Skip to main content
International Journal for Parasitology: Drugs and Drug Resistance logoLink to International Journal for Parasitology: Drugs and Drug Resistance
. 2024 Jun 20;25:100552. doi: 10.1016/j.ijpddr.2024.100552

In vitro and in vivo activity evaluation and mode of action of broxaldine on Toxoplasma gondii

Yanhua Qiu a,b, Bintao Zhai a, Yubin Bai a, Hongling Lin a, Lingyu Wu a, Wei Luo a, Mengyan Shi a, Shulin Chen b,⁎⁎, Jiyu Zhang a,⁎
PMCID: PMC11284705  PMID: 38986389

Abstract

Toxoplasma gondii (T. gondii) is a highly successful global parasite, infecting about one-third of the world's population and significantly affecting human life and the economy. However, current drugs for toxoplasmosis treatment have considerable side effects, and there is no specific drug to meet current needs. This study aims to evaluate the anti-T. gondii activity of broxaldine (BRO) in vitro and in vivo and explore its mechanism of action. Our results showed that compared to the control group, the invasion rate of tachyzoites in the 4 μg/mL BRO group was only 14.31%, and the proliferation rate of tachyzoites in host cells was only 1.23%. Furthermore, BRO disrupted the lytic cycle of T. gondii and reduced the size and number of cysts in vitro. A mouse model of acute toxoplasmosis reported a 41.5% survival rate after BRO treatment, with reduced parasite load in tissues and blood. The subcellular structure of T. gondii was observed, including disintegration of T. gondii, mitochondrial swelling, increased liposomes, and the presence of autophagic lysosomes. Further investigation revealed enhanced autophagy, increased neutral lipids, and decreased mitochondrial membrane potential in T. gondii treated with BRO. The results also showed a significant decrease in ATP levels. Overall, BRO demonstrates good anti-T. gondii activity in vitro and in vivo; therefore, it has the potential to be used as a lead compound for anti-T. gondii treatment.

Keywords: Toxoplasma gondii, Broxaldine, Autophagy, Neutral lipid, Mitochondrial dysfunction

Graphical abstract

Image 1

Highlights

  • •

    Broxaldine could disrupt the lytic cycle of Toxoplasma gondii tachyzoites in vitro.

  • •

    Broxaldine was effective against bradyzoites and could destroy the cyst wall of Toxoplasma gondii in vitro.

  • •

    Broxaldine reduced the mortality rate of acute toxoplasmosis in mice.

  • •

    Broxaldine induced autophagy, mitochondrial dysfunction, and neutral lipid accumulation in Toxoplasma gondii.

1. Introduction

T. gondii is an obligate intracellular parasite that can parasitize almost all nucleated cells (Jin et al., 2020). Toxoplasmosis is a parasitic zoonosis caused by T. gondii that can infect all warm-blooded animals, including humans (Lourido, 2019). In immunocompetent individuals, the infection is often asymptomatic or appears as a mild, self-limiting infection, while immunocompromised individuals may experience acute toxoplasmosis or a potentially life-threatening condition (Montoya and Liesenfeld, 2004). T. gondii can pass through the placental barrier, and infection during pregnancy may result in abortion. Not only that, infants born to infected mothers are also likely to develop congenital toxoplasmosis, which can cause debilitating neurological or ocular diseases, even resulting in blindness (Ahmed et al., 2020). T. gondii has the ability to cross the blood-brain barrier and escape detection by the immune system, forming tissue cysts in the brain, which may persist for life (Olivera et al., 2021). These tissue cysts in the central nervous system may also be related to various neurological diseases, such as bipolar disorder (Cossu et al., 2022), autism (Nayeri et al., 2020), Alzheimer's disease (Nayeri et al., 2019), and schizophrenia (Milne et al., 2020).

Toxoplasmosis remains a serious public health challenge in the world. Since there is currently no vaccine available to prevent or treat toxoplasmosis, the primary strategy for combating this global disease is through effective chemotherapy (Antczak et al., 2016). Currently, toxoplasmosis treatment mainly relies on pyrimethamine-based regimens. The gold standard is the combination with sulfadiazine, and other options include combinations with clarithromycin, azithromycin, or trimethoprim-sulfamethoxazole (Dunay et al., 2018). While these methods can effectively control acute T. gondii infection, they are ineffective against chronic infection caused by T. gondii bradyzoites and have disadvantages, such as significant side effects (hematotoxicity, bone marrow suppression, allergies, etc.), long treatment cycles, and prone to recurrence of infections (Dunay et al., 2018). Therefore, there is a need to develop more effective drugs to treat toxoplasmosis and reduce the infection.

Broxaldine (BRO), also known as brobenzoxaldine, is a quinoline compound and an FDA-approved drug (Fig. 1) (Ghajar-Rahimi et al., 2022). Although BRO is not used clinically in the United States, Intestopan, which is primarily composed of BRO and broxyquinoline, has been utilized in clinical settings in various countries (such as Spain, Italy, India, etc.) as an intestinal antibacterial agent for treating diarrhea (Maiamos et al., 1962; Russo et al., 1962). The drug can be used to treat leprosy and is effective against fungal infections (Sharma, 1975). BRO is also an antiprotozoal drug, which is effective against infections caused by Giardia, Entamoeba histolytica, Trichomonas faecalis, and Lamblia intestinalis (Maiamos et al., 1962). In a recent study, Ghajar-Rahimi et al. found that BRO can prevent or treat acute kidney injury by inducing the expression of Heme Oxygenase-1 in drug screening. BRO is active against other protozoa, it is hypothesized that BRO may also be effective against T. gondii infection. Hence, this study aims to evaluate the in vivo and in vitro activities of BRO against T. gondii and preliminarily explore its mechanism of action in anti-T. gondii activity.

Fig. 1.

Fig. 1

Chemical structure of broxaldine.

