Development and validation of Mayaro virus with luciferase reporter genes as a tool for antiviral assays

Abstract

Arboviruses are etiological agents in an extensive group of emerging diseases with great clinical relevance in Brazil, due to the wide distribution of their vectors and the favorable environmental conditions. Among them, the Mayaro virus (MAYV) has drawn attention since its emergence as the etiologic agent of Mayaro fever, a highly debilitating disease. To study viral replication and identify new drug candidates, traditional antiviral assays based on viral antigens and/or plaque assays have been demonstrating low throughput, making it difficult to carry out larger-scale assays. Therefore, we developed and characterized two DNA-launched infectious clones reporter viruses based on the MAYV strain BeAr 20290 containing the reporter genes of firefly luciferase (FLuc) and nanoluciferase (NLuc), designated as MAYV-firefly and MAYV-nanoluc, respectively. The viruses replicated efficiently with similar properties to the parental wild-type MAYV, and luminescence expression levels reflected viral replication. Reporter genes were also preserved during passage in cell culture, remaining stably expressed for one round of passage for MAYV-firefly and three rounds for MAYV-nanoluc. Employing the infectious clone, we described the effect of Rimantadine, an FDA-approved Alzheimer's drug, as a repurposing agent for MAYV but with a broad-spectrum activity against Zika virus infection. Additionally, we validated MAYV-nanoluc as a tool for antiviral drug screening using the compound EIDD-2749 (4′-Fluorouridine), which acts as an inhibitor of alphavirus RNA-dependent RNA polymerase.

Highlights

• •DNA-launched infectious clones of MAYV-nanoluciferase or -firefly were produced.
• •MAYV-nanoluc and -firefly replicated efficiently, similarly to the wild-type MAYV.
• •MAYV-nanoluc was stable to three passages in cell culture.
• •MAYV-firefly luciferase was stable for one passaging round.
• •Rimantadine was identified as a repurposing agent with a broad-spectrum activity.

1. Introduction

Arboviruses make up an extensive group of emerging pathogens of great clinical relevance in Brazil, due to the wide distribution of their vectors, mediated by favorable environmental conditions [1]. Although their circulation is geographically restricted by vectors and reservoir hosts, arboviruses have the potential to adapt to infect new organisms, spreading beyond the endemic areas [2]. In this sense, the global emergence and resurgence of those pathogens lead to management and preparedness efforts for possible new outbreaks, including the search for antivirals against them [3].

Mayaro virus (MAYV; specie Alphavirus mayaro) is a single-stranded positive-sense RNA (ssRNA+) arbovirus, that belongs to the Togaviridae family and the genus Alphavirus [4]. The viral genome encodes MAYV structural proteins (CP, E3, E2, 6k/TF, E1) and non-structural proteins (nsP1, nsP2, nsP3, nsP4), which are involved in virus replication and pathogenesis [5]. It was first described in Trinidad in 1954 [6], and since then, several localized outbreaks of MAYV have been reported, especially in northern region of Brazil, due to increased trade and climate changes [1].

MAYV is the etiologic agent of Mayaro fever, a disease characterized by joint inflammation and arthralgias, which can progress to a chronic condition and cause clinical complications [7]. As an aggravating factor, there is no approved antiviral drug to treat Mayaro fever, and the treatment for the disease is based on controlling symptoms [4]. Another fact is that the virus is maintained in a wild enzootic cycle and the occurrence of spillover into the urban environment has drawn attention due to the potential to remain in an urban cycle [8,9].

On this basis, the emerging character of MAYV combined with the lack of antivirals to control infections caused by this pathogen demonstrates the need to search for molecules with the potential to treat the disease. In this context, drug repurposing can be an effective and rapid strategy to identify new indications of existing drugs to control virus spreading [10]. Rimantadine is an approved antiviral drug, which exhibits structural stability, good thermal and oxidative stability, extreme lipophilicity, and low consumption of energy [11]. In addition, it inhibits the influenza A virus by blocking the M2 ion channel, preventing viral uncoating, and its antiviral profile makes rimantadine an attractive candidate for drug repurposing [12].

Nevertheless, traditional antiviral assays based on viral antigens and/or plaque assays demonstrate low throughput, making it difficult to carry out larger-scale assays [13]. As a response, reporter viruses are an alternative system for high-throughput antiviral assays since the insertion of a specific reporter gene into the viral genome facilitates and provides a more efficient way of measuring viral replication, pathogenesis, and/or dissemination in infected cells and animals [14].

