Skip to main content
NCBI home page
Protein Science : A Publication of the Protein Society logoLink to Protein Science : A Publication of the Protein Society
. 2024 Jul 29;33(8):e5126. doi: 10.1002/pro.5126

Haspin mediates H3.3S31 phosphorylation downstream of Aurora B in mouse embryonic stem cells

Yuanyuan Li 1,2, Meixian Wu 1, Yang Liu 1, Lihua Sun 2, Peiqiang Mu 3, Binbin Ma 1,4,✉, Jing Xie 1,2,✉
PMCID: PMC11284449  PMID: 39073155

Abstract

Histone phosphorylation is instrumental in regulating diverse cellular processes across eukaryotes. Unraveling the kinases that target specific histone sites is key to deciphering the underlying mechanisms. Among the various sites on histone tails that can undergo phosphorylation, the kinase responsible for H3.3S31 phosphorylation remained elusive. Since both H3.3S31ph and H3T3ph occur specifically during mitosis, and Haspin is the known kinase for H3T3 phosphorylation, we investigated its potential role in H3.3S31 phosphorylation. We employed CRISPR/Cas9, RNA interference, and specific small molecule inhibitors to eliminate Haspin function in various cell types. Our data consistently revealed a link between Haspin and H3.3S31ph. Furthermore, in vitro kinase assays provided evidence supporting Haspin's contribution to H3.3S31ph. Loss‐ and gain‐of‐function experiments targeting Haspin and Aurora B further suggested a hierarchical relationship. Haspin acts as a downstream kinase of Aurora B, specifically orchestrating H3.3S31 phosphorylation in mESCs. This study unveils a novel role for Haspin as a kinase in regulating H3.3S31 phosphorylation during mitosis. This discovery holds promise for expanding our understanding of the functional significance of Haspin and H3.3S31ph in mammals.

Keywords: Aurora B, Haspin, histone phosphorylation, H3.3S31ph

1. INTRODUCTION

Eukaryotic chromosomes, the vital structures housing the genome, are primarily composed of DNA wrapped around histone octamers. Chemical modifications on histone tails, known as post‐translational modifications (PTMs), including methylation, acetylation, phosphorylation, and ubiquitination, significantly impact chromatin structure and function (Kouzarides, 2007; Mersfelder & Parthun, 2006). Among these, histone phosphorylation plays a key role in governing diverse chromatin‐related events like DNA damage repair, gene expression, and chromosome compaction (Rossetto et al., 2012).

Histone H3 phosphorylation occurs primarily at its N‐terminal tail. Well‐studied examples like H3 Thr3, Ser10, Thr11, and Ser28 are all linked to mitotic chromosome events (Hans & Dimitrov, 2001; Pérez‐Cadahía et al., 2009; Xie et al., 2015). However, the kinases responsible for some phosphorylation sites remain enigmatic.

The histone H3 family consists of various members, including “replicative” histones like H3.1/3.2 and histone variants such as H3.3. During DNA replication (S phase), H3.1/H3.2 are deposited onto newly replicated DNA in a coordinated manner (Ma et al., 2020; Talbert & Henikoff, 2021). In contrast, H3.3 is incorporated throughout the cell cycle (G1, S, and G2 phases) in a replication‐independent way. While H3.1 and H3.2 exhibit distinct distributions across different genomic regions, H3.3 preferentially accumulates in actively transcribed regions like promoters, enhancers, and gene bodies, as well as in telomeres and heterochromatic loci (Ahmad & Henikoff, 2002; Talbert & Henikoff, 2021).

Interestingly, H3.1 and H3.3 differ by only five amino acids. Notably, the sole difference in their N‐terminal tail is a single amino acid at position 31: serine in H3.3 and alanine in H3.1 (Elsaesser et al., 2010). This unique serine residue allows for a specific PTM in H3.3–Serine 31 phosphorylation (H3.3S31ph) (Hake et al., 2005). Recent studies have revealed the critical role of H3.3S31ph in regulating transcription. For instance, H3.3S31ph recruits the histone acetyltransferase p300, promoting an open and acetylated chromatin state at enhancers (Martire et al., 2019). Additionally, H3.3S31ph is reported to be crucial for transcription elongation, as it correlates with H3K36me3 on genes activated by external stimuli (Armache et al., 2020). Given the significant role of H3.3S31ph in transcription regulation, it would be intriguing to identify the kinase(s) responsible for its phosphorylation. Several kinases, including IKKα, Aurora B, and CHK1, have been proposed to phosphorylate H3.3S31 (Chang et al., 2015; Li et al., 2017; Thorne et al., 2012). However, their involvement seems to be cell type‐specific. For instance, IKKα phosphorylates H3.3S31 at inflammatory genes, while CHK1 targets H3.3S31 specifically in ALT cancer cells (Chang et al., 2015; Thorne et al., 2012). Aurora B, a key regulator of mitosis, appears to be a more general kinase for H3.3S31ph, although a direct interaction between them has not been established yet (Li et al., 2017). Additionally, inhibiting Aurora B doesn't completely abolish H3.3S31ph, suggesting the involvement of other kinases (Li et al., 2017). These findings suggest a more complex regulatory network for H3.3S31 phosphorylation, potentially involving multiple kinases.

Haspin is a kinase primarily known for phosphorylating histone H3 threonine 3 (H3T3) during mitosis (Dai et al., 2005). This phosphorylation event is crucial for accurate chromosome segregation (Wang et al., 2011). Interestingly, Haspin exhibits peak activity during mitosis, which coincides with the timing of H3.3S31ph expression. This temporal overlap provides Haspin with the opportunity to phosphorylate H3.3S31ph (Hake et al., 2005). Additionally, the known kinases responsible for H3T3ph and H3.3S31ph, Haspin and Aurora B, interact with each other. For example, Aurora B can phosphorylate Haspin, while H3T3ph recruits Aurora B to centromeres, where Aurora B participates in the full activation of Haspin (Wang et al., 2010, 2011). Based on these, we hypothesize that Haspin might be involved in H3.3S31 phosphorylation.

In this study, we focus on the potential role of Haspin in H3.3S31 phosphorylation. We employed various techniques, such as CRISPR/Cas9 mediated Haspin knockout, RNAi knockdown, and specific small molecule inhibitors to abrogate Haspin function in mouse embryonic stem cells (mESCs). Our data consistently revealed that Haspin depletion not only reduces H3T3ph, but also significantly diminishes H3.3S31ph levels. In vitro kinase assays further validated Haspin's capacity to contribute to H3.3S31ph. We then investigated the interplay between Haspin and Aurora B (Wang et al., 2012). Loss‐ and gain‐of‐function assays for both kinases in mESCs suggest that Haspin acts as a downstream mediator of Aurora B in H3.3S31 phosphorylation.