2. Materials and methods

2.1. Animals

Female BALB/c mice aged 6–8 weeks were purchased from Lanzhou Veterinary Research Institute for in vivo experiments. The mice were housed in specific pathogen free laboratory with appropriate temperature (25 ± 2 °C), sufficient light (12 h light, 12 h dark), and diet without restriction. The study was reviewed and approved by the Animal Ethics Committee of the Lanzhou Institute of Husbandry and Pharmaceutical Sciences and the Chinese Academy of Agricultural Sciences (Permit No. 2020–020). At the end of the experiment, the mice were anesthetized by intraperitoneal injection of avertin. After anesthesia, the mice were euthanized by cervical dislocation.

2.2. Cells and parasites

African green monkey kidney (Vero) cells and human foreskin fibroblasts (HFF) were purchased from the Cell Bank of the Chinese Academy of Sciences. These cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37 °C and 5% CO2.

T. gondii RH and Prugniaud (PRU) strains were gifts from the Lanzhou Veterinary Research Institute, and the T. gondii RH strain expressing beta-galactosidase (RH-2F) was procured from ATCC (50,839). Parasites were maintained in Vero or HFF layers in DMEM containing 3% FBS. To purify tachyzoites, cells infected with parasites were passed three times through a 27G needle and filtered with a 3.0-μm-pore filter.

2.3. Cytotoxicity assay

The cytotoxicity of BRO (MCE) was determined on both HFF and Vero cells using the Cell Counting Kit-8 (CCK-8, MCE) following the manufacturer's instructions. BRO was prepared at various concentrations in phenol red-free DMEM medium (Gibco) and then added to a 96-well plate containing a monolayer of Vero or HFF cells for 72 h. After adding CCK-8 for 1 h, the absorbance at 450 nm was measured using a microplate reader (Multiskan GO, Thermo Fisher, USA).

2.4. Inhibition assay

A growth inhibition assay was performed by modifying Lorraine's method (Jones-Brando et al., 2003). Each concentration of BRO was added to a 96-well plate containing a monolayer of HFF cells, along with 100 RH-2F tachyzoites per well.0.1% dimethyl sulfoxide (DMSO, MCE) was used as the negative control group, and 5 μg/mL pyrimethamine (PYR, MCE) was used as the positive control group. After 72 h, 10 μL of 10% Triton X-100 (to inactivate the parasite) and 1 mM chlorophenol red-β-D-galactopyranoside (CPRG, Sigma) was added to each well, and the absorbance was measured at 570 nm after 12 h.

2.5. Invasion assay

Invasion assay was performed by indirect fluorescent antibody method (Li et al., 2020). In this case, extracellular tachyzoites were pretreated with BRO or DMSO in an incubator at 37 °C for 1 h, and the concentration of tachyzoites was 2 × 105/mL. After pretreatment, BRO or DMSO and tachyzoites were added to the Vero cells in the 12-well plate. After 2 h, the uninvaded tachyzoites were washed with PBS. Mouse anti-Toxoplasma monoclonal antibody (TP3, Abcam, ab8313) and goat anti-mouse Alexa Fluor 647 (Abcam, ab150115) were used to quantify the attached tachyzoites. After permeabilization, rabbit anti-T. gondii polyclonal antibody (Abcam, ab138698) and goat anti-rabbit Alexa Fluor 488 (Abcam, ab150077) were used to quantify the number of invading tachyzoites. DAPI (MCE) staining was used, and 20 randomly selected fields of view were examined under a confocal microscope (LSM 800, Carl Zeiss, Germany). The invasion rate was calculated as the number of tachyzoites per host cell.

2.6. Replication assay

The specific number of RH-2F was determined via biochemiluminescence to understand the anti-proliferative effect of BRO on intracellular T. gondii. Typically, 1 × 105/mL RH-2F was added to a 96-well plate containing HFF cells. After 2 h, the non-invasive tachyzoites were removed, and the remaining tachyzoites were incubated with BRO, DMSO, and PYR for 72 h. Galactosidase activity was detected using the Beta-Glo luminescent assay kit (Promega), and a standard curve was established using the known number of RH-2F to calculate the number of parasites.

For the immunofluorescence test, 1 × 105 RH and 2 × 105 PRU tachyzoites were added to 12-well plate crawls containing Vero cells, respectively. After 2 h, the uninvaded parasites were washed away, and the remaining cells were treated with 4 μg/mL BRO, 0.1% DMSO, and 5 μg/mL PYR. The cells were fixed at 24, 48, and 72 h, respectively. T. gondii was labeled with rabbit anti-T. gondii polyclonal antibody, with goat anti-rabbit Alexa Fluor 488 used as the secondary antibody of RH and goat anti-rabbit Alexa Fluor 594 (Abcam, ab150080) for PRU. Then, photographs were taken after DAPI staining.

2.7. Plaque assay

Three hundred RH tachyzoites were added to 6-well plates containing HFF cells and left for 2 h. BRO was added at 1, 2, and 4 μg/mL, with 0.1% DMSO as the control. After 7 days, the cells were fixed with cold methanol at room temperature for 15 min, which was then washed with PBS and stained with 1% crystal violet (Sigma) for another 15 min. The cells were photographed after being washed with PBS.

2.8. Bradyzoite assay

Bradyzoite differentiation was performed based on the method of Mayoral J et al. (Mayoral et al., 2020). Initially, PRU tachyzoites were added to Vero cells in glass-bottom 6-well plates at a multiplicity of infection (MOI) of 3:1. Two hours later, PBS was added to the 6-well plate and washed on a shaker for 5 min. This process was repeated at least six times to ensure the removal of extracellular tachyzoites. And the medium was replaced with a differentiation medium (containing 1% FBS and 50 mM HEPES, pH = 8.2), which was then transferred to a 37 °C incubator with 0% CO2. The medium was replaced approximately every 12 h. After 5 days, each concentration of BRO was added, with 0.1% DMSO used as the control group, and the medium was incubated for 7 days, during which the differentiation medium containing different concentrations of BRO was replaced every 12 h. Finally, the cells were fixed with 4% paraformaldehyde and incubated with 10 μg/mL FITC-conjugated Dolichos biflorus agglutinin (FITC-DBA; Thermo Fisher) for 30 min to observe the cysts. Ten fields were randomly selected for each well in the 6-well plate to capture images, and Image J software (National Institutes of Health, USA) was used to quantify the number and size of cysts. The assay was repeated three times.