Previous investigations described the development and applicability of several viruses inserted with reporter genes, such as the Dengue virus [15], Influenza virus [16], Hepatitis C virus [17], Poxviruses [18], Sindbis virus, Chikungunya virus [19], and more recently, SARS-CoV-2 [20]. In a previous study, we also developed and characterized a stable enhanced green fluorescent protein (eGFP) reporter virus for the MAYV strain BeAr 20290, providing an interesting tool for antiviral screening assays [21]. Alternatively, Ramjag and coworkers described and characterized the MAYV expressing nanoluciferase (MAYV E2^nLuc) [22].However, both of these systems are based on the bacteriophage T7 and SP6 promoter, respectively [21,22], and therefore, depends on the transcription of backbone plasmid into infectious RNA to produce virions in eukaryotic cells [23,24]. This is an interesting technique; however, it presents limitations due to the instability of the RNA transfection into host cells, making it susceptible to degradation [25] In addition, the viral RNA can induce cellular immune response, compromising the efficient production of recombinant viruses and stimulating undesired mutations [26]. In contrast, cytomegalovirus (CMV) promoter-driven systems exhibit a less laborious and more efficient rescue process in eukaryotic cells, allowing transcription of the cDNA clone to be initiated directly by cellular RNA polymerase II (Chey et al., 2021). This system exhibits robust activity in mammalian cells, resulting in high levels of gene expression and increased production of viral particles [27]. In addition, it also presents higher accessibility, cost-effectiveness, and production speed than bacteriophage-driven systems, which makes it ideal for the efficient and economical production of viral vectors in research [28].

In this sense, we developed and characterized two stable infectious clones harbouring the luciferase reporters under the CMV promoter for antiviral screening assays, based on the strain BeAr 20290 of MAYV, Brazil [29]. The inserted reporter genes of firefly luciferase (FLuc) and nanoluciferase (Nluc) were designated as MAYV-firefly and MAYV-nanoluc, respectively. Additionally, we employed the system to identify Rimantadine hydrochloride (rtdH) as a repurposing drug, as well as validated MAYV-nanoluc as a tool as a powerful tool for high-throughput antiviral screening by using the compound EIDD-2749 (4′-Fluorouridine), which acts as an inhibitor of alphavirus RNA-dependent RNA polymerase [30]. Furthermore, rtdH presented a potential broad-spectrum activity by inhibiting the Zika virus (ZIKV).

2. Methods

2.1. Cells and compound

Vero E6 cells (kidney tissue derived from a normal adult African green monkey, ATCC E6) were cultivated on Dulbecco's Modified Essential Medium (DMEM, GIBCO) supplemented with 100 U/mL penicillin (Sigma-Aldrich), 100 mg/mL streptomycin (Sigma-Aldrich), 1 % (v/v) non-essential amino acids (Sigma-Aldrich) and 10 % (v/v) fetal bovine serum (FBS; Hyclone) at 37 °C in a humidified 5 % CO₂ incubator. Cell line was monthly tested to avoid mycoplasma infection.

The Rimantadine hydrochloride (rtdH, C12H22NCl, 99 %) was purchased from Sigma-Aldrich Laboratories and 4′-Fluorouridine (EIDD-2749, 98 %) was purchased from Cayman Chemical. The compounds were dissolved in DMSO (dimethyl sulfoxide), stored at −20 °C, and diluted in media at time of the assay.

2.2. Generation of the MAYV reporter construct

Using the previously constructed infectious cDNA clone of MAYV with the T7 promotor (termed as T7-MAYV) as a backbone (Li et al., 2019), the CMV-MAYV-nanoluc and CMV-MAYV-firefly were constructed under the control of the CMV promoter, in which a cassette expressing the NLuc or/FLuc gene and a repeated sub-genomic (sg) promoter was inserted between the nonstructural nsP4 gene and the 5′-terminal of structural genes (Fig. 1). To achieve this, T7-MAYV-nanoluc was initially constructed and details for construction were as follows. Three individual fragments, respectively encompassing the sequences from part of nsp4 to the first sg promotor of the NLuc gene, and from the second sg promotor to the most of E1, were amplified and fused followed by pasting into the T7-MAYV backbone at EcoR I and Rsr II restriction sites to generate T7-MAYV-nanoluc clones. To facilitate the construction of the firefly reporter clone, AscI and PacI restriction sites were introduced at both ends of the NLuc gene, and the T7-MAYV-firefly clone was generated by replacing the NLuc gene of the T7-MAYV-nanoluc clone with FLuc through AscI and PacI sites. Then, the fragment encompassing the sequences from CMV promotor to nsp2 was obtained by fusion PCR and replace the corresponding part of T7-MAYV-nanoluc and T7-MAYV-firefly clones by BamH I and Mlu restriction sites. The resulting plasmids were confirmed by sequencing and named as CMV-MAYV-nanoluc and CMV-MAYV-firefly. All primers used for PCRs were listed in Table 1, and the full-length sequences of the clones are available in Supplementary Material 1.