Taken together, this study sheds light on the potential regulatory mechanisms governing Haspin and H3.3S31 phosphorylation, offering novel insights into chromosome dynamics and transcriptional regulation during mitosis in mammalian cells.

2. MATERIALS AND METHODS

2.1. Cell cultures

Mouse embryonic stem cells (mESCs) were cultured in standard ES medium containing knockout‐DMEM, 10% Glutamax, 15% ESC grade fetal bovine serum (FBS), 10% penicillin/streptomycin, 1 × non‐essential amino acids, 50 μM β‐mercaptoethanol, 1 μM MEKi, 3 μM GSKi and LIF. HEK293 cells were cultured in Dulbecco's‐modified Eagle's medium (DMEM) supplemented with 10% FBS, 10% Glutamax, and 10% penicillin/streptomycin. All cells were maintained at 37°C with 5% CO2 in a humidified incubator. mESCs were passaged every 3 days.

2.2. Generation of Haspin KO using CRISPR/Cas9

Single‐guide RNA (sgRNA) was designed by Benchling (https://www.benchling.com/), which specifically recognized the upstream of the coding sequence (CDS) of haspin gene. The sgRNA sequence is 5′‐TTCTGTTTGAAACGCCGGGCGGG‐3′, and the sequence was cloned into the pX459 CRISPR vector to generate a gRNA‐pX459 vector. mESCs were seeded into a six‐well plate and gRNA‐pX459 (2.5 μg) was transfected into 1 × 105 cells by lipofectamine 2000. One microgram per milliliter of puromycin was applied for Haspin KO clone's selection. After almost all wild type cells were killed, single cells were transferred to a 96‐well plate by manually selecting. Half of sub‐confluent cells were applied to genome extraction and the rest was kept on culturing. Genotyping polymerase chain reaction (PCR) of individual clones was performed and deletion fragments were identified by Sanger sequencing.

2.3. Plasmid construction

Haspin and Aurora B overexpression vectors were constructed by cloning CDS of Haspin and Aurora B in cDNA of mESCs, following by RFP sequence into the pCAG‐Cre vector. RFP overexpression vectors were constructed by cloning RFP sequence into pCAG‐Cre. The inserted sequences replaced original Cre sequence. The utilized primers in the study are shown in Table S1.

2.4. Antibodies, inhibitors, proteins and peptides

Primary antibodies used were as follows: Rabbit anti‐H3.3S31ph (ab92628, Abcam, 1:1000), Rabbit anti‐H3T3ph (ab272139, Abcam,1;1000), Rabbit anti‐H3T3ph (07–424, Millipore, 1:1000), Mouse anti‐H3S10ph (ab14955, Abcam, 1:1000), GAPDH (HRP‐6004, Proteintech, 1:5000), Rabbit anti‐H3 (ab176842, 1:1000), and Mouse anti‐6xHis (ab18184, 1:1000). Secondary antibodies for immunofluorescence were donkey anti‐rabbit Alexa 488 (1:1000), donkey anti‐mouse Alexa 555 (1:1000), donkey anti‐mouse Alexa 647 (1:1000); Secondary antibodies for western blots were goat anti‐rabbit HRP (1:3000) or goat anti‐mouse HRP (1:3000). Haspin inhibitor was CHR‐6494 (MCE, No.1333377‐65‐3t). Aurora B inhibitor was AZD‐1152 (Selleck, No. S1147). Haspin kinase domain protein was a gift from Dr. Peiqiang Mu. Recombinant Aurora B protein was purchased from Abcam (ab51435), Histone H3.3 from Sigma (H2542). Peptides were synthesized by GenScript company. Peptides of H3.3 protein sequences were following:

  • 1‐25AA peptide was ARTKQTARKSTGGKAPRKQLATKAA,

  • 1‐25AA T3A peptide was ARAKQTARKSTGGKAPRKQLATKAA,

  • 19‐43AA peptide was QLATKAARKSAPSTGGVKKPHRYRP,

  • 19‐43AA S31A peptide was QLATKAARKSAPATGGVKKPHRYRP.

2.5. siRNA depletion of Haspin

siRNA oligonucleotide specific against Haspin was synthesized by Guangzhou RiboBio (www.ribobio.com). The siRNA oligonucleotide target sequences are listed in Table S2. And it was transfected into cells by Lipofectamine 2000 (Gibco). After 48 h post‐transfected, cells were collected for analysis.

2.6. Haspin and Aurora B inhibition

Cells were cultured in a six‐well plate and CHR‐6494 or AZD‐1152 with different concentrations were added into the culture medium.

2.7. Immunofluorescence

Cells were plated onto glass bottom dish for immunofluorescence analysis. Samples were fixed with 4% paraformaldehyde (PFA) at room temperature for 30 min and washed with PBS three times. 0.5% PBST (PBS, 0.5% Triton‐X, 0.1% Tween‐20) was used for permeabilization for 15 min and washed with PBS three times. Then incubated in 5% BSA blocking solution diluted with PBST for 1 h and primary antibodies were applied according to the manufacturing recommendations at 4°C overnight. Secondary antibodies were incubated at room temperature for 2 h and nucleus was stained with Hoechst 33342 (Thermo Fisher).

2.8. Reverse transcription and quantitative polymerase chain reaction analysis

Cells cultured in six‐well plates were collected for total RNA extraction by Trizol (Invitrogen) and generated cDNA by reverse transcription kit (Takara). Cycling parameters were 95°C 2 min denaturation, 95°C 5 s, 60°C 30 s for 40 cycles. GADPH was used as internal controls and expression levels changes were calculated based on the manufacturer's instructions. The quantitative real‐time PCR (qRT‐PCR) primers we used were shown in Table S3.

2.9. Western blots

Cells were treated with 2.5 μM nocodazole for 12 h before harvest. Cold RIPA buffer (150 mM NaCl, 50 mM Tris–HCl at pH 7.4, 1% sodium deoxycholate, 1% Triton X‐100, sodium orthovanadate, and protease inhibitor) was used for cell lysis and followed by 1 min vortex. The lysis supernatant was collected after 20 min centrifugation at 12, 000 rpm and boiled in 6× loading SDS sample buffer at 95°C for 10 min and run on a 15% SDS‐PAGE gel. Proteins were transferred into PVDF membranes and membranes were blocked in tris‐buffered saline (TBS) containing 0.5% BSA and 0.05% Tween‐20 at room temperature. Membranes were incubated with primary antibodies overnight at 4°C. After removing primary antibodies, membranes were washed in TBS containing 0.05% Tween‐20 followed by incubating for an additional hour in secondary antibody. Intensities of protein bands were quantitated using the Image J Software. Relative protein levels were expressed as a ratio relative to the loading control.