2.9. Therapeutic experiments in mice

In the treatment experiment of acute infection in mice, 126 female BALB/c mice were randomly divided into 7 groups. Except for mice in the blank control group, each mouse was intraperitoneally injected with 1 × 103 RH tachyzoites, which the administration began 4 h later. The groups included the low-dose group (LD: BRO 10 mg/kg/d), the medium-dose group (MD: BRO 25 mg/kg/d), the high-dose group (HD: BRO 50 mg/kg/d), the positive control group (PC: PYR 50 mg/kg/d + sulfadiazine 100 mg/kg/d + folic acid 15 mg/kg/d), the negative control group (NC: 0.9% saline), the solvent control group (SC: corn oil), and the blank group (BC: 0.9% saline and without T. gondii infection). BRO was dissolved in corn oil for intraperitoneal administration, whereas the PC drugs were given by gavage in a 0.2% sodium carboxymethyl cellulose suspension. The body weight and death number of mice were then recorded. After 7 days of administration, 6 mice in each group were randomly selected for collecting blood and tissue, while the remaining mice continued to be observed for 23 days. The highest dose and administration method of BRO were determined based on previous basic research. We continuously administered BRO to mice for 7 days. No obvious toxic reactions were observed in mice, and no pathological changes were detected in the liver and kidney sections.

2.10. Tissue immunofluorescence

The brain or liver tissues of the experimental mice were fixed, dehydrated, transparent, waxed, embedded, and sliced into sections. Then, dewaxing and antigen repair were performed on 3 μm thick sections. In this case, T. gondii was labeled with rabbit anti-T. gondii polyclonal antibody and goat anti-rabbit Alexa Fluor 488, with the nucleus stained with DAPI.

2.11. qPCR

Genomic DNA was extracted following the instructions of the blood DNA mini kit and tissue DNA kit (Omega). The standard curve was obtained by adding a known number of RH to the blood or tissue of normal mice. DNA from each individual specimen was utilized in order to conduct qPCR with primers designed to target a 529 bp (529 bp forward, 5′–AGGAGAGATATCAGGACTGTAG–3′, 529 bp reverse 5′–GCGTCGTCTCGTCTAGATCG–3′, and the taqman probe, 6-Fam CCG GCT TGG CTG CTT TTC CT BHQ1) repetitive region specific to T. gondii (Homan et al., 2000). Samples with CT values ≥ 40 were considered to have no amplification detected, and the number of T. gondii in these samples was set to zero.

2.12. Transmission electron microscope analysis

The first is the ultrastructure observation of tachyzoites, a total of 1 × 107 RH tachyzoites were added to a 125 T culture flask containing Vero cells. After 8 h, 4 μg/mL BRO or 0.1% DMSO was added to the cells, which were digested with trypsin and harvested after 8 or 24 h. We also observed the ultrastructure of bradyzoites and cysts. Bradyzoites underwent differentiation before adding BRO to the treatment, and cells were collected by trypsin digestion after BRO treatment. Cells containing tachyzoites or bradyzoites were prefixed with 2.5% glutaraldehyde for 2 h at 4 °C and then postfixed with 1% osmic acid in the dark at room temperature for 2 h. After washing with PBS, the ultrathin sections were made after dehydration, penetration, embedding, and polymerization process. Finally, the ultrathin sections were stained with 2% uranyl acetate and 2.6% lead citrate and photographed under a transmission electron microscope (TEM; HT7800, HITACHI, Japan).

2.13. Monodansylcadaverine and Nile red staining

RH tachyzoites were added to Vero cells at a MOI of 2:1, followed by the addition of BRO and DMSO after 24 h. Tachyzoites were then purified after 24 h and stained with 100 μM monodansylcadaverine (MDC; Sigma) for 1 h or 10 μg/mL Nile red (Sigma) for 30 min to prep for observation. Upon washing the parasites with PBS, a portion of the stained tachyzoites was observed under a laser confocal microscope. Another fraction was used to determine the fluorescence intensity using a flow cytometer (CytoFLEX LX, Beckman, USA). The remaining unstained Tachyzoites using 0.1% DMSO treatment were used as a blank control. The flow cytometry results were analyzed using the FlowJo™ v10.8 Software (BD Life Sciences, USA).

2.14. Mitochondrial membrane potential and ATP content assay

We selected extracellular RH tachyzoites for mitochondrial membrane potential and ATP content determination assays. Typically, 1 × 107 RH tachyzoites were added to each group with 1, 2, and 4 μg/mL of BRO, and the control group was established. The parasites were collected after 6 h of BRO treatment, which were washed with PBS and then incubated with 100 nM MitoTracker™ red CMXRos (Thermo Fisher) at 37 °C for 30 min. The parasites were rewashed with PBS before the stained samples were observed using a laser confocal microscope. The fluorescence intensity was quantified using a flow cytometer.

The adenosine triphosphate (ATP) content of T. gondii was quantified using an enhanced ATP assay kit (Beyotime). T. gondii was treated with BRO for 6 h and then lysed by addition of ATP lysate on ice, and the supernatant was removed after centrifugation. The ATP assay working solution was prepared according to instructions, and 100 μL of the working solution was then added to a white 96-well plate for 3–5 min at room temperature. Approximately 20 μL of sample or standard was added to each well, mixed quickly, and after a minimum interval of 2 s, the chemiluminescence values were determined using a multifunctional microplate reader (EnSpire, PerkinElmer, USA). Based on the known concentration of the ATP standard, a standard curve was constructed, and the ATP content of each group was quantified.