Fig. 1.

Scheme of plasmid construction of MAYV-nanoluc and –firefly. The constructions were developed based on the sequence of MAYV BeAr 20290 strain, isolated in Brazil in 1960 from Haemagogus mosquitoes, belonging to genotype L. The marker genes that express the protein Nanoluciferase(A) and Firefly luciferase(B) were inserted in the viral genetic sequence between the non-structural proteins and capsid encoding genes.

Table 1.

Primers used for construction of infectious MAYV reporter clones.

Primer	Sequence
EcoRI-MAYV nsp4-F	CCGGAATTCACAGAGAGCTGGTTCGCCGCC
Nanoluc-F	CTACACGACACCTATTCCACCCGGCGCGCCATGGTCTTCACACTCGAAGATTTC
Nanoluc-R	GGCGCGCCGGGTGGAATAGGTGTCGTGTAGAGCACCTATTTAGGACCGCC
MAYV-Nanoluc-Sg-Linker-F	ACGCATTCTGGCGTAATTAATTAATGTCATACATCTGTACGGCGGTCC
MAYV-Nanoluc-Sg-Linker-R	GTATGACATTAATTAATTACGCCAGAATGCGTTCGCACAGCCGCCAGCCGG
MAYV-E1-RsrII	GGTCGGACCGGATTTGTCTGGATTATG
AscI-Firefly-F	TTGGCGCGCCATGGAAGACGCCAAAAACATAAAG
PacI-Firefly-R	TCCTTAATTAATTACACGGCGATCTTTCCGCCCTTC
CMV promoter-5′UTR-F	GCTCGTTTAGTGAACCGTATGGCGGGCAAGTGACAC
5′UTR + MAYV-nsp2-Mlu I–R	CG ACGCGTCAATAGGACATTGACGTGTT
BamH I - CMV promoter-F	CGCGGATCC CATTGATTATTGACTAGTTA
CMV promoter-5′UTR-R	GTGTCACTTGCCCGCCATACGGTTCACTAAACGAGC

2.3. MAYV plasmids amplification and purification

Initially, 1 μg of the plasmids CMV-MAYV-nanoluc or CMV-MAYV-firefly was added to 200 μL of competent DH5-α Escheria coli and incubated on ice for 30 min. Subsequently, the bacteria were submitted to a thermal shock at 42 °C for 45 s, returned to ice for 2 min, and incubated with SOC medium at 37 °C for 1 h 200 rpm. Then, the DH5-α cells were streaked for isolation in solid Luria Berthani (LB) medium supplemented or not with Ampicillin (Sigma-Aldrich) at 50 μg/mL, for control based on the antibiotic resistance gene inserted in the plasmids. Afterward, the transformed bacteria were grown for 24 h and lysed to obtain the amplified plasmids. The purification process was performed by Plasmid Maxi kit (QUIAGEN) protocol, and the amount of DNA extracted was quantified through Nanodrop (Thermo Fisher).

2.4. MAYV infectious clone rescue

To produce the MAYV-nanoluc and MAYV-firefly virions, 1 × 10⁶ BHK-21 cells/well seeded in 6 well plates were transfected with 5 μg of CMV-MAYV-nanoluc or CMV-MAYV-firefly plasmids using the LipofectamineTM LTX Reagent with PLUS Reagent (Thermo Fisher Scientific) and Optimem Medium following the manufacturer's instructions. After 48 h, the supernatant was collected and stored at −80 °C. The expression of NLuc and FLuc genes were assessed by luminescence reading on Glomax microplate reader (Promega), through the Renilla luciferase Assay System (Promega) or Luciferase Assay System (Promega), respectively, at different time-points post-transfection.

To determine viral titers, 8 × 10⁴ Vero E6 cells/well were seeded in 24 wells plate, and 24 h later, the cells were infected with ten-fold serial dilutions of each MAYV infectious clone. Cells were incubated with viruses for 1 h at 37 °C and 5 % CO₂, followed by the inoculum removal, washes with PBS to remove the unbound virus, and addition of fresh medium supplemented with 1 % dilution of stock of penicillin and streptomycin, 2 % FBS, and 1 % carboxymethyl cellulose (CMC). Infected cells were incubated for 2 days in a humidified 5 % CO2 incubator at 37 °C, followed by fixation with 4 % formaldehyde and staining with 0.5 % violet crystal. The viral foci were visualized to determine plaque morphology. Images were analyzed at EVOs M5000 Cell Imaging Systems (Thermo Fisher Scientific).