2.10. In vitro kinase phosphorylation assay

For phosphorylation of H3T3, H3.3S31, 0.5 μg substrates were incubated with 0.2 μg recombinant Haspin protein. The kinase reactions were conducted in 50 μL kinase reaction buffer (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 10 mM MgCl2) with 0.2 mM ATP for 40 min at 37°C. The reactions were terminated with SDS sample buffer, boiled at 95°C for 5 min. We finally analyzed the results by western blotting.

2.11. Lambda protein phosphatase (λ‐PP) treatment

Cells were cultured in glass bottom dish and fixed with 4% PFA in PBS for 20 min followed by permeabilized with 0.5% Triton X‐100 in PBS for 30 min at room temperature. Lambda Protein Phosphatase (λ‐PP) treatment was performed in a 50 μL reaction system containing 1 × NEBuffer Pack Protein Metallo Phosphatases (PMP), 1 mM MnCl2, 1 μL of λ‐PP. Samples were incubated at 30°C for 4 h. Then heat at 65°C for 1 hour to inactivate λ‐PP under the presence of 50 mM Na2EDTA. After washed by PBS three times, 0.2 μg recombinant Haspin or Aurora B protein was added into a kinase reaction which was conducted in 50 μL kinase reaction buffer (250 mM HEPES pH 7.5, 5 mM EGTA, 50 mM MgCl2, and 0.05% Brij‐35) with 1 mM ATP for 40 min at 37°C. After blocking in permeabilized buffer containing 5% BSA, primary and secondary antibodies were diluted in blocking buffer and incubated at 4°C for 12 h or room temperature for 2 h, respectively. DNA was stained for 10 min with Hoechst 33342.

2.12. Microscope and image processing

Fixed cell images were collected using the Zeiss LSM 880 Multiphoton confocal microscope with a 63x oil immersion objective and Olympus FV3000 inverted LSCM with a 60x oil objective. Image analyses were processed with Image J.

2.13. ADP‐Glo™ assay

The synthesized peptides and Haspin/Aurora B protein were incubated on ice. The 25 μL kinase reaction system containing peptides, ATP, Haspin/Aurora B protein and 1× kinase reaction buffer with and without CHR‐6494/AZD‐1152 was performed in a PCR tube at 37°C for 45 min. After finished, 25 μL reaction product was transferred into the 96‐well plate. Firstly, 25 μL ADP‐Glo™ reagent was added to terminate the reaction and incubated at room temperature for 40 min to deplete unconsumed ATP. Secondly, to transfer ADP to ATP, 50 μL kinase detection reagent was added then newly synthesized ATP could be measured by the luciferase reaction. After incubating at room temperature for 40 min, the kinase detection reaction was terminated, and the illuminance signal could be detected. We also prepared a standard curve to calculate the consumption rate of ATP. Each set was performed in triplicate.

3. RESULTS

3.1. Haspin knockout results in a decrease in H3.3S31 phosphorylation in mESCs

Histone H3 contains several serine/threonine residues that are phosphorylated during mitosis (such as threonine 3 and serine 10) (Polioudaki et al., 2004; Wei et al., 1998; Wei et al., 1999). Notably, H3.3 differs from H3.1/H3.2 at position 31, where H3.3 has serine and H3.1/H3.2 have alanine (Figure 1a). Previous studies identified Haspin as a histone H3 kinase in vitro, with Thr‐3 as its well‐known substrate (Dai et al., 2005). H3.3S31 phosphorylation occurs specifically during late prometaphase and metaphase, absent in anaphase (Hake et al., 2005). This specific mitotic pattern to some extent resembles the temporal pattern of H3T3 phosphorylation (Polioudaki et al., 2004), suggesting that Haspin could potentially be involved in the phosphorylation process of H3.3S31. To investigate these mitotic phosphorylation events, we enriched mitotic cells in wild type (WT) mESCs using nocodazole treatment (Blajeski et al., 2002). Compared to untreated mESCs, nocodazole increased the proportion of mitotic cells (Figure S1a,b), resulted in the enrichment of H3T3ph, H3.3S31ph, and H3S10ph (Figure S1a,c). To test our hypothesis regarding Haspin's role in H3.3S31 phosphorylation, we employed CRISPR/Cas9‐mediated Haspin knockout in mESCs. The gRNA sequence was designed to target the 5′ end of haspin upstream of the start codon. PCR analysis with single cell derived colonies confirmed the successful different deleted sequence of Haspin in two separate cell lines (HKO1 and HKO2) (Figure 1b). We then evaluated the efficiency of Haspin knockout using qRT‐PCR and western blotting. Due to the lack of commercial Haspin antibodies for mouse, we detected H3T3ph as an indicator of Haspin protein levels. Both qRT‐PCR and western blotting revealed a significant reduction in Haspin transcripts and H3T3ph levels in Haspin‐KO mESCs (Figure 1c,d), confirming functional elimination of Haspin. Consistently, immunofluorescence staining further demonstrated a marked decrease in H3T3ph in both HKO1 and HKO2 cells (Figure S1d,e), whereas H3S10ph signal, a Haspin‐independent event, remained largely unaffected (Figure S1d,f).

FIGURE 1.

FIGURE 1

Open in a new tab

Haspin KO attenuates H3.3S31 phosphorylation in mESCs. (a) Representative sequences of mammalian H3.1, H3.2, and H3.3. (b) Schematic of CRISPR‐Cas9‐mediated Haspin KO in the mESC genome and PCR shows different fragments were deleted, thus two Haspin KO cell lines (HKO1 and HKO2) were obtained. (c) The expression level of Haspin in the two Haspin KO cell lines is detected by qRT‐PCR. (d) Western blotting indicates H3T3ph is depleted in Haspin‐KO cells, while the H3S10ph level does not change, using H3 as control. (e) H3.3S31ph immunostaining in wild‐type ESCs and Haspin‐KO cells shows the H3.3S31ph level decreases significantly at mitosis, while the H3S10ph level does not change. (f and g) Immunofluorescence quantifications of fluorescence intensity of H3.3S31ph and H3S10ph levels from E. (h) Western blotting indicates H3.3S31ph decreases in Haspin‐KO cells. (i) Bar charts show the Western blot quantification of H3.3S31ph protein levels from h, which was normalized to the level of histone H3. Over 30 cells were counted in each immunostaining experiment. The values in (c, f, g, and i) are presented as **p < 0.01, ***p < 0.001, ****p < 0.0001, using a two‐sided t‐test; data represent mean ± SEM; ns, not significant. Scale bars: 5 μm.