2.15. Statistical analysis

The software Prism 9 (Graph Pad, USA) was utilized to create histograms, scatter plots, and perform non-linear curve analysis. The results were presented as the mean ± standard deviation (SD) of data from at least three repeated assays, and the one-way ANOVA test as appropriate. Intergroup comparisons were carried out using Tukey's post hoc test, with P ≤ 0.05 considered statistically significant.

3. Results

3.1. BRO inhibits T. gondii growth in vitro

We first analyzed the cytotoxicity of BRO on HFF and Vero cells. The results showed that BRO's 50% cytotoxicity concentrations (CC50) at 72 h were 17.95 μg/mL on HFF and 11.15 μg/mL on Vero cells, respectively (Fig. 2A and B). Both HFF and Vero cell viability were greater than 95% at a BRO concentration of 4 μg/mL; therefore, 4 μg/mL BRO was selected as the maximum concentration for subsequent in vitro experiments.

Fig. 2.

Fig. 2

BRO inhibits T. gondii growth in vitro. (A–B) Inhibition of HFF and Vero growth with BRO treatment. The 50% cytotoxicity concentrations (CC50) were examined. (C) Inhibition of RH-2F after BRO treatment. The 50% effective concentration (EC50) and selectivity index (SI Created by potrace 1.16, written by Peter Selinger 2001-2019 CC50/EC50) were determined. Reference drug: PYR—pyrimethamine. *, P < 0.05; ns, P > 0.05.

After assessing the cytotoxic characteristics of BRO, its inhibitory effect on T. gondii was examined in vitro. The 50% effective concentration (EC50) and selectivity index (SI) were determined, with SI as the ratio of CC50 to EC50. PYR at 5 μg/mL was used as a positive control, and 0.1% DMSO was used as a negative control. The results showed that the EC50 of BRO against T. gondii was 0.28 μg/mL, and the inhibitory effect of BRO at 0.4 μg/mL was comparable to the case using PYR (Fig. 2C). Note that the SI value should be greater than 1 for a drug to be considered a good candidate against toxoplasmosis (Węglińska et al., 2021). In this case, a 64.1 SI value was reported for BRO, indicating that BRO was both safe and efficient in inhibiting the growth of T. gondii.

3.2. The T. gondii lytic cycle is impaired by BRO in vitro

The invasion, replication, and plaque formation assays were performed using a safe concentration of BRO to evaluate its effect on the lytic cycle of T. gondii. Extracellular tachyzoites were pretreated with BRO for 1 h. Subsequently, tachyzoites and BRO were added to Vero cells for 2 h to assess the impact of BRO on T. gondii invasion into host cells. BRO was found to influence the ability of tachyzoites to invade Vero cells in a dose-dependent manner. The invasion rate of T. gondii was 14.31% when 4 μg/mL BRO was added, compared to a 40.53% invasion rate of the control group (Fig. 3A). In the anti-proliferation assay, we observed results similar to those of the anti-invasion test. Notably, the anti-proliferation effect of BRO at 4 μg/mL exceeded that of PYR (Fig. 3B). The immunofluorescence images showed that the host cell structure of the RH control group had basically disappeared at 72 h, with the few remaining host cells also filled with parasites. PRU controls appeared to contain cysts (white arrows) and the usual tachyzoites. In contrast, only a few deformed RH and PRU tachyzoites were found in the BRO group (Fig. 3C). In the plaque assay, T. gondii in the control group destroyed the structure of the host cells and formed many plaques in the host cells. In the BRO group, the host cells were normal and did not form plaques (Fig. 3D). Hence, the study suggests that BRO impairs the lytic cycle of T. gondii in vitro.

Fig. 3.

Fig. 3

T. gondii's lytic cycle is impaired by BRO in vitro. (A) Invasion assay. Extracellular tachyzoites were pretreated with different concentrations of BRO (4, 2, and 1 μg/mL) or DMSO (0.1%) at 37 °C for 1 h. Subsequently, the compounds and tachyzoites were introduced to the host cells, and the invasion rate was determined using the IFA method after 2 h (B–C) Intracellular replication assay. After RH-2F invaded cells for 2 h, 4, 2, and 1 μg/mL BRO were added to the cells and incubated for 72 h, respectively. The β-galactosidase activity was measured, a standard curve was generated, and the number of parasites was counted. (B) After RH tachyzoites invaded and increased in cells for 2 h, immunofluorescence labeling was performed after BRO treatment (4 μg/mL) for 24, 48, and 72 h, respectively. Scale bar = 10 μm. (C–D) Plaque formation assay. HFF monolayers were infected with 300 RH tachyzoites and cultured with BRO or DMSO for 7 days before staining with 1% crystal violet, scale bar = 2 mm. Reference drug: PYR—pyrimethamine. *, P < 0.05; ****, P < 0.0001; ns, P > 0.05.

3.3. BRO is effective for T. gondii bradyzoites in vitro

Previous anti-proliferative tests of BRO against PRU tachyzoites showed that BRO may inhibit the formation of T. gondii cysts (Fig. 3C), indicating its potential effectiveness against bradyzoites and cysts of T. gondii. To verify this hypothesis, we induced the differentiation of bradyzoites in vitro and then treated them with BRO. The cyst wall of T. gondii stands out for being heavily glycosylated, a feature that allows for easy staining with periodic acid-Schiff, DBA, and succinylated wheat germ agglutinin (Tomita et al., 2013). In this study, FITC-conjugated DBA was used to stain the cysts of T. gondii. The results revealed that the number of cysts in the BRO group was fewer and smaller, with many abnormal deformed cysts observed compared to the control group (Fig. 4A). Consequently, our results validate the hypothesis that BRO is effective against T. gondii bradyzoites while disrupting the cyst wall.

Fig. 4.

