an indication that a particular sequence is under a strong selective pressure toward change in the encoded amino acid. Ka/Ks ratios were plotted against the codon length of the aligned pairs, which allows possible stochastic effects of Ka/Ks ratios obtained from short sequences to be visualized (Fig. 4). Of the 88 genes analyzed, U24, U54, U90, U91, and U95 have Ka/Ks ratios of greater than 1. The values for U24 and U91 possibly reflect stochastic effects due to their small size. Of the remaining ORFs with Ka/Ks ratios greater than 1, U90 and U95 appear to be under strong positive selection toward sequence divergence. The products of both genes are hypothesized to have regulatory functions and therefore may have important roles in the establishment of the variant-specific niche in the host. U90 has been shown to be a transcriptional activator of the human immunodeficiency virus type 1 long terminal repeat (61). U95 is a member of the HCMV US22 gene family, and two family members from HCMV have been shown to transactivate gene expression (53). These data add additional support to the hypothesis based on sequence differences that the right-most 24 kb of U of HHV-6A and HHV-6B genomes is not under strong sequence conservation.

FIG. 4.

ORF length versus Ka/Ks ratio. Ka/Ks ratios were calculated by using DIVERGE for 88 aligned HHV-6A and HHV-6B coding sequences. Protein and nucleic acid sequences were aligned by using PILEUP with gap and length weights of 12 and 4, respectively, for proteins and 5 and 1, respectively, for nucleic acids. Ka/Ks ratios for spliced genes were determined for the spliced proteins and are designated by the 5′-proximal exon. ORFs with less than 80% amino acid (aa) identity are labeled.

Relationships of HHV-6B with other herpesviruses.

The relationship of HHV-6B to other herpesviruses is similar to that described for HHV-6A (19). HHV-7 is the next-closest relative of HHV-6B; homologs to 82 HHV-7 genes that are likely to encode proteins are present in HHV-6B (37, 41). Amino acid identities between HHV-6B genes and their HHV-7 homologs range from 75% for U66EX1 and U77 to 22% for U20 (Table 3).

Strain variation.

A 30-kb region encompassing part of U74 through the carboxy terminus of U94 has been reported for HHV-6B(HST) (27). In pairwise comparisons between the two variant B strains, the amino acid identity for complete ORFs ranged from 92% (U90EX3) to 100% (U75). For comparison, amino acid identity between HHV-6A and HHV-6B ORFs in this region range from 57.1% (U91EX1) to 98.9% (U77).

R1 and R3 are regions of greater divergence (Fig. 5); nucleotide identities between R1 and R3 from strains Z29 and HST are 92.4 and 94.4% without gaps, respectively. There are strain differences in the copy number of the repeat elements; R1 has 54 copies in strain Z29 and 53 in strain HST, while R3 has 26 copies in strain Z29 and 24 copies in strain HST. Additionally, Z29 U86 is encoded by a single ORF, while there are two ORFs (U86 and U87) in the HST sequence as a result of a one-base deletion at position 16394 of the HST sequence. The amino-terminal ends of Z29 U86 and HST U87 are related, but the carboxy-terminal end of Z29 U86 is related to HST U86. Overall, the region spanning U75 through the end of R3 has high nucleotide identity between the strains (98.4%). For comparison, the corresponding region in HHV-6A has 79.3% nucleotide identity with HHV-6B (Fig. 5). Most of the intravariant sequence differences are localized in repeat elements R1 and R3; greater interstrain divergence (both insertions and substitutions) has previously been described in regions adjacent to repetitive regions of other herpesviruses (7, 56). The observed sequence differences between the two HHV-6B strains may reflect either geographic or etiologic differences; HST was isolated from a Japanese exanthem subitum patient, whereas Z29 was isolated from an AIDS patient from Zaire.

FIG. 5.

Graphical representation of intra- and intervariant alignments in the region encompassing U75 to the 3′ end of U94 [HHV-6B(Z29) coordinates 113977 to 143096). The HHV-6B(Z29) and HHV-6B(HST) DNA segments were aligned by using GAP with gap and length weights of 50 and 3, respectively, and the graphical representations were generated with GAPSHOW. The corresponding region of HHV-6A(U1102) was aligned with that of HHV-6B(Z29) by using GAP with gap and length weights of 25 and 1, respectively. Nucleotide sequence differences are represented by the longest vertical bars; gaps are depicted by the shorter vertical lines. Regions spanning R1 and R3 are indicated. Locations of R1, R2A, R2B, R3, and ORFs are indicated.

DISCUSSION

In this work we present the general features of the HHV-6B genome sequence, describe its coding potential, and describe its relationships with other herpesviruses. This information will facilitate examination of the biological significance of the genetic differences between HHV-6B and other herpesviruses, in particular between HHV-6A and HHV-6B. The HHV-6B genome sequence allows prediction of 97 unique genes, 88 of which have HHV-6A counterparts, while 82 have counterparts in HHV-7. Thirty-nine of these genes are conserved among all mammalian herpesviruses (herpesvirus core genes), others have been found only in betaherpesviruses, while still others are found only in members of the genus Roseolovirus and some are found only in HHV-6A and HHV-6B. Below we discuss the general aspects of sequence conservation and divergence across the herpesvirus family, as well as the relationship between the HHV-6 variants.

Relationship of HHV-6B and other herpesviruses.

Herpesviruses encode a set of conserved genes, the herpesvirus core genes, that are grouped into seven gene blocks (7). Within gene blocks, the order and transcriptional polarity of the component genes are maintained. The gene blocks have different genomic locations, order, and orientations in the different herpesvirus subfamilies. Products of the core genes include structural components, such as capsid proteins and glycoproteins. Others include enzymes required for DNA replication, such as the major DNA binding protein and the DNA polymerase. The HHV-6B gene organization shares overall similarity with other betaherpesviruses, such as HCMV and HHV-7.