We subsequently examined H3.3S31ph levels in Haspin‐KO cells. Intriguingly, both western blots and immunofluorescence analyses revealed a significant reduction in H3.3S31ph, particularly in prometaphase and metaphase cells (Figure 1e–i). Notably, the reduction was substantial but not complete. Conversely, H3S10ph remained unaffected (Figure 1d–g). To validate these findings, we employed Haspin siRNA in 293T cells (Figure S2). Similarly, Haspin knockdown resulted in decreased H3T3ph levels without affecting H3S10ph (Figure S2b–d), which aligns with previous reports (Dai et al., 2005; Wang et al., 2021). Additionally, H3.3S31ph levels significantly decreased in Haspin siRNA treated‐293T cells, further supporting the role of Haspin in H3.3S31 phosphorylation (Figure S2e–g).

In summary, these data from both Haspin knockout and knockdown experiments in mammalian cells demonstrate that Haspin contributes to H3.3S31 phosphorylation during mitosis.

3.2. Haspin kinase activity is essential for H3.3S31 phosphorylation

Haspin is a Ser/Thr kinase responsible for the phosphorylation of histone H3T3. The N‐terminal region (amino acids 1–469) of Haspin, whose sequence possesses low complexity, is unlikely to fold as a functional domain while the kinase domain (amino acids 470–798) can bind to nucleosomes with high affinity (Villa et al., 2009). In addition, the structure of the kinase domain exhibits an active conformation that facilitates substrate recognition and phosphorylation in the absence of external regulators (Eswaran et al., 2009; Villa et al., 2009). During interphase, Haspin activity is restricted by its autoinhibitory segment (Haspin basic inhibitory segment, HBIS). Upon entering mitosis, Cdk1 and Plk1 sequentially phosphorylate the N‐terminus of Haspin, relieving this inhibition (Ghenoiu et al., 2013).

Compound CHR‐6494, a specific small molecule inhibitor for Haspin (Huertas et al., 2012), was employed to investigate the role of Haspin's enzymatic function in H3.3S31 phosphorylation; 293T cells were treated with increasing concentrations of CHR‐6494 (0.01 μM, 0.05 μM, and 0.1 μM). Immunofluorescence assays revealed a dose‐dependent decrease in both H3T3ph and H3.3S31ph levels (Figure 2; Figure S3). Notably, 0.1 μM CHR‐6494 completely abolished H3T3ph (Figure S3a,b) and caused a 50% reduction in H3.3S31ph (Figure 2a,b). As a control, H3S10ph remained unaffected (Figure 2a,c; Figure S3a,c). These results demonstrate a link between Haspin kinase activity and H3.3S31 phosphorylation in both 293T cells and mESCs, suggesting Haspin's contribution to this process during mitosis.

FIGURE 2.

FIGURE 2

Open in a new tab

Haspin kinase domain contributes to H3.3S31 phosphorylation. (a) Immunostaining of H3.3S31ph and H3S10ph in 293T cells shows a significant decrease in H3.3S31ph with varying concentrations of Haspin inhibitor CHR‐6494 treatment for 48 h. (b and c) The level of H3.3S31ph in mitotic cells treated with CHR‐6494 is dose‐dependent, while the H3S10ph level does not change. Over 30 cells were counted in each immunostaining experiment. The values in (b) and (c) are presented as **p < 0.01, ***p < 0.001, ****p < 0.0001, using a two‐sided t‐test; data represent mean ± SEM; ns, no significance. Scale bars: 5 μm.

3.3. Haspin mediates H3.3S31 phosphorylation in vitro

To gain deeper insight into Haspin's potential contribution to H3.3S31 phosphorylation, we refined an in vitro kinase assay system. Firstly, we utilized non‐specific lambda protein phosphatase (λ‐PP) to effectively remove most phosphate groups from histones in fixed mESCs. Subsequently, after thoroughly washing, we inactivated λ‐PP and introduced recombinant Haspin protein to examine its ability to restore specific phosphorylation events. To evaluate the efficacy of this system, we utilized H3T3ph and H3S10ph immunofluorescence on mitotic chromosomes as an indicator. As anticipated, both H3T3ph and H3S10ph were significantly diminished following treatment with λ‐PP (+PP) (Figure S4a–c). After incubation with Haspin, H3T3ph was fully restored in these cells, while H3S10ph was not (+PP/+H) (Figure S4a–c). Interestingly, interphase chromosomes were also positive for H3T3ph (+PP/+H) (Fresán et al., 2020), suggesting that a substantial amount of active Haspin kinase has undergone reaction (Figure S4a). To rule out false positive phosphorylation signals that could arise from non‐specific reactions by the recombinant Haspin, we introduced CHR‐6494 at a 1 μM concentration to distinguish authentic signals. As expected, H3T3ph signals in mitotic cells were significantly diminished following the administration of CHR‐6494 (+PP/+H/+CHR) (Figure S4a,b), confirming that our assay specifically detects Haspin activity. This established in vitro system allowed us to investigate whether Haspin contributes to the phosphorylation of H3.3S31.

With aforementioned system, we further explored whether H3.3S31ph could be reinstated via the incubation of recombinant Haspin or Aurora B, as previous reports have indicated that Aurora B is capable of phosphorylating H3.3S31 (Li et al., 2017). Interestingly, recombinant Haspin could partially restored the signals of H3.3S31ph with a recovery ratio of approximately 25%, while CHR‐6494 was able to suppress this recovery (Figure 3a–c). And recombinant Aurora B partially restored H3.3S31ph and H3S10ph signals (~50%) and these recoveries were inhibited by Barasertib (AZD‐1152) at 1 μM, a specific small molecular inhibitor for Aurora B (Figure 3d–f) (Wilkinson et al., 2007). Our results are consistent with previous findings that Aurora B is responsible for H3.3S31ph (Li et al., 2017). Notably, Aurora B did not restore H3T3 phosphorylation (Figure S4d–f). Western blot analysis using recombinant H3.3 as a substrate confirmed that Haspin mediated the phosphorylation of both T3 and S31 residues, and again these kinase reactions could be inhibited by CHR‐6494 (Figure 3g).

FIGURE 3.