Fig. 4

BRO is effective for T. gondii bradyzoites in vitro. The PRU tachyzoites in Vero cells were added to the differentiation medium for 5 days to induce bradyzoites and cysts. Then, BRO was added and incubated for 7 days. After BRO treatment, cysts were stained with DBA-FITC. The pictures a, b, c, and d represent the enlarged pictures of the control group, BRO 1 μg/mL, BRO 2 μg/mL, and BRO 4 μg/mL, respectively. Scale bar = 20 μm (A). The number and size of cysts were counted using ImageJ software. (B) The average number of cysts in each laser confocal image was calculated. (C) The average size of the cyst. ***, P < 0.001; ****, P < 0.0001.

3.4. BRO treatment controls acute toxoplasmosis in mice

Mice were intraperitoneally injected with 1000 RH tachyzoites to establish an acute toxoplasmosis infection model and were then treated with BRO intraperitoneally for 7 days to observe the therapeutic effect. The experiments revealed that mice typically developed onset symptoms within the first two days prior to death. However, mice in PC and BC groups did not show any onset symptoms throughout the experiment, including hair disorders or mental malaise. Despite the onset of symptoms in mice, BRO had successfully delayed the onset time and reduced the mortality rates. All mice in the NC and SC groups died within 8–10 days. Mice in the LD treatment group died within 8–12 days, while those in the MD and HD groups began to die on the 11th and 12th days, respectively. The survival rates of the MD and HD groups at the end of the 30-day observation period were 25% and 41.7%, respectively (Fig. 5B). The body weight of mice in NC, SC, and LD groups rapidly decreased after the onset of the disease, while the body weight of mice in the MD, HD, PC, and BC groups had marginal changes (Fig. 5A).

Fig. 5.

Fig. 5

BRO controls acute T. gondii infection in mice. Female BALB/c mice were infected with intraperitoneal injection with an acute dose of 1 × 103 RH tachyzoites and treated with intraperitoneal injection from day 1–7 postinfection with 50, 25, or 10 mg/kg BRO (HD, MD, and LD); corn oil (SC); or normal saline (NC) once daily. Positive control (PC: pyrimethamine 50 mg/kg + sulfadiazine 100 mg/kg + folic acid 15 mg/kg) and blank control (BC: saline and without T. gondii infection) were also set up. (A) Body weight changes of RH-induced acute toxoplasmosis mice treated with BRO within 7 days, n = 18. (B) Survival of mice within 30 days. After the end of administration (day 7), mice were randomly selected to collect blood, liver, and brain tissues for tissue immunofluorescence test or qPCR assay. (C–E) qPCR assay. A standard curve was established by adding a known number of parasites to the blood, brain and liver of normal mice to determine the number of parasites in the blood and tissues of diseased mice. (C) The number of RH in the blood of each group, n = 3.(D) The number of RH in the liver of each group, n = 3. (E) The number of RH in the brain of each group, n = 3. (F) Tissue immunofluorescence assay. N = 3 and the scale bar = 20 μm *, P < 0.05; **, P < 0.01; ns, P > 0.05.

Furthermore, the tissue immunofluorescence and qPCR experiments were performed on the blood, liver, and brain tissues collected from mice at the end of the treatment period (day 7). The qPCR analysis revealed a significantly decreased number of RH in the blood, liver, and brain tissues of the BRO group. Notably, HD and PC groups reported a number of RH below the detection limit in the blood (Fig. 5C). The number of RH in the brain tissues was comparable to that in the PC group (Fig. 5E). The tissue immunofluorescence images further supported the reduction of parasites in the drug treatment group, particularly in the HD group (Fig. 5F). The findings suggest that BRO exhibits therapeutic potential against acute toxoplasmosis in mice.

3.5. BRO causes the disintegration of T. gondii

The changes in T. gondii RH tachyzoites treated with BRO were observed after 8 and 24 h to evaluate the effect of BRO on the ultrastructure of T. gondii. The results showed that the tachyzoites in the control group retained a normal crescent shape and were in the endogenous stage with a normal organelle morphology (Fig. 6A). In contrast, treatment with 4 μg/mL BRO for 8 h led to morphological changes in most tachyzoites, including mitochondrial swelling, increased lipids, and enhanced cytoplasmic vacuolization (asterisks). After 24 h of treatment, the structure of many tachyzoites was destroyed with disintegrated internal structures. Some tachyzoites were also found to contain autophagic lysosomes (red arrows).

Fig. 6.

Fig. 6

Ultrastructural changes in T. gondii after BRO treatment. (A) The intracellular tachyzoites treated with BRO for 8 and 24 h were observed via TEM. The scale bar = 500 nm. (B) After 5 days of tachyzoite differentiation in vitro, BRO was added for 7 days and photographed under a TEM. The scale bar = 1 μm. Co, conoid; Dg, dense granule; Go, Golgi body; Hm, host mitochondria; Lb, lipid bodies; Mn, micronemes; N, nucleus; PV, parasitophorous vacuole; R, rhoptry; Am, amylopectin; CW, cyst wall. The asterisk refers to the vacuole. Red arrows refer to autophagosomes or autolysosomes.

This study also examined the effect of BRO on bradyzoites and cysts that had differentiated for 7 days in vitro. The results revealed typical structures of bradyzoites and cysts in the control group, with bradyzoites containing a large amount of amylopectin and a thick cyst wall. However, extensive vacuolization of T. gondii bradyzoites (asterisk) was observed in the BRO group, along with the rupture of some bradyzoite cell membranes (black arrows) and the presence of autophagosomes or autolysosomes (Fig. 6B).

3.6. BRO causes autophagy in T. gondii

TEM analysis revealed that BRO might induce autophagy in T. gondii. MDC staining experiments were performed to verify the results. Initially, the fluorescence intensity of different numbers of tachyzoites in each group was measured using flow cytometry. It was found that the fluorescence intensity and mean fluorescence intensity of MDC staining increased with the BRO dose, with 4 μg/mL BRO having the greatest effect (Fig. 7A and B). The effect of 4 μg/mL BRO on tachyzoites was then examined using laser confocal microscopy. The analysis revealed significant morphological changes in T. gondii compared to the control group, and autophagosomes (white arrows) were identified in T. gondii (Fig. 7C). The findings align with TEM results, indicating that BRO can induce autophagy in T. gondii.