All work was performed at biosafety level 2 under the authorization number SEI: 01245.006267/2022-14 CBQ: 163/02 from the CTNBio — National Technical Commission for Biosecurity from Brazil.

2.5. MAYV-nanoluc and -firefly growth kinetics

To assess the growth kinetics of both MAYV-nanoluc and MAYV-firefly, 1 × 10⁵ Vero E6 cells were seeded in 12 well plates 24 h before infection. Later, cells were infected with MAYV wild-type strain BeAr 20290 (MAYV_WT), MAYV-nanoluc, or MAYV-firefly at the MOIs of 0.01, 0.05, and 0.1. After 2 h of incubation, the supernatants were removed, and cells were washed with PBS (1x) three times and replaced with fresh medium supplemented with 2 % FBS. At different time-points post-infection (4, 6, 12, 24, 36, and 48 h.p.i.), the culture medium was collected and stored at −80 °C.

The viral titer of each time-point was determined by TCID50 (Median Tissue Culture Infectious Dose). To this, 5 × 10³ Vero E6 cells were seeded in each well of a 96 well plate, were infected with ten-fold serial dilutions of the viral stocks, and incubated for 72 h at 37 °C, with 5 % CO2. Subsequently, viral titers were calculated according to the Spearman-Kärber algorithm as described by Killington and Hierholzer [31,32].

2.6. Stability of the reporter viruses in cell culture

To analyze whether the FLuc and NLuc reporter genes can be stably maintained after cell culture passaging, MAYV-firefly and MAYV-nanoluc were serially passaged in Vero E6 cells. For this, 1 × 10⁶ cells were seeded in a T25 cm2 and infected with each MAYV infectious clone at an MOI of 0.1. Virus supernatant was stored at −80 °C, titrated through plaque reduction assay, and used to infect a new T25 cm2 flask using the same MOI. The cell passaging was performed 5 times. Additionally, the plaque focus was captured at EVOs M5000 Cell Imaging Systems (Thermo Fisher Scientific), and the morphology was compared among viruses.

To access the luciferase level expression during each passage, Vero E6 cells were seeded in a 48-well plate at a density of 2 × 10⁴ cells per well and infected with each passage of the virus at an MOI of 0.1 for 24h. Afterward, cells were washed with PBS [1x] and harvested using Renilla-luciferase lysis buffer (Promega). Virus replication levels were quantified by measuring NLuc or FLuc activity through the Renilla luciferase assay system (Promega) or the Luciferase Assay System (Promega), respectively.

2.7. Determination of cytotoxic concentration of 50 % (CC₅₀)

Cell viability was measured by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (Sigma-Aldrich) assay as previously described [33,34]. Briefly, Vero E6 cells were plated to 24 well plates at a density of 8 × 10⁴ cells/well for MAYV assays, or 5 × 10³ cells/well in 96 well plate for ZIKV assays and incubated at 37 °C and 5 % CO₂. After 24h, medium containing two-fold serial dilutions of rtdH or EIDD-2749 (4′-Fluorouridine) was added to cells in concentrations ranging from 1.6 to 400 μM 1.56–200 μM, respectively. Since the CC50 was performed simultaneously with viral infection, the analysis for ZIKV was conducted after 72 h, and MAYV after 48 h. Then, the medium was replaced by MTT solution at 1 mg/mL for 30 min and replaced by 100 μL of DMSO (dimethyl sulfoxide) to solubilize the formazan crystals. The absorbance was measured at 490 nm on the Glomax microplate reader (Promega). Cell viability was calculated according to equation (T/C) × 100 %, where T and C represent the mean optical density of the treated and untreated control groups, respectively. The cytotoxic concentration of 50 % (CC₅₀) was calculated using GraphPad Prism 8.0.