FIGURE 3

Open in a new tab

Haspin kinase domain facilitates H3.3S31 phosphorylation in vitro. (a, b, and c) H3S10ph and H3.3S31ph immunostaining and corresponding quantification in mitotic mESCs treated by λ‐PP and rescued by Haspin kinase domain with or without CHR‐6494 treatment. H3.3S31ph can be rescued by Haspin kinase domain while H3S10ph cannot be rescued. (d, e, and f) H3S10ph and H3.3S31ph immunostaining and corresponding quantification in mitotic mESCs treated by λ‐PP and rescued by Aurora B with or without AZD‐1152 treatment. The immunostaining results show that H3S10ph and H3.3S31ph can be rescued by Aurora B. (g) Western blotting of H3T3ph and H3.3S31ph indicates Hapsin kinase domain can phosphorylate H3.3S31 and H3T3 when incubating with H3.3 recombinant protein and CHR‐6494 suppresses the activity of Haspin kinase domain. His‐Haspin and H3 were detected to indicate the quantities of components in the reaction system. (h, i, and j) ADP‐Glo™ Kinase Assay detected the percentage of ATP consumption (%) in the incubation of different peptides of H3.3 with Haspin kinase domain at different time points. The results indicate that peptides with serine 31 site can be phosphorylated by Haspin kinase domain and CHR‐6494 can suppress the effects. Over 30 cells were counted in each immunostaining experiment. The values in (b, c, e, and f) are presented as **p < 0.01, ***p < 0.001, ****p < 0.0001, using a two‐sided t‐test; data represent mean ± SEM; ns, no significance. Scale bars: 5 μm.

Given that the kinetic reaction between Haspin and histone substrates depletes ATP (Eswaran et al., 2009), we devised an ADP‐Glo™ kinase assay to further verify the enzyme‐substrate relationship between Haspin and H3.3S31ph. Synthetic histone tail peptides, including 1‐25AA (containing T3) and 19‐43AA (containing S31), were used as substrates (purple line) (Figure 3h). As expected, a highly efficient consumption of ATP was observed in peptide 1‐25AA in a time‐dependent manner, with the percentage of ATP consumption exceeding 98% (Figure 3i). And this ATP consumption could be inhibited completely with the treatment of CHR‐6494 at 1 μM (Figure 3i). In line with these observations, peptide 19‐43AA showed a gradual increase in the percentage of ATP consumption, and this kinetic reaction could be significantly reduced by CHR‐6494 as well (Figure 3j). Notably, CHR‐6494 did not appreciably inhibit Aurora B at a 1 μM concentration, and AZD‐1152 at the same concentration did not inhibit Haspin (Figure S4g,h). Moreover, mutated peptides containing T3A (1‐25AA T3A) and S31A (19‐43AA S31A) abolished signals, confirming the specificity of the proposed phosphorylation sites (T3 and S31) (Figure S4i,j).

Collectively, these results provide compelling evidence for Haspin's potential to phosphorylate H3.3S31 in vitro. While both T3 and S31 can be targeted by Haspin, the T3 site shows higher efficiency.

3.4. Haspin phosphorylates H3.3S31 independently of Aurora B in mESCs

Our findings indicate that Haspin is involved in the phosphorylation of H3.3S31 phosphorylation, and previous studies proposed that H3.3S31 is a phosphorylation site of Aurora B (Li et al., 2017). Besides, Aurora B‐H3T3ph loop helps to facilitate the full activation of Haspin (Zhou et al., 2014). To dissect the interplay between Haspin and Aurora B, we perturbated Aurora B activity by AZD‐1152 (Wilkinson et al., 2007). Since H3S10 phosphorylation is a known Aurora‐B target (Crosio et al., 2002; Giet & Glover, 2001; Hsu et al., 2000), AZD‐1152 treatment (0.5 μM) completely abolished H3S10ph signals on mitotic chromosomes (Figure S5a,c). Interestingly, AZD‐1152 also significantly reduced H3.3S31ph by 90% (Figure S5a,b).

To further examine whether Haspin could independently restore H3.3S31ph in Aurora B‐inhibited cells, we overexpressed (OE) Haspin in mESCs after AZD‐1152 (0.5 μM) treatment (Figure 4a). Aurora B‐OE and RFP‐OE served as positive and negative controls, respectively. Aurora B‐OE effectively increased H3S10ph in WT cells, confirming its functionality (Figure S5d). Interestingly, both Haspin and Aurora B are primarily localized at centromeric regions, but are also spotted on chromatid arms during mitosis, consistent with previous studies (Figure 4c) (Broad & DeLuca, 2020; Soupsana et al., 2021). Intriguingly, in AZD‐1152‐treated mESCs, although H3.3S31ph and H3S10ph were completely diminished (Figure 4b), overexpression of either Aurora B or Haspin rescued H3.3S31ph levels, while RFP‐OE did not (Figure 4c,d). Notably, H3S10ph, product of Aurora B, was not recoverable by Haspin‐OE in mitotic cells but was successfully restored by Aurora B‐OE (Figure 4c,e). Also, H3T3ph was affected by AZD‐1152 treatment (Figure S5e), aligning with previous reports (Ghenoiu et al., 2013). These reinforce the specific kinase targets of each enzyme. Western blot analysis also corroborated the findings from immunofluorescence, demonstrating rescue of H3.3S31ph by both Haspin and Aurora B overexpression in Aurora B‐inhibited cells (Figure 4f).

FIGURE 4.

FIGURE 4

Open in a new tab

Both Aurora B and Haspin can rescue H3.3S31 phosphorylation in Aurora B completely inhibited mESCs. (a) Timeline of AZD treatment, Haspin/Aurora B/RFP overexpression, immunostaining, and imaging. (b) Immunostaining of H3.3S31ph and H3S10ph in WT and Aurora B completely inhibited mESCs. (c) Immunostaining of H3.3S31ph and H3S10ph in Aurora B completely inhibited mESCs with overexpression of Haspin‐RFP, Aurora B‐RFP or RFP in cells. (d and e) Quantitative analysis from (b) and (c) indicates H3.3S31ph expression level is rescued by Haspin‐OE and Aurora B‐OE mESCs, while H3S10ph expression level is only rescued by Aurora B‐OE mESCs. (f) Western blotting analysis of H3.3S31ph, H3S10ph, H3T3ph in Aurora B completely inhibited mESCs with/without Haspin (WT + AZD + HOE)‐, Aurora B (WT + AZD + AOE)‐, and RFP (WT + AZD + ROE)‐overexpression. Using GAPDH level as control. Over 30 cells were counted in each immunostaining experiment. The values in (d) and (e) are presented as **p < 0.01, ***p < 0.001, ****p < 0.0001, using a two‐sided t‐test; data represent mean ± SEM; ns, no significance. Scale bars: 5 μm.

In conclusion, these findings reveal that Haspin can independently phosphorylate H3.3S31 in mESCs, even when Aurora B activity is inhibited.

3.5. Haspin phosphorylates H3.3S31 downstream of Aurora B

Having established that both Haspin and Aurora B can mediate H3.3S31 phosphorylation, we further investigated the potential hierarchy between these kinases for H3.3S31 phosphorylation. To this end, we examined the rescue effects of ectopic overexpression of Haspin and Aurora B in Haspin‐depleted HKO1 cells.