Fig. 7.

Fig. 7

BRO causes autophagy in T. gondii. After 24 h of BRO treatment, the tachyzoites were purified from Vero cells and stained with MDC for 1 h. (A) The MDC fluorescence intensity of the parasites in each group was determined using flow cytometry. (B) FlowJo™ v10.8 software was used to calculate the mean fluorescence intensity of BRO (4, 2, and 1 μg/mL) and the control group. (C) 4 μg/mL BRO and 0.1% DMSO control groups were photographed and observed. The white arrow refers to the autophagosome. The scale bar = 2 μm *, P < 0.05; ns, P > 0.05.

3.7. BRO causes lipid enrichment of T. gondii

TEM analysis also showed that BRO increased the lipid content in T. gondii tachyzoites (Fig. 6A). Hence, the Nile red staining test was performed, which revealed that compared with the control group, the BRO group exhibited more abnormal T. gondii with increased tachyzoite volume, content overflow, and increased lipid droplets (Fig. 8C). Flow cytometry data also showed that BRO significantly increased the fluorescence intensity of tachyzoites (Fig. 8A and B). These results thus suggest that BRO can induce tachyzoite deformation and neutral lipid accumulation in T. gondii.

Fig. 8.

Fig. 8

BRO causes neutral lipid enrichment of T. gondii. Tachyzoites treated with BRO or DMSO, and stained with Nile red for 30 min. (A) The Nile red fluorescence intensity of the parasites was determined by flow cytometry. (B) Mean fluorescence intensity. (C) 4 μg/mL BRO and control groups were photographed and observed. The scale bar = 2 μm *, P < 0.05.

3.8. BRO causes mitochondrial dysfunction in T. gondii

Additionally, TEM analysis showed that BRO resulted in swelling of the mitochondria in T. gondii, often regarded as mitochondrial dysfunction. The mitochondrial membrane potential and ATP content assays demonstrated that BRO can significantly reduce the mitochondrial membrane potential of tachyzoites (Fig. 9A–C), and the ATP levels in T. gondii were greatly reduced in a dose-dependent manner (Fig. 9D).

Fig. 9.

Fig. 9

BRO causes mitochondrial dysfunction in T. gondii. (A–C) Extracellular tachyzoites were incubated with BRO or DMSO for 6 h before staining with 100 nM MitoTracker™ red CMXRos for 30 min. After washing with PBS, the fluorescence intensity was measured by flow cytometry (A), and the mean fluorescence intensity of each group was calculated (B). Tachyzoites treated with 4 μg/mL BRO or 0.1% DMSO were observed and photographed using a confocal laser microscope (C). (D) Effect of BRO on the ATP level of T. gondii after 6 h. The scale bar = 2 μm **, P < 0.01; ****, P < 0.0001.

4. Discussion

Due to limited preventive measures, current strategies for treating toxoplasmosis mainly rely on chemotherapy. Traditional treatment for toxoplasmosis includes antibiotics such as sulfadiazine and clindamycin, as well as antimalarial drugs like pyrimethamine and atovaquone (Antczak et al., 2016). However, these drugs have numerous side effects, and T. gondii has developed resistance to some of them (Alday and Doggett, 2017). Therefore, there is an urgent need to develop new therapies for T. gondii infection, and drug repurposing has emerged as a promising approach. Historically, drug repurposing has been playing an essential role in discovering anti-T. gondii drugs while saving plenty of time and cost (Cajazeiro et al., 2022). This is the first study that investigates the effect of BRO on the tachyzoite and bradyzoite stages of T. gondii in vitro while evaluating the impact of BRO on acute toxoplasmosis in mice and its potential mode of action in vitro.

BRO demonstrated notable therapeutic efficacy against infections caused by T. gondii tachyzoites in vitro and in vivo. The drug can also disrupt the lytic cycle of T. gondii in vitro, with the anti-proliferative effect of 4 μg/mL BRO surpassing that of 5 μg/mL PYR. In vivo experiments reported a 100% survival rate in the positive control group (sulfadiazine + pyrimethamine + folic acid), which agrees well with the findings of SI et al. (Si et al., 2018). Despite BRO efficacy not being as potent as the positive control group, the drug significantly improved the survival rate of mice with acute toxoplasmosis, such that the survival rate for mice treated with 50 mg/kg/d of BRO for 7 days was 41.7%.

The transition of T. gondii bradyzoites into rapidly proliferating tachyzoites occurs when the body's immunity is compromised, leading to severe infection. The persistence of bradyzoites and cysts poses a challenge, as there is currently no method to eradicate them. Thus, an ideal anti-T. gondii drug should aim to eliminate both the tachyzoite and bradyzoite stages. The in vitro experiments showed that BRO can effectively target T. gondii bradyzoites by reducing the cyst numbers and size. Nevertheless, further in vivo studies are required to assess the therapeutic potential of BRO for chronic toxoplasmosis.

To investigate BRO's potential mechanism of action, initial TEM observations showed that BRO can induce swelling of T. gondii mitochondria and lead to the disappearance of mitochondrial cristae. Notably, mitochondria are crucial for ATP production, which is also vital for the survival of eukaryotic cells (Annesley and Fisher, 2019). In addition, the primary driving force for ATP synthesis in mitochondria is membrane potential (Muhleip et al., 2021). In this study, the mitochondrial membrane potential tests and ATP content measurements demonstrated the impacts of BRO on T. gondii mitochondria. We also observed that the increased lipid droplets in T. gondii, which indicates an enrichment of neutral lipids, as supported by the Nile red staining results. These neutral lipids, stored in structures such as liposomes or lipid droplets, are linked to the proliferation of T. gondii (Sonda and Hehl, 2006). Furthermore, the presence of autophagosomes or autolysosomes in tachyzoites and bradyzoites from MDC staining showed that BRO triggers autophagy in T. gondii. Previous studies have highlighted the potential of targeting T. gondii mitochondria, autophagy, and neutral lipids for novel therapeutic strategies for toxoplasmosis (Sonda and Hehl, 2006; Cheng et al., 2022; Usey and Huet, 2022). Overall, this study demonstrates that BRO induces autophagy, neutral lipid accumulation, and mitochondrial dysfunction in T. gondii. Nonetheless, further investigations are required to elucidate the specific mechanisms involved.