2.8. Determination of effective concentration of 50 % (EC₅₀) using MAYV-nanoluc

To identify the effect of Rimantadine hydrochloride (rtdH) in MAYV replication, the MAYV-nanoluc was employed. To this, Vero E6 cells were plated in microplates of 48 wells at a concentration of 2 × 10⁴ cells/well and incubated at 37 °C and 5 % CO₂ for 24 h. RtdH was diluted in a two-fold serial dilution following the concentrations of 1.6–400 μM, in the presence of the virus in a MOI of 0.1. The dose-response assay was also performed with EIDD-2749, a broad-spectrum inhibitor of alphaviruses (positive control) [30] in a two-fold serial dilution from 1.56 to 200 μM. After 24 h of incubation, the supernatant was removed, cells washed and lysed according to the Renilla Luciferase Assay System (Promega) kit protocol, and subsequently submitted to a luminescence analysis on the GloMax (Promega) plate reader. The effective concentration of 50 % inhibition (EC₅₀) was calculated using GraphPad Prism 8.0 software.

2.9. ZIKV assays

A wild-type ZIKV isolate from a clinical sample of a patient in Brazil (ZIKV_PE243) [35] was amplified employing infected Vero E6 cells in a 75 cm² flask for 3 days. It was produced, rescued, and titrated as previously described [34].

For determination of the EC50 using ZIKV_PE243, Vero E6 cells were seeded at a density of 5 × 10³ cells per well into 96 well plates, infected with ZIKV_PE243 at a MOI of 0.01 and simultaneously treated with rtdH at concentrations ranging from 1.6 to 400 μM. For EC₅₀, cells were also. After 72 h, cells were fixed with 4 % formaldehyde, washed with PBS, and added of blocking buffer (BB) to perform an immunofluorescence assay [34]. The same protocol was performed in parallel in the absence of ZIKV_PE243 to determine CC50. The CC₅₀ and EC₅₀ were calculated using GraphPad Prism 8.0 software. These values were used to calculate the selectivity index (SI CC₅₀/EC₅₀).

All work was performed at biosafety level 2 under the authorization number SEI: 01245.006267/2022-14 CBQ: 163/02 from the CTNBio — National Technical Commission for Biosecurity from Brazil.

2.10. Statistical analysis

Individual experiments were conducted in triplicates and all assays were performed a minimum of three times to confirm the reproducibility of the results. All data were normalized and expressed as mean and standard deviation. Differences between mean readings were compared using analysis of variance (one-way and two-way ANOVA) or Student's t-test, with p values < 0.05 considered significant. GraphPad Prism 8.0 software was used to assess statistical differences of means of readings using a non-linear regression.

3. Results

3.1. Construction of MAYV-nanoluc and –firefly

To construct the cDNA clones of MAYV reporter viruses, we utilized the protocol reported to the construction of an eGFP Chikungunya reported in our previous study [36]. Briefly, a cassette expressing the NLuc or/FLuc gene and a repeated sub-genomic (sg) promoter was inserted between the nonstructural nsP4 gene and the 5′-terminal of structural genes. In addition, to avoid steps such as transcription to obtain viral RNAs in vitro, the reporter cDNA clones were placed under the control of CMV promotor (Fig. 1). The resulting plasmids were confirmed by sequencing and named as CMV-MAYV-nanoluc and CMV-MAYV-firefly.

3.2. Characterization and growth kinetics of MAYV-nanoluc and -firefly

The plasmids of CMV-MAYV-nanoluc and CMV-MAYV-firefly were transfected into Vero E6 cells to evaluate the efficacy of the infectious clone in producing an infectious particle. At different time points post-transfection, supernatants were collected and subjected to plaque assay to determine plaque morphology and virus production (Fig. 2). As shown in Fig. 2A, Relative Light Units (RLUs) were detectable at 1 h post-transfection (h.p.t.) for MAYV-nanoluc and increased until 24 h.p.t., reaching 1 × 10⁸ RLUs (Fig. 2A). Alternatively, luminescence levels in cells transfected with MAYV-firefly were also detected 1 h.p.i., however, RLU values were maintained in about 1 × 10² RLUs until 24 h.p.t. (Fig. 2B).

Fig. 2.

Characterization of MAYV infectious clones. Analysis of luminescence expression in Vero E6 cells transfected with CMV-MAYV-nanoluc and CMV-MAYV-firefly and. Vero E6 cells were transfected with 1 μg of each plasmid and the expression of Nanoluciferase (A) and Firefly luciferase (B) were detected through Luciferase and Renilla luciferase assay system after transfection, respectively. (C) Plaque morphology of the recombinant viruses MAYV-nanoluc and MAYV-firefly, and the wild type. (D) Focus morphology of each virus in Vero E6 cells. Images were analyzed at EVOs M5000 cell imaging systems (Thermo Fisher Scientific). Scale bar 100 nm.