Firstly, we used H3T3ph as a readout to evaluate the efficacy of Haspin‐OE and Aurora B‐OE in HKO1 cells. As expected, mitotic cells, including those in prometaphase and metaphase cells, regained H3T3ph signals after Haspin‐OE (Figure S6a,c). Notably, Haspin‐OE also increased H3T3ph level in interphase cells, suggesting potential Haspin hyperactivity in these cells (Figure S6a,b). Conversely, Aurora B‐OE could not rescue H3T3ph signals in either mitotic or interphasic HKO1 cells (Figure S6), aligning with previous reports that Aurora B does not affect H3T3 phosphorylation (Dai et al., 2005; Ghenoiu et al., 2013).

Given these experimental conditions, we carried out a more comprehensive analysis of H3.3S31ph. Interestingly, Haspin‐OE significantly restored H3.3S31ph, whereas Aurora B‐OE did not compensate for the loss of H3.3S31ph in mitotic HKO1 cells. This suggests that Aurora B couldn't phosphorylate H3.3S31 when Haspin was absent (Figure 5a,c,d). It's noteworthy that Haspin‐OE enhanced H3.3S31ph signal in mitotic WT mESCs (Figure 5b–d). These findings further demonstrated that Haspin plays a role in regulating H3.3S31ph.

FIGURE 5.

FIGURE 5

Open in a new tab

Haspin mediates H3.3S31 phosphorylation downstream of Aurora B kinase. (a and b) Immunostaining of H3.3S31ph and H3S10ph in WT and HKO1 mESCs with or without Haspin‐ and Aurora B‐OE. (c) Quantification of fluorescence intensity indicates H3.3S31ph expression level is rescued by Haspin‐OE rather than Aurora B‐OE. (d) Western blotting analysis of H3.3S31ph, H3S10ph, H3T3ph in WT and HKO1 mESCs with overexpression of Haspin‐RFP, Aurora B‐RFP, and RFP. Over 30 cells were counted in each immunostaining experiment. The values in (c) are presented as **p < 0.01, ***p < 0.001, ****p < 0.0001, using a two‐sided t‐test; data represent mean ± SEM; ns, no significance. Scale bars: 5 μm.

Together, these findings indicate that Haspin can compensate for the loss of Aurora B and restore H3.3S31ph independently. However, in the absence of Haspin, Aurora B is unable to phosphorylate H3.3S31 on its own, indicating that Haspin functions downstream of Aurora B.

Based on these results, we propose a model for the H3.3S31 phosphorylation pathway, where Haspin participates in phosphorylating H3.3S31, potentially acting downstream of Aurora B (Figure 6). Notably, Haspin knockout only partially reduced H3.3S31ph levels, suggesting the involvement of additional kinases in this process.

FIGURE 6.

FIGURE 6

Open in a new tab

A model of Haspin activity and its role in H3.3S31 phosphorylation pathway. During interphase, the presence of HBIS leads to Haspin inactivity. In contrast, during mitosis, Cdk1, Plk1, and Aurora B sequentially phosphorylate numerous sites on Haspin, resulting in its activation (denoted by a purple solid arrow). Upon activation, Haspin acquires the ability to phosphorylate H3T3 (indicated by a gray solid arrow). Our research reveals that Haspin can also participate in the phosphorylation of H3.3S31, a non‐classical substrate (shown by a black solid arrow). Furthermore, it appears that Haspin functions downstream of Aurora B. Additionally, based on prior studies and our findings, we propose that other kinases are likely implicated in the phosphorylation of H3.3S31 (represented by a dotted arrow).

4. DISCUSSION

Understanding the intricate interplay between enzymes and their substrates is essential for deciphering the molecular mechanisms underlying various biological processes. This is particularly true for Histone PTMs like phosphorylation, which critically orchestrate chromatin structure and function (Kouzarides, 2007; Mersfelder & Parthun, 2006).

H3.3 and its N‐terminal serine 31 phosphorylation have emerged as potential players in various cellular functions linked to mitosis, transcription regulation, and DNA damage protection (Armache et al., 2020; Hake et al., 2005; Martire et al., 2019; Rossetto et al., 2012). While kinases such as IKKα, Aurora B, and CHK1, have been implicated in H3.3S31 phosphorylation in different cell types, further research is needed to identify general kinase(s) responsible in mammalian cells (Chang et al., 2015; Li et al., 2017; Thorne et al., 2012).

H3T3ph is important for recruiting the Chromosomal Passenger Complex (CPC) to mitotic chromatids and regulate downstream kinetochore function (Kelly et al., 2010). The specifically temporal patterns of H3T3ph, mediated by Haspin, and H3.3S31ph in mitosis indicate Haspin as a potential candidate kinase for H3.3S31ph (Hake et al., 2005; Polioudaki et al., 2004). Our data from several lines of evidence support this hypothesis, demonstrating that Haspin contributes to H3.3S31 phosphorylation in mammalian cells.

To validate the kinase‐substrate relationship of Haspin and H3.3S31ph, we utilized specific Haspin inhibitors and in vitro kinase assays. Specifically, Haspin was able to reestablish H3.3S31ph independently after λ‐PP removed all phosphorylation modifications within the fixed cells. The ADP‐Glo™ assay results further showed a significant decrease in the percentage of ATP consumption for S31A peptide compared to the WT peptide, highlighting the specific role of Haspin in H3.3S31 phosphorylation. Interestingly, the kinase site prediction tool developed by Cantley Lab suggests that Haspin preferentially phosphorylates threonine residues (Johnson et al., 2023). This prediction is consistent with the data from ADP‐Glo™ assay, where synthetic 1‐25AA peptide (including T3) exhibited a significant higher percentage of ATP consumption compared to 19‐43AA peptide (including S31).

Aurora B has been previously linked to H3.3S31 phosphorylation (Li et al., 2017). Additionally, the known crosstalk between Haspin and Aurora B depicted that Aurora B assists Haspin to undergo a full phosphorylation, while H3T3ph, production of Haspin, aids Aurora B to deposit at centromeres (Wang et al., 2011; Yu et al., 2017). Given that, we further dissect the interplay between Haspin and Aurora B in the process of H3.3S31 phosphorylation.

Loss‐ and gain‐of‐function analyses of Haspin and Aurora B suggest a hierarchical relationship, with Haspin acting downstream of Aurora B in H3.3S31 phosphorylation. Specifically, Aurora B inhibitor AZD‐1152 resulted in a rapid decrease in H3.3S31ph in cells, highlighting its crucial role. However, in Haspin knockout cells, Haspin‐OE could rescue the loss of H3.3S31ph whereas Aurora B‐OE could not. Interestingly, both Haspin‐OE and Aurora B‐OE rescued the loss of H3.3S31ph in Aurora B‐inhibited mESCs. These findings suggest that Haspin acts as an intermediate mediator in the Aurora B‐mediated phosphorylation of H3.3S31 and Haspin contributes to the H3.3S31ph. Nevertheless, Haspin‐depletion did not lead to a complete removal of H3.3S31ph. Thus, we propose that H3.3S31 phosphorylation is likely to be regulated by multiple signaling pathways, with each pathway contributing to specific phosphorylation events. Based on these findings, we propose a model where Haspin acts as a downstream mediator of Aurora B in phosphorylating H3.3S31 (Figure 6).