The clinical use of chloroquine, and in some recent cases quinine, has declined dramatically due to the development and spread of chloroquine-resistant malaria parasites (Ursos and Roepe, 2002; Wicht et al., 2020). T. gondii has developed resistance to certain commonly used clinical drugs in some regions, including sulfa drugs and atovaquone (Montazeri et al., 2018). Given that BRO belongs to the quinoline compound family, similar to quinine and chloroquine, this reminds us that we should pay attention to the possibility that BRO may also be resistant to T. gondii.

5. Conclusion

Our results demonstrate that BRO exhibits significant efficacy against both T. gondii tachyzoites and bradyzoites in vitro, as well as a therapeutic effect on acute toxoplasmosis in mice in vivo. BRO can induce mitochondrial dysfunction in T. gondii by affecting its mitochondrial membrane potential and ATP levels. BRO can also induce autophagy and promote neutral lipid accumulation in T. gondii. These findings suggest that BRO could be a promising lead compound for new treatments against T. gondii infection.

CRediT authorship contribution statement

Yanhua Qiu: Writing – review & editing, Writing – original draft, Visualization, Validation, Software, Resources, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Bintao Zhai: Funding acquisition. Yubin Bai: Software, Methodology, Formal analysis, Data curation. Hongling Lin: Writing – review & editing. Lingyu Wu: Resources, Methodology. Wei Luo: Resources. Mengyan Shi: Resources. Shulin Chen: Writing – review & editing, Conceptualization. Jiyu Zhang: Writing – review & editing, Validation, Supervision, Resources, Project administration, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare no competing interests.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (Grant Nos. 32102701), the National Key Research and Development Program of China (Grant Nos. 2022YFD1602201 and 2022YFD16022).

Contributor Information

Shulin Chen, Email: csl_1359@163.com.

Jiyu Zhang, Email: infzjy@sina.com.