After 48h, the supernatant of transfected cells was titrated employing the plaque formation assay, and as a result, the viral plaque morphology was homogeneously between MAYV_WT, MAYV-nanoluc, and –firefly (Fig. 2C). Visualization at a digital inverted microscope demonstrated that the MAYV-nanoluc and MAYV-firefly presented similar foci morphology, being those larger foci and with rounded edges when compared to MAYV_WT, which presented smaller and not defined foci (Fig. 2D).

Given the high stability and expression level of luciferase protein for both viruses at the first passage, we performed a growth kinetics comparison curve of the P1 from MAYV-nanoluc, -firefly, and MAYV_WT. To this, Vero E6 cells were infected with these three viruses at MOIs of 0.1, 0.05, and 0.01, and viral supernatant was collected at the time points 4, 6, 12, 24, 36, and 48 h.p.i. and titrated by TCID50. As an outcome, the viral titers increased in a dose- and time-dependent manner (Fig. 3A). At all MOIs, both reporter viruses and MAYV_WT presented low titers at 4 h.p.i., ranging between 1.45 and 3.88 pfu/mL (Fig. 3). At the MOIs of 0.1 (Figs. 3B) and 0.05 (Fig. 3C), the reporter viruses presented lower titers than the MAYV_WT until 24h.p.i. However, MAYV-nanoluc reached a similar titer to MAYV_WT at 36 h.p.i, presenting even higher titers than MAYV_WT and MAYV-firefly at 48h.p.i. (Fig. 3B and C). Additionally, MAYV-firefly presented slightly higher titers than MAYV_WT at the MOI of 0.05 at 48 h.p.i. (Fig. 3C). At the lowest MOI, MAYV-nanoluc presented higher titers than both MAYV-firefly and MAYV_WT 24h.p.i., while MAYV-nanoluc and MAYV-firefly overcame MAYV_WT titers at 48 h.p.i (Fig. 3D). These results demonstrated that the reporter viruses could efficiently replicate in Vero E6 cells, reaching similar growth rates to MAYV_WT.

Fig. 3.

Replication kinetics of MAYV in cell culture. (A) Schematic representation of replication kinetics assay. Growth kinetics of the wild type MAYV (indicated by ●), MAYV-nanoluc (indicated by ■), and MAYV-firefly (indicated by ▲). Vero E6 cells were infected with the three viruses at MOIs of 0.01 (B), 0.05 (C), and 0.1 (D), viral supernatant was collected at different time points up to 48 h.p.i. and titrated by TCID₅₀.

3.3. Nluc and Fluc reporter genes present different stability and luminescence expression levels in cell culture

To analyze the in vitro stability and expression of the FLuc and NLuc genes, the viruses were serially passaged on Vero E6 cells for five times at an MOI of 0.1 for 48 h (Fig. 4A). The passages were titrated by plaque-forming assay, and the luciferase expression of each passage was measured by infecting Vero E6 cells with -nanoluc, at an MOI of 0.1 and MAYV-firefly at an MOI of 1, due to the contrast in the luminescence activity among the constructs. As an outcome, MAYV-nanoluc showed strong and consistent luminescence signals until the third passage, indicating the NLuc gene was stable for a minimum of three passages of infectious virus (Fig. 4B). Differently, MAYV-firefly presented a significant decrease in luminescence signal from the first to the second passage, indicating the loss of the FLuc gene probably due to selective pressure (Fig. 4C). Despite the gradual loss of reporter gene expression, viral titers were stable during passaging, varying from 2.67 × 10⁶ to 2 × 10⁸ PFU/mL.

Fig. 4.

Stability of the MAYV-nanoluc and -firefly viruses in cell culture. The luciferase expression of the different passages of MAYV-nanoluc(A) and –firefly(B) in Vero E6 cells. Vero E6 cells were serially infected with viruses for five passages. Viruses from each passage (P1–P5) were used to infect 1 × 10⁵ Vero E6 cells at an MOI of 0.1, and the expression of luciferase proteins were detected 48 h.p.i. through Luciferase and Renilla luciferase assays, respectively. Mean values of three independent experiments each measured in triplicate including the standard deviation are shown. P values < 0.05 were considered significant. (**) P < 0.01, (***) P < 0.001 and (****) P < 0.0001.

3.4. Employing MAYV-nanoluc reporter virus to identify rtdH as a drug candidate to be repurposed against MAYV infections

In order to validate the employment of MAYV reporter viruses as tools for antiviral screening, and considering the high stability and sensibility of NLuc for in vitro assays, we used this reporter virus to analyze the antiviral activity of rtdH on MAYV replication. Additionally, the potential of MAYV-nanoluc as a powerful tool for antiviral screening was validated by treating infected cells with EIDD-2749.