This study opens exciting avenues for future investigation. First, the mechanism by which mitosis‐specific H3.3S31ph contributes to interphase transcriptional regulation remains elusive. Future studies should determine if this mark is passively inherited during mitosis or established through distinct pathways (Armache et al., 2020; Martire et al., 2019). Second, since both Haspin and H3T3ph are involved in the asymmetric cell division (ACD) (Gao et al., 2023; Xie et al., 2015), it is crucial to explore a potential role for H3.3S31ph in ACD. Third, given that both H3T3ph and H3.3S31ph are products of Haspin, and the ADP‐Glo™ assay suggests a difference in kinase activity between H3T3 and H3.3S31. Future studies should investigate the potential competition (or synergy) between these modifications. Besides, it is also intriguing to explore their interactions with other histone modifications, which could provide insights into their impact on chromatin dynamics and functions (Lee et al., 2010). Finally, the incomplete elimination of H3.3S31ph on the mitotic chromatids upon Haspin or Aurora B inhabitation suggests the involvement of additional kinases. Identifying these additional players will provide a more comprehensive picture of H3.3S31ph regulation and potentially lead to novel therapeutic targets.

This work sheds light on Haspin's crucial role in H3.3S31 phosphorylation and paves the way for further exploration of its intricate functions in chromosome dynamics and transcriptional regulation in mammals.

AUTHOR CONTRIBUTIONS

Yuanyuan Li: Writing – review and editing; conceptualization; investigation; methodology; data curation; formal analysis; validation; writing – original draft; visualization. Meixian Wu: Conceptualization; methodology; investigation; validation; data curation; formal analysis; visualization; writing – original draft. Yang Liu: Methodology; validation; data curation; formal analysis; writing – review and editing; investigation; visualization. Lihua Sun: Supervision; investigation; data curation. Peiqiang Mu: Data curation; supervision; investigation. Binbin Ma: Writing – original draft; project administration; conceptualization; writing – review and editing; supervision. Jing Xie: Supervision; resources; writing – review and editing; funding acquisition; project administration; writing – original draft.

CONFLICT OF INTEREST STATEMENT

The authors have declared that no competing interest exists.

Supporting information

Data S1. Supporting Information.

PRO-33-e5126-s001.docx (3.1MB, docx)

ACKNOWLEDGMENTS

We are grateful to Dr. Xin Chen (Howard Hughes Medical Institute, Department of biology, The Johns Hopkins University) for insightful discussions and support. We also thank Dr. Yihan Wan (School of Life Sciences, West Lake University) for her kind suggestions. This work was supported by the National Key Research and Development Program of China (2018YFA0800100) and the National Natural Science Foundation of China (32170800 and 31871490). It is also supported by the Fundamental Research Funds for the Central Universities.

Li Y, Wu M, Liu Y, Sun L, Mu P, Ma B, et al. Haspin mediates H3.3S31 phosphorylation downstream of Aurora B in mouse embryonic stem cells. Protein Science. 2024;33(8):e5126. 10.1002/pro.5126

Review Editor: John Kuriyan

Contributor Information

Binbin Ma, Email: bma13@jhu.edu.

Jing Xie, Email: jingxie@tongji.edu.cn.