References

  1. Ahmed M., Sood A., Gupta J. Toxoplasmosis in pregnancy. Eur. J. Obstet. Gynecol. Reprod. Biol. 2020;255:44–50. doi: 10.1016/j.ejogrb.2020.10.003. [DOI] [PubMed] [Google Scholar]
  2. Alday P.H., Doggett J.S. Drugs in development for toxoplasmosis: advances, challenges, and current status. Drug Des. Dev. Ther. 2017;11:273–293. doi: 10.2147/DDDT.S60973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Annesley S.J., Fisher P.R. Mitochondria in health and disease. Cells. 2019;8:680. doi: 10.3390/cells8070680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Antczak M., Dzitko K., Dlugonska H. Human toxoplasmosis - Searching for novel chemotherapeutics. Biomed. Pharmacother. 2016;82:677–684. doi: 10.1016/j.biopha.2016.05.041. [DOI] [PubMed] [Google Scholar]
  5. Cajazeiro D.C., Toledo P., de Sousa N.F., Scotti M.T., Reimao J.Q. Drug repurposing based on protozoan proteome: In vitro evaluation of in silico screened compounds against Toxoplasma gondii. Pharmaceutics. 2022;14:1634. doi: 10.3390/pharmaceutics14081634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng A., Zhang H., Chen B., Zheng S., Wang H., Shi Y., You S., Li M., Jiang L. Modulation of autophagy as a therapeutic strategy for Toxoplasma gondii infection. Front. Cell. Infect. Microbiol. 2022;12 doi: 10.3389/fcimb.2022.902428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cossu G., Preti A., Gyppaz D., Gureje O., Carta M.G. Association between toxoplasmosis and bipolar disorder : a systematic review and meta-analysis. J. Psychiatr. Res. 2022;153:284–291. doi: 10.1016/j.jpsychires.2022.07.013. [DOI] [PubMed] [Google Scholar]
  8. Dunay I.R., Gajurel K., Dhakal R., Liesenfeld O., Montoya J.G. Treatment of toxoplasmosis: historical perspective, animal models, and current clinical practice. Clin. Microbiol. Rev. 2018;31:e00017–e00057. doi: 10.1128/CMR.00057-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ghajar-Rahimi G., Traylor A.M., Mathew B., Bostwick J.R., Nebane N.M., Zmijewska A.A., Esman S.K., Thukral S., Zhai L., Sambandam V., Cowell R.M., Suto M.J., George J.F., Augelli-Szafran C.E., Agarwal A. Identification of cytoprotective small-molecule inducers of Heme-Oxygenase-1. Antioxidants. 2022;11:1888. doi: 10.3390/antiox11101888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Homan W.L., Vercammen M., De Braekeleer J., Verschueren H. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int. J. Parasitol. 2000;30:69–75. doi: 10.1016/s0020-7519(99)00170-8. [DOI] [PubMed] [Google Scholar]
  11. Jin Y., El-Ashram S., Yao Y., Shen J., Suo X., Liu X., Ji Y. Video microscopic analysis of invasion of Toxoplasma gondii into peritoneal macrophages. J. Parasitol. 2020;106:715–720. doi: 10.1645/19-152. [DOI] [PubMed] [Google Scholar]
  12. Jones-Brando L., Torrey E.F., Yolken R. Drugs used in the treatment of schizophrenia and bipolar disorder inhibit the replication of Toxoplasma gondii. Schizophr. Res. 2003;62:237–244. doi: 10.1016/s0920-9964(02)00357-2. [DOI] [PubMed] [Google Scholar]
  13. Li J., Guo H., Galon E.M., Gao Y., Lee S.H., Liu M., Li Y., Ji S., Jia H., Xuan X. Hydroxylamine and carboxymethoxylamine can inhibit Toxoplasma gondii growth through an aspartate aminotransferase-independent pathway. Antimicrob. Agents Chemother. 2020;64:e01819–e01889. doi: 10.1128/AAC.01889-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lourido S. Toxoplasma gondii. Trends Parasitol. 2019;35:944–945. doi: 10.1016/j.pt.2019.07.001. [DOI] [PubMed] [Google Scholar]
  15. Maiamos B., Daikos G.K., Kourkoumeli-Kontomichalou P., Pinetidou E. Fecal flora in protozoal and common colitis. Changes after therapeutic use of intestinal antiseptics. II. AI 307 (Intestopan). Chemotherapia (Basel) 1962;4:419–441. doi: 10.1159/000219939. [DOI] [PubMed] [Google Scholar]
  16. Mayoral J., Di Cristina M., Carruthers V.B., Weiss L.M. Toxoplasma gondii: bradyzoite differentiation in vitro and in vivo. Methods Mol. Biol. 2020;2071:269–282. doi: 10.1007/978-1-4939-9857-9_15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Milne G., Webster J.P., Walker M. Toxoplasma gondii: an underestimated threat? Trends Parasitol. 2020;36:959–969. doi: 10.1016/j.pt.2020.08.005. [DOI] [PubMed] [Google Scholar]
  18. Montazeri M., Mehrzadi S., Sharif M., Sarvi S., Tanzifi A., Aghayan S.A., Daryani A. Drug resistance in Toxoplasma gondii. Front. Microbiol. 2018;9:2587. doi: 10.3389/fmicb.2018.02587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Montoya J.G., Liesenfeld O. Toxoplasmosis. Lancet. 2004;363:1965–1976. doi: 10.1016/S0140-6736(04)16412-X. [DOI] [PubMed] [Google Scholar]
  20. Muhleip A., Kock F.R., Ovciarikova J., Lacombe A., Fernandes P., Sheiner L., Amunts A. ATP synthase hexamer assemblies shape cristae of Toxoplasma mitochondria. Nat. Commun. 2021;12:120. doi: 10.1038/s41467-020-20381-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Nayeri C.T., Sarvi S., Moosazadeh M., Sharif M., Aghayan S.A., Amouei A., Hosseininejad Z., Daryani A. Is Toxoplasma gondii a potential risk factor for Alzheimer's disease? A systematic review and meta-analysis. Microb. Pathog. 2019;137 doi: 10.1016/j.micpath.2019.103751. [DOI] [PubMed] [Google Scholar]
  22. Nayeri T., Sarvi S., Moosazadeh M., Hosseininejad Z., Sharif M., Amouei A., Daryani A. Relationship between toxoplasmosis and autism: a systematic review and meta-analysis. Microb. Pathog. 2020;147 doi: 10.1016/j.micpath.2020.104434. [DOI] [PubMed] [Google Scholar]
  23. Olivera G.C., Ross E.C., Peuckert C., Barragan A. Blood-brain barrier -restricted translocation of Toxoplasma gondii from cortical capillaries. Elife. 2021;10 doi: 10.7554/eLife.69182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Russo N., Marchiano V., Vetrano A. [Clinical data on a new intestinal antiseptic: Intestopan (AI-307)] Gazz. Int. Med. e Chir. 1962;66:1102–1107. [PubMed] [Google Scholar]
  25. Sharma C.S. Letter: effect of broxyquinoline and broxaldine in leprosy. Lancet. 1975;1:405. doi: 10.1016/s0140-6736(75)91334-3. [DOI] [PubMed] [Google Scholar]
  26. Si H., Xu C., Zhang J., Zhang X., Li B., Zhou X., Zhang J. Licochalcone A: an effective and low-toxicity compound against Toxoplasma gondii in vitro and in vivo. Int. J. Parasitol. Drugs Drug Resist. 2018;8:238–245. doi: 10.1016/j.ijpddr.2018.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sonda S., Hehl A.B. Lipid biology of Apicomplexa: perspectives for new drug targets, particularly for Toxoplasma gondii. Trends Parasitol. 2006;22:41–47. doi: 10.1016/j.pt.2005.11.001. [DOI] [PubMed] [Google Scholar]
  28. Tomita T., Bzik D.J., Ma Y.F., Fox B.A., Markillie L.M., Taylor R.C., Kim K., Weiss L.M. The Toxoplasma gondii cyst wall protein CST1 is critical for cyst wall integrity and promotes bradyzoite persistence. PLoS Pathog. 2013;9 doi: 10.1371/journal.ppat.1003823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ursos L.M., Roepe P.D. Chloroquine resistance in the malarial parasite, Plasmodium falciparum. Med. Res. Rev. 2002;22:465–491. doi: 10.1002/med.10016. [DOI] [PubMed] [Google Scholar]
  30. Usey M.M., Huet D. Parasite powerhouse : a review of the Toxoplasma gondii mitochondrion. J. Eukaryot. Microbiol. 2022;69 doi: 10.1111/jeu.12906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Węglińska L., Bekier A., Dzitko K., Pacholczyk-Sienicka B., Albrecht A., Plech T., Paneth P., Paneth A. 1,3,4-Thiadiazoles effectively inhibit proliferation of Toxoplasma gondii. Cells. 2021;10:1053. doi: 10.3390/cells10051053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wicht K.J., Mok S., Fidock D.A. Molecular mechanisms of drug resistance in Plasmodium falciparum malaria. Annu. Rev. Microbiol. 2020;74:431–454. doi: 10.1146/annurev-micro-020518-115546. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal for Parasitology: Drugs and Drug Resistance are provided here courtesy of Elsevier

RESOURCES