To this, Vero E6 cells were infected with MAYV-nanoluc and treated with rtdH or EIDD-2749 for 24h. Afterward, the cells were lysed and subjected to a luminescence analysis to evaluate the reporter gene expression. Cell viability assay was performed in parallel. As a result, rtdH had an EC₅₀ of 88.5 μM and a CC₅₀ of 291.9 μM. Further, EIDD-2749 inhibited MAYV-nanoluc replication with an EC₅₀ of 2.76 μM and CC₅₀ of 4.99 × 10⁷ μM. The calculated selectivity index (SI CC₅₀/EC₅₀) for rtdH and EIDD-2749 were 2.3 and 1.8 × 10⁷, respectively (Fig. 5). These results indicated that the MAYV-nanoluc reporter virus could be a useful tool for the evaluation of compounds presenting an anti-MAYV activity.

Fig. 5.

Antiviral activity of Rimantadine hydrochloride on MAYV infectious clone. (A) Schematic representation of MAYV-nanoluc assay. Vero E6 cells were infected with MAYV-nanoluc at a MOI of 0.01 and treated with two-fold serial dilutionss of rtdH (1.6–400 μM) (B) or EIDD-2749 (1.56–200 μM) (C) for 24 h, when luminescence levels were measured by Renilla luciferase assay (indicated by ■) and cellular viability measured using MTT assay (indicated by ●). The effective concentration of 50 % (EC₅₀) and cytotoxic concentration of 50 % (CC₅₀) were determined. Mean values of three independent experiments each measured in quadruplicate including the standard deviation are shown.

3.5. RtdH also presents antiviral activity against ZIKV

The results presented here suggested that rtdH exerts its antiviral function against MAYV with a SI of 2.3, and, recently, it was described to possess activity against CHIKV [37]. Therefore, this drug could also present an antiviral activity on other arboviruses. To further investigate its broad-spectrum activity, we evaluated the inhibitory effects of rtdH on ZIKV replication. To this, Vero E6 cells were treated with the compound in a two-fold serial dilution ranging from 1.5 to 400 μM, along with the infection with ZIKV_PE243 at an MOI of 0.01 for 72h, when immunofluorescence assay was performed [34] (Fig. 6A). The results demonstrated that rtdH was able to inhibit ZIKV infection in a dose-dependent manner. The EC₅₀ calculated by fluorescence value reduction was 80.3 μM and the CC₅₀ of 194.3 μM, with an SI of 2.4 (Fig. 6B). Taken together, our findings demonstrate that rtdH presented an interesting antiviral effect against MAYV and ZIKV infections in vitro.

Fig. 6.

Anti-ZIKV activity of Rimantadine hydrochloride. (A) Schematic representation of ZIKV_PE243 assay. (B) Vero E6 cells were treated with rtdH at concentrations ranging from 1.6 to 400 μM and the effective concentration of 50 % (EC₅₀) and cytotoxic concentration of 50 % (CC₅₀) were determined. ZIKV replication was measured by FFU/mL (indicated by ■) and cellular viability measured using MTT assay (indicated by ●). Mean values of three independent experiments each measured in triplicate including the standard deviation are shown.

4. Discussion

The use of infectious clones of emergent viruses has been increasing in the past few years [13]. The insertion of specific reporter genes into the viral genome is a powerful tool to monitor the viral replication into infected mammalian cells, for applications such as high-throughput screening (HTS) for antiviral drug discovery [38]. Traditional plaque reduction assay for antiviral screening requires weeks to complete, while infectious clones expressing reporter genes can be done in days [39].

Here, we described the development of two DNA-launched replicative efficient MAYV-luciferase systems, expressing NLuc and FLuc genes. The NLuc or FLuc gene was inserted between the nonstructural nsP4 gene and the 5′-terminal of structural genes, and expressed under the control of sg promotor. Transfection of Vero E6 cells with the CMV-MAYV-nanoluc and –firefly plasmids resulted in detecting luminescence from the luciferase reporters. The reporter viruses were infectious to Vero E6 cells, with robust luciferase levels production. While MAYV-nanoluc maintained the NLuc gene expression for three passages, MAYV-firefly was able to maintain the reporter gene for only one passage. Compared with the wild-type virus, the viral-growth kinetics were similar for both clones, showing indistinguishable replication efficiency. Additionally, we confirmed the usefulness of the MAYV-nanoluc for rapid antiviral screening assay using the Rimantadine hydrochloride, a well-known antiviral agent against the Influenza A virus. The broad-spectrum antiviral properties of rtdH were also demonstrated against ZIKV.