REFERENCES

  1. Ahmad K, Henikoff S. The histone variant H3.3 marks active chromatin by replication‐independent nucleosome assembly. Mol Cell. 2002;9:1191–1200. [DOI] [PubMed] [Google Scholar]
  2. Armache A, Yang S, de Paz AM, Robbins LE, Durmaz C, Cheong JQ, et al. Histone H3.3 phosphorylation amplifies stimulation‐induced transcription. Nature. 2020;583:852–857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blajeski AL, Phan VA, Kottke TJ, Kaufmann SH. G1 and G2 cell‐cycle arrest following microtubule depolymerization in human breast cancer cells. J Clin Invest. 2002;110:91–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Broad AJ, DeLuca JG. The right place at the right time: Aurora B kinase localization to centromeres and kinetochores. Essays Biochem. 2020;64:299–311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang FTM, Chan FL, McGhie JDR, Udugama M, Mayne L, Collas P, et al. CHK1‐driven histone H3.3 serine 31 phosphorylation is important for chromatin maintenance and cell survival in human ALT cancer cells. Nucleic Acids Res. 2015;43:2603–2614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Crosio C, Fimia GM, Loury R, Kimura M, Okano Y, Zhou HY, et al. Mitotic phosphorylation of histone H3: spatio‐temporal regulation by mammalian aurora kinases. Mol Cell Biol. 2002;22:874–885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dai J, Sultan S, Taylor SS, Higgins JMG. The kinase haspin is required for mitotic histone H3 Thr 3 phosphorylation and normal metaphase chromosome alignment. Gene Dev. 2005;19:472–488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Elsaesser SJ, Goldberg AD, Allis CD. New functions for an old variant: no substitute for histone H3.3. Curr Opin Genet Dev. 2010;20:110–117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eswaran J, Patnaik D, Filippakopoulos P, Wang FW, Stein RL, Murray JW, et al. Structure and functional characterization of the atypical human kinase haspin. Proc Natl Acad Sci USA. 2009;106:20198–20203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fresán U, Rodríguez‐Sánchez MA, Reina O, Corces VG, Espinàs ML. Haspin kinase modulates nuclear architecture and polycomb‐dependent gene silencing. PLoS Genet. 2020;16:e1008962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gao YY, Ma B, Li YF, Wu XY, Zhao SF, Guo HP, et al. Haspin balances the ratio of asymmetric cell division through Wnt5a and regulates cell fate decisions in mouse embryonic stem cells. Cell Death Discov. 2023;9:307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ghenoiu C, Wheelock MS, Funabiki H. Autoinhibition and polo‐dependent multisite phosphorylation restrict activity of the histone H3 kinase Haspin to mitosis. Mol Cell. 2013;52:734–745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giet R, Glover DM. Aurora B kinase is required for histone H3 phosphorylation and condensin recruitment during chromosome condensation and to organize the central spindle during cytokinesis. J Cell Biol. 2001;152:669–681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hake SB, Garcia BA, Kauer M, Baker SP, Shabanowitz J, Hunt DF, et al. Serine 31 phosphorylation of histone variant H3.3 is specific to regions bordering centromeres in metaphase chromosomes. Proc Natl Acad Sci USA. 2005;102:6344–6349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hans F, Dimitrov S. Histone H3 phosphorylation and cell division. Oncogene. 2001;20:3021–3027. [DOI] [PubMed] [Google Scholar]
  16. Hsu JY, Sun ZW, Li XM, Reuben M, Tatchell K, Bishop DK, et al. Mitotic phosphorylation of histone H3 is governed by IpI1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell. 2000;102:279–291. [DOI] [PubMed] [Google Scholar]
  17. Huertas D, Soler M, Moreto J, Villanueva A, Martinez A, Vidal A, et al. Antitumor activity of a small‐molecule inhibitor of the histone kinase Haspin. Oncogene. 2012;31:1408–1418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Johnson JL, Yaron TM, Huntsman EM, Kerelsky A, Song JH, Regev A, et al. An atlas of substrate specificities for the human serine/threonine kinome. Nature. 2023;613:759–766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kelly AE, Ghenoiu C, Xue JZ, Zierhut C, Kimura H, Funabiki H. Survivin reads phosphorylated histone H3 threonine 3 to activate the mitotic kinase Aurora B. Science. 2010;330:235–239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kouzarides T. Chromatin modifications and their function. Cell. 2007;128:693–705. [DOI] [PubMed] [Google Scholar]
  21. Lee JS, Smith E, Shilatifard A. The language of histone crosstalk. Cell. 2010;142:682–685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li M, Dong Q, Zhu B. Aurora kinase B phosphorylates histone H3.3 at serine 31 during mitosis in mammalian cells. J Mol Biol. 2017;429:2042–2045. [DOI] [PubMed] [Google Scholar]
  23. Ma BB, Trieu TJ, Cheng J, Zhou S, Tang QS, Xie J, et al. Differential histone distribution patterns in induced asymmetrically dividing mouse embryonic stem cells. Cell Rep. 2020;32:32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Martire S, Gogate AA, Whitmill A, Tafessu A, Nguyen J, Teng YC, et al. Phosphorylation of histone H3.3 at serine 31 promotes p300 activity and enhancer acetylation. Nat Genet. 2019;51:941–946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mersfelder EL, Parthun MR. The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure. Nucleic Acids Res. 2006;34:2653–2662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pérez‐Cadahía B, Drobic B, Davie JR. H3 phosphorylation: dual role in mitosis and interphase. Biochem Cell Biol. 2009;87:695–709. [DOI] [PubMed] [Google Scholar]
  27. Polioudaki H, Markaki Y, Kourmouli N, Dialynas G, Theodoropoulos PA, Singh PB, et al. Mitotic phosphorylation of histone H3 at threonine 3. FEBS Lett. 2004;560:39–44. [DOI] [PubMed] [Google Scholar]
  28. Rossetto D, Avvakumov N, Côté J. Histone phosphorylation a chromatin modification involved in diverse nuclear events. Epigenetics. 2012;7:1098–1108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Soupsana K, Karanika E, Kiosse F, Christogianni A, Sfikas Y, Topalis P, et al. Distinct roles of Haspin in stem cell division and male gametogenesis. Sci Rep. 2021;11:19901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Talbert PB, Henikoff S. Histone variants at a glance. J Cell Sci. 2021;134. 10.1242/jcs.244749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Thorne JL, Ouboussad L, Lefevre PF. Heterochromatin protein 1 gamma and IκB kinase alpha interdependence during tumour necrosis factor gene transcription elongation in activated macrophages. Nucleic Acids Res. 2012;40:7676–7689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Villa F, Capasso P, Tortorici M, Forneris F, de Marco A, Mattevi A, et al. Crystal structure of the catalytic domain of Haspin, an atypical kinase implicated in chromatin organization. Proc Natl Acad Sci USA. 2009;106:20204–20209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang FW, Dai J, Daum JR, Niedzialkowska E, Banerjee B, Stukenberg PT, et al. Histone H3 Thr‐3 phosphorylation by Haspin positions Aurora B at centromeres in mitosis. Science. 2010;330:231–235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wang FW, Ulyanova NP, Daum JR, Patnaik D, Kateneva AV, Gorbsky GJ, et al. Haspin inhibitors reveal centromeric functions of Aurora B in chromosome segregation. J Cell Biol. 2012;199:251–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang FW, Ulyanova NP, van der Waal MS, Patnaik D, Lens SMA, Higgins JMG. A positive feedback loop involving Haspin and Aurora B promotes CPC accumulation at centromeres in mitosis. Curr Biol. 2011;21:1061–1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang PL, Hua XM, Sun Y, Li HY, Bryner YH, Hsung RP, et al. Loss of haspin suppresses cancer cell proliferation by interfering with cell cycle progression at multiple stages. FASEB J. 2021;35:e21923. [DOI] [PubMed] [Google Scholar]
  37. Wei Y, Mizzen CA, Cook RG, Gorovsky MA, Allis CD. Phosphorylation of histone H3 at serine 10 is correlated with chromosome condensation during mitosis and meiosis in. Proc Natl Acad Sci USA. 1998;95:7480–7484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wei Y, Yu LL, Bowen J, Gorovsky MA, Allis CD. Phosphorylation of histone H3 is required for proper chromosome condensation and segregation. Cell. 1999;97:99–109. [DOI] [PubMed] [Google Scholar]
  39. Wilkinson RW, Odedra R, Heaton SP, Wedge SR, Keen NJ, Crafter C, et al. AZD1152, a selective inhibitor of Aurora B kinase, inhibits human tumor xenograft growth by inducing apoptosis. Clin Cancer Res. 2007;13:3682–3688. [DOI] [PubMed] [Google Scholar]
  40. Xie J, Wooten M, Tran V, Chen BC, Pozmanter C, Simbolon C, et al. Histone H3 threonine phosphorylation regulates asymmetric histone inheritance in the male germline. Cell. 2015;163:920–933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yu FZ, Jiang Y, Lu L, Cao MM, Qiao YL, Liu X, et al. Aurora‐a promotes the establishment of spindle assembly checkpoint by priming the Haspin‐Aurora‐B feedback loop in late G2 phase. Cell Discov. 2017;3:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhou LL, Tian XY, Zhu CL, Wang FW, Higgins JMG. Polo‐like kinase‐1 triggers histone phosphorylation by Haspin in mitosis. EMBO Rep. 2014;15:273–281. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1. Supporting Information.

PRO-33-e5126-s001.docx (3.1MB, docx)

Articles from Protein Science : A Publication of the Protein Society are provided here courtesy of The Protein Society

RESOURCES