Betaherpesviruses encode several genes that are common to the viruses of this subfamily and that are absent in alpha- and gammaherpesviruses. Many of these genes belong to the US22 family of genes, examples of which are scattered throughout the HCMV genome (7). The function of these genes during infection is unclear, although HCMV TRS1 and IRS1 are transcriptional activators (53). Within the betaherpesviruses, divergence between viruses of the Cytomegalovirus and Roseolovirus genera is reflected by genes that are specific to members of Roseolovirus, including U20, U21, U23, U24, and U26.

It is particularly interesting that the roseoloviruses encode homologs (U73) of both the origin binding protein of alphaherpesviruses and their binding sites in origins of lytic DNA replication (23). As described here and elsewhere (19, 29, 31, 37, 41), the other proteins that are involved in replication at the replication fork are more highly conserved between the roseoloviruses and their HCMV counterparts than with any alphaherpesvirus. This strengthens the previous suggestion (14) that the mechanisms of DNA replication initiation and elongation for roseoloviruses have greater similarities with alphaherpesviruses and cytomegaloviruses, respectively.

Among the roseoloviruses, HHV-7 encodes no genes without counterparts in HHV-6A and HHV-6B, whereas both HHV-6A and HHV-6B encode DR3, U6, U9, U22, U83, and U94. In addition, HHV-6A and HHV-6B each encode variant-specific genes.

Relationship of HHV-6B and HHV-6A.

Comparisons of the HHV-6A and HHV-6B genomes confirmed that while the two genomes are colinear, there are regions of significant variation, including DR, a region spanning the junction of DR_L-U and the extreme left end of U, and a 24-kb segment located to the right of U86 (except for U94). The region spanning ORFs U2 through U85, which encompasses approximately 75% of U, is more highly conserved. Of the 89 ORFs in this region, 66 have over 92% amino acid identity. All of the genes belonging to the herpesvirus conserved gene blocks have greater than 94% amino acid identity.

U47 and U54 have less than 90% amino acid identity with their HHV-6A counterparts and Ka/Ks ratios of greater than 0.8, possibly reflecting gene products whose functions do not require specific sequences or that the gene products have different functions in each variant. It is interesting that these genes, which are the most divergent in the segment spanned by the herpesvirus core genes, map at the junctions of blocks of conserved genes. Extensive amino acid sequence variation of genes at these locations has been previously found in comparisons of herpesvirus genomes. This variation is easily rationalized for comparisons between herpesvirus genomes that have been rearranged through these sites, e.g., varicella-zoster virus and Epstein-Barr virus (10), but the basis for the susceptibility of these genes to variation is not obvious in the case of viruses with colinear genomes, e.g., HCMV, HHV-6A, HHV-6B, and HHV-7, for which these sites have not been the location of genomic rearrangements during evolution of the lineage.

The segment from U86 to the right end of U is the most divergent between the variants. This region is likely to be important in defining the biological differences between the variants. Interestingly, this region contains genes that have anomalous sequence compositions due to CpG suppression and complex splicing patterns. As an example, the variants differ in temporal regulation and splicing patterns of U91 transcripts in T-cell lines (39). It will be important to determine whether R3 is involved in transcriptional regulation of the IE-A locus and to ascertain the effect of sequence differences and copy number on R3-mediated transcriptional regulation.

Another source of phenotypic difference between the variants could be the gp82-gp105 complex, which is a major envelope glycoprotein that is composed of a number related polypeptides (44, 45). This glycoprotein is encoded by U100, which encompasses 11 exons (45) and is located in one of the most divergent regions of the genome. Homologs of the gene have been found only in roseoloviruses, with the intron-exon structure being conserved between the HHV-6 variants and HHV-7 (19, 37, 41). Differential splicing accounts for the presence of multiple related protein species, at least in the case of HHV-6A and as postulated for HHV-6B (45). The gp82-105 complex is likely to be important to the biology of HHV-6 since there are variant-specific neutralizing epitopes (44). HHV-6A and HHV-6B U100 share 79.9% amino acid identity, which is much lower than for other glycoproteins, such as glycoproteins B, H, L, and M (Table 3). Because glycoproteins are important determinants of specificity in the initial physical interaction between virus and the host cell, this complex of related proteins may confer different biological properties on the variants.

In addition to the effects of the more dramatically divergent regions, it is likely that the smaller genetic differences elsewhere in the genome reflect subtle adaptations to specific biological niches and cumulatively are likely to have an important effect on the biology of the variants.

Are HHV-6A and HHV-6B distinct herpesvirus species?

The genetic differences found between HHV-6A and HHV-6B are substantially greater than those found between HHV-7 strains RK and JI, even in the conserved region spanning ORFs U2 to U85. Across their lengths, the two HHV-7 genomes differed by a total of only 179 nt, an average of 1 per kb (37). In contrast, the sequence identity between HHV-6A and HHV-6B is 85% in DR, a mean of 95% in the region spanning U2 and U85, and 72% in the region spanning U86 and U100, for an overall identity of 90% (Fig. 1B). Additionally, sequence variation between HHV-6B strains Z29 and HST in the 30-kb region spanning the IE-A locus is substantially less than that between the variants. The accumulated biological, genetic, and epidemiologic data thus converge and make it clear that while HHV-6A and HHV-6B are closely related viruses, they have independent biological niches and meet the criteria for classification into distinct species.