While the FLuc gene has more than 1.6 kb and encodes a 61 kDa protein, the nLuc gene has about three times fewer base pairs that encode a 19 kDa protein, being considered to present higher sensitivity and luminescent signal than FLuc [40]. In previous studies, constructs of the Sindbis virus (SINV) that presented the insertion of FLuc or NLuc genes, demonstrated different stability after cell passaging. In agreement with our data, the NLuc gene presented gene stability in SINV for ten passaging rounds, while the FLuc gene expression was only detected until the third passage [19]. Furthermore, in our study, the virus passages were performed in Vero E6 cells, which lack innate immune defenses and offer the potential for virus genetic drift, which possibly could also favor the loss of reporter genes during passaging [41].

Nevertheless, the FLuc system is applied in vivo due to the free diffusion of Firefly luciferase protein across the cell membrane [42]. FLuc possesses stable glow kinetics in the presence of its substrate and presents longer periods of photon emission than the nanoluciferase protein [43]. However, the Fluc gene presented low stability in MAYV infectious clones and was lost after the first passage, equivalent to about 4–6 rounds of virus infection [44]. This instability limits the utility of the FLuc marker for long-term studies or multiple rounds of viral replication, making it unsuitable for antiviral screening assays. Additionally, the bioluminescent activity of FLuc and NLuc originated through the reaction with different substrates that do not show cross-reactivity. In this sense, the systems can be applied concurrently for in vivo and in vitro dual bioluminescence analyses, allowing the simultaneous characterization of two different organisms or two separate biological processes [45].

Recently, our group pointed out rtdH as an inhibitor of CHIKV, an arbovirus that belongs to the same family and genus as MAYV, demonstrating promising results [37]. We proposed that the compound exhibits multiple effects on CHIKV, impairing mostly the early stages of the viral cycle, due to a virucidal action that involves viroporin blocking and interaction with the virus envelope [37]. Here, we described the antiviral properties of rtdH on both MAYV and ZIKV infections, presenting a SI of 2.3 and 2.4, respectively. In this sense, considering that rtdH has a known pharmacological profile and is an approved drug to treat Influenza A infection, it could be further evaluated in pre-clinical studies as a drug to be repurposed against MAYV, CHIKV and ZIKV infections, being applied more quickly than novel antivirals. Additionally, it could be used as a template to develop more potent drugs against MAYV, CHIKV and ZIKV infections. However, further studies are necessary to elucidate the mechanism of action on MAYV and ZIKV viroporins, which can be hypothesized by the differences between their structure and distribution in host cells. In addition, the compound EIDD-2749, previously described as RNA-dependent RNA polymerase (RdRp) inhibitor against MAYV [30] was used to validate MAYV-nanoluc as a potent tool for antiviral screening, presenting a SI of 1.8 × 10⁷, in agreement with the previously published data. In summary, the results with rtdH and EIDD-2749 demonstrate that MAYV-nanoluc is a useful tool for HTS assays to detect inhibitors in different compound libraries for future antiviral research.

5. Conclusion

Considering the data described here, the reverse genetic system for MAYV employing DNA-launched plasmids containing NLuc and FLuc reporter genes were efficiently rescued and presented efficient replication as the wild-type virus in Vero E6 cells. Due to the high stability of MAYV-nanoluc activity, which accurately represents virus replication rates, it is an applicable tool for antiviral assays that could facilitate the antiviral screening for novel anti-MAYV agents. Furthermore, we highlight the repurposing potential of Rimantadine hydrochloride as a broad-spectrum antiviral drug against MAYV and ZIKV.

Data availability statement

All data generated or analyzed during this study are included in this article.

CRediT authorship contribution statement

Mikaela dos Santos Marinho: Formal analysis, Investigation, Methodology, Validation, Writing – original draft. Ya-Nan Zhang: Investigation, Methodology, Writing – original draft. Natasha Marques Cassani: Investigation, Methodology, Writing – original draft, Writing – review & editing. Igor Andrade Santos: Investigation, Methodology, Writing – original draft, Writing – review & editing. Ana Laura Costa Oliveira: Investigation. Anna Karla dos Santos Pereira: Resources, Writing – review & editing. Pedro Paulo Corbi: Resources, Writing – review & editing. Bo Zhang: Methodology, Resources, Writing – review & editing. Ana Carolina Gomes Jardim: Funding acquisition, Supervision, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article: