Abstract
Aim: Azoospermia accounts for 10–20% of male infertility. In 20–30% of affected males, genetic abnormalities are the leading cause of azoospermia. LncRNAs can regulate spermatogenic cell development.
Methods: This study chose 76 azoospermia patients and 36 healthy males. The gene expression was examined using the qRT-PCR technique.
Results: IGSF11-AS1 and BVES-AS appeared to be considerably underexpressed in the patients; however, only IGSF11-AS1 demonstrated a significant biomarker role. Additionally, IGSF11-AS1 expression was positively correlated with testosterone but was negatively correlated with follicle-stimulating hormone (FSH) and luteinizing hormone (LH). For the BVES-AS gene, however, FSH and LH had a negative correlation.
Conclusion: As a result of its low expression level in tissue samples, IGSF11-AS1 has a biomarker role for early azoospermia detection.
Keywords: : azoospermia, BVES-AS, IGSF11-AS1, LncRNAs
Plain language summary
Summary points.
Infertility affects 8–12% of childbearing-age couples, with around 50% of total cases of male infertility, while azoospermia, or the absence of sperm, accounts for 15% of cases.
In 20–30% of affected males, genetic abnormalities may be the leading cause of azoospermia. However, the molecular mechanisms related to spermatogenic failure are poorly understood.
Due to the widespread expression of lncRNAs in the testis, these molecules may be biomarkers for abnormalities affecting the male reproductive system.
Expression levels of IGSF11-AS1 and BVES-AS were considerably lower in infertile patients than in fertile controls.
IGSF11-AS1 can be a potential biomarker for azoospermia detection with AUCs of 0.84.
Infertile patients had significantly greater LH and FSH levels. However, testosterone levels were considerably reduced in patients compared with control males.
IGSF11-AS1 expression level showed a negative association with LH and FSH hormones, with a positive correlation for testosterone.
The BVES-AS gene has negatively correlated with the LH and FSH expression levels, with no correlation shown for testosterone.
1. Background
Male infertility is simply the inability of a male to conceive after engaging in regular sexual activity with a fertile female for at least a year [1]. Research indicates that between 8 and 12% of couples who are child-bearing age are infertile, with around 50% of the cases suffering from male infertility and a complete lack of sperm (azoospermia) accounting for 15% of cases [2,3]. Systemic illnesses, endocrine disorders, congenital conditions, acquired testicular injury, varicocele, production of anti-sperm antibodies and infections of the male accessory glands have also been linked to male infertility [4]. The traditional semen analysis does not reveal the etiology; it just provides information about the male's capability for conception; therefore, medical history, physical exam and other factors like hormonal analysis should all be considered when determining the underlying reason [5].
More than 25% of male infertility instances are still idiopathic with undetermined etiology [5]. However, azoospermia is divided into nonobstructive azoospermia (NOA), which accounts for about 60% of azoospermic cases, and obstructive azoospermia (OA), which accounts for about 40% of azoospermia cases [6]. The physical obstruction of the excurrent ducts causes OA with normal spermatogenesis, which is accompanied by an inability to generate mature sperm. The most severe type of male infertility in humans, known as NOA, results from defective spermatogenesis, which fails to create testicular sperm [3].
All males with azoospermia should have a hormonal examination, which at least should consider serum follicle-stimulating hormone (FSH) levels and total testosterone. Rare endocrine problems, including pituitary diseases and Kallmann syndrome (hypothalamic GnRH deficiency), which appear with reduced FSH, are pretesticular causes of azoospermia. Chromosome abnormalities and Y chromosome microdeletions are the other two congenital causes of azoospermia that are most frequently found, and both conditions can be detected by karyotyping and polymerase chain reaction, respectively [7].
According to research conducted using high-throughput technologies, a significant portion of the human genome has been transcribed, outnumbering the present gene annotations. Furthermore, most of these transcripts are not translated into proteins. Noncoding RNAs (ncRNAs) are transcripts that do not translate into proteins [8]. One way to classify noncoding RNAs is by size, which defines long noncoding RNAs (lncRNAs) as noncoding RNAs with a length greater than 200 bp [9]. Many lncRNAs are commonly expressed in the testis, making them potential biomarkers for male reproductive system diseases [10]. Recent studies have shown that lncRNA has a major impact on spermatogonia's development, differentiation and mortality [11]. Investigations are currently being performed to explore long noncoding RNAs' role and molecular mechanism in male infertility [12].
IGSF11-AS1 is a 1601 nt long noncoding RNA found on 3q13.32. Studies have shown that the lncRNA IGSF11-AS1 functions in the testis formation are linked to spermatogenic abnormalities and are typically highly expressed in the testis [10]. Initially recognized as a part of the immunoglobulin superfamily, IGSF11 has been shown to act as a CAM in a calcium-independent manner, mainly expressed in the mammalian testis and brain. It is particularly expressed in Sertoli cells to keep the blood–testis barrier functioning [13].
Blood vascular epicardial substance antisense RNA 1, or lncRNA BVES-AS1, is found on 6q21 and is more expressed in testicular tissue than in other tissues [14]. Blood vessel epicardial substance (BVES), also known as POPDC1, is a tight junction-associated transmembrane protein that regulates the epithelial-to-mesenchymal transition (EMT) through junctional signaling pathways. POPDC1, or BVES, identified in 1999, has been associated with the development of malignancies, considering the studies conducted over the past 20 years. It is initially identified in cardiac tissue and is highly expressed in various tissues, including smooth and skeletal muscle, the autonomic nervous systems, the gastrointestinal (GI) tract and the liver [15–17]. Additionally, testicular tissue demonstrates significant levels of BVS expression [14].
This study aims to examine the expression levels of IGSF11-AS1 lncRNA and BVES-AS1 lncRNA in tissue samples from patients with azoospermia, additionally to investigate the level of sex hormones and their relationship to gene expression in patients with azoospermia, also to examine the possibility that these lncRNAs could offer as diagnostic biomarkers of azoospermia.
2. Materials & methods
2.1. Study subjects
In this case-control study, 76 patients with azoospermia and 36 fertile males were used to assess the gene expression profile of IGSF11-AS1 and BVES-AS lncRNAs. The project was approved by the Ethics Committee of the University of Tabriz (no. 52/422368/1), and all individuals had provided written consent.
Azoospermia patients had no spermatozoa per milliliter (spz/ml), while healthy controls had proven fertility with an average sperm concentration of more than 20 × 106 spz/ml. The infertile patients received bilateral microdissection testicular sperm extraction (mTESE) surgery to retrieve spermatozoa for intracytoplasmic sperm injection. Y chromosomal microdeletion studies, karyotyping, testosterone, follicle-stimulating and luteinizing hormone serum levels were tested before the surgery. Patients did not receive any hormonal therapy and suffered primary infertility. The male controls had no history of cryptorchidism or mTESE. Cystic fibrosis, Y chromosome microdeletion, and those with chromosomal abnormalities have been excluded from the study.
2.2. Sampling & cDNA extraction
To reveal the gene expression pattern, frozen testis tissues were homogenized. In accordance with the instructions provided by the manufacturer, total RNA was isolated by the RNeasy Plus Universal Mini Kit (Qiagen in Hilden, Germany) and kept at -80°C. DNA contamination was eliminated using in-solution DNase digestion. The purity and concentration of extracted RNA were assessed by a NanoDrop2000 spectrophotometer from Thermo Scientific, and agarose gel electrophoresis was used to confirm the results. Thermo Scientific's Revert Aid First Strand cDNA Synthesis Kit was utilized to create the template cDNA with 1 μg of total RNA in an Eppendorf Mastercycler Gradient (Eppendorf AG) along with random hexamer and oligo-dT primers for each reaction.
2.3. qRT-PCR technique
Primers specific for B-actin, IGSF11-AS1 and BVES-AS were used in quantitative real-time PCR (qRT-PCR) on cDNA libraries to examine gene expression (Table 1). The housekeeping gene B-actin was discussed as an internal control for the isolation of RNA and RT-PCR effectiveness.
Table 1.
Specific primers used in the qRT-PCR and their amplicon length.
| Genes | Primer's name | Primer sequencing (5′-3′) | Amplicon length (bp) |
|---|---|---|---|
| IGSF11-AS1 | Forward | ATCTTCCCGTCAGCAACAGG | 173 |
| Reverse | GGAGGATAGGCGTTGGGTTC | ||
| BVES-AS | Forward | ACGCGCCACTGTTTTTGTTT | 91 |
| Reverse | AGTGCTTTGCCTACGATGGA | ||
| β-Actin | Forward | AGAGCTACGAGCTGCCTGAC | 184 |
| Reverse | AGCACTGTGTTGGCGTACAG |
The qPCR was carried out on 48-well plates in the StepOne-Plus RT-PCR System (Thermo Fisher Scientific/Applied Biosystems) in triplicate, by 1.0 μl of extracted cDNA, 10 μl of the SYBR Green qPCR Master Mix (Applied Biosystems ABI/PE), 7.0 μl of DNase/RNase-free water. and 1.0 μl of the designated primers. Initial denaturation took place for the first 8 min at 95°C, then 40 cycles of denaturation for 10 s at 95°C, annealing for 30 s at 60°C, and extension for 30 s at 72°C were performed. By raising the temperature from 72 to 95°C, the melting curve was shaped to prevent genomic DNA contamination or primer dimer amplification. All RT-PCR cycles contained non-template (cDNA) controls to prevent contamination, and the average cycles to threshold (CT) value was used for additional evaluation.
2.4. Statistic evaluation
Relative gene expression was assessed using the comparative CT method (2-ΔΔCT). The 2-ΔΔCT parameter, known as a fold change, reflects the gene expression profile considering housekeeping gene expression level. The data on gene expression was verified using the mean and standard deviation. GraphPad Prism 6 was used for the statistical analysis, and p-values of less than 0.05 were regarded as statistically significant. Data from non-parametric sources were analyzed using the Mann–Whitney U test. Area under the curve (AUC) and receiver operating characteristic (ROC) curve studies were utilized to evaluate the diagnostic potential. Additionally, the Spearman correlation test was employed to see whether there was any association between the expression of these genes and the hormone levels of the patients.
3. Results
3.1. Participants' demographic information
Patients with azoospermia and fertile males between 24 and 38 years of age have participated in this investigation. Table 2 displays mean and standard deviation values for demographic information of study subjects.
Table 2.
The demographic characteristics of participants.
| Groups | Azoospermia (n = 76) | Controls (n = 36) | p-value |
|---|---|---|---|
| Age | 29.35 ± 3.29 | 30.66 ± 2.53 | 0.01* |
| Testosterone (ng/ml)† | 2.91 ± 0.50 | 4.66 ± 0.49 | <0.0001**** |
| LH (mIU/ml)‡ | 11.53 ± 1.66 | 7.06 ± 0.63 | <0.0001**** |
| FSH (mIU/ml)§ | 19.76 ± 3.34 | 7.00 ± 0.58 | <0.0001**** |
Normal levels of testosterone = 3 to 10 ng/ml.
Normal level of LH = 2 to 12 mIU/ml.
Normal levels of FSH = 1 to 12 mIU/ml.
FSH: Follicle-stimulating hormone; LH: Luteinizing hormone.
3.2. Expression evaluation
The Mann–Whitney U test revealed that the expression levels of IGSF11-AS1 with p-value <0.0001 and BVES-AS with p-value = 0.0015 were considerably lower in infertile patients than in fertile controls (Figure 1).
Figure 1.
Expression evaluation in azoospermia patients compared with healthy males. (A) IGSF11-AS1 with p-value <0.0001 had a significantly low expression profile, and (B) BVES-AS with p-value = 0.0015 had a downregulation in azoospermia patients.
3.3. A biomarker for azoospermia detection
To detect azoospermia, the diagnostic utility of IGSF11-AS1 and BVES-AS genes was assessed using ROC (receiver operating characteristic) curve analysis. IGSF11-AS1 can be a potential biomarker for azoospermia detection with AUCs of 0.84; however, BVES-AS has a low potential for azoospermia diagnosis with an AUC of 0.68 (Figure 2).
Figure 2.
Considering ROC curves. (A) IGSF11-AS1 can function as a potential biomarker for azoospermia detection with AUC = 84%, sensitivity = 83%, specificity = 76% and (B) BVES- with AUC = 68%%, sensitivity = 67%, and specificity = 64% has a low chance of functioning as a biomarker in infertility diagnosis.
3.4. Hormonal evaluation
An ELISA test was used to identify hormone levels. Infertile patients had significantly greater LH and FSH levels than healthy controls (p < 0.001). However, testosterone levels were considerably reduced (p < 0.001) in patients compared with control males (Figure 3).
Figure 3.
Luteinizing hormone, follicle-stimulating hormone and testosterone hormone level. (A & B) FSH and LH serum levels are significantly high in infertile males (p < 0.0001), and (C) testosterone levels are extremely low in male patients (p < 0.0001).
FSH: Follicle-stimulating hormone; LH: Luteinizing hormone.
3.5. Correlation analysis
According to the Spearman correlation analysis, IGSF11-AS1 expression level showed a negative association with luteinizing hormone (LH) (R = -0.356, p < 0.0001) and FSH (R = -0.292, p = 0.0018) hormones, but a positive correlation was shown for testosterone (R = 0.223, p = 0.0187) (Figure 4).
Figure 4.
Correlation of IGSF11-AS1 expression with luteinizing hormone, follicle-stimulating hormone and testosterone level. (A & B) Negative correlation was observed between LH (R = -0.355, p < 0.0001) and FSH (R = -0.292, p = 0.0018) serum levels with IGSF11-AS1 expression level; however, (C) positive correlation was detected between testosterone level and IGSF11-AS1 expression level (R = 0.223, p = 0.0187).
Additionally, for the BVES-AS gene, LH and FSH negatively correlated with the expression level, respectively, with R = -0.336, p-value = 0.0003, and R = -0.276, p-value = 0.0033 (Figure 5).
Figure 5.
Correlation of BVES-AS expression with luteinizing hormone and follicle-stimulating hormone level. (A) A negative correlation was observed between LH serum level and BVES-AS expression level (R = -0.336, p = 0.0003); and (B) a negative correlation was detected between FSH level and BVES-AS expression level (R = -0.276, p = 0.0033).
FSH: Follicle-stimulating hormone; LH: Luteinizing hormone.
4. Discussion
The most prevalent genetic reason of male infertility is azoospermia, which is the absence of spermatozoa in an ejaculate and occurs from disabilities in sperm production or obstructions of the reproductive tract [4,18].
The primary roles of lncRNAs are transcriptional, post-transcriptional regulation and chromatin modification. Furthermore, the mRNA translation stability and regulation is significantly influenced by lncRNAs, primarily by binding to miRNA through the competitive endogenous RNA (ceRNA) regulation mechanism. A growing body of research revealed the significance of the lncRNA-miRNA-mRNA ceRNA regulation network in several illnesses [19,20]. Furthermore, several lncRNAs have been shown to function as disease biomarkers [21].
Sung et al.'s investigation on gene expression in males with NOA revealed that all men in the TESE group, regardless of whether surgical sperm extraction successfully produced spermatozoa (+Sperm) or not (-TESE), had underexpressed IGSF11-AS1 [22]. A study on NOA by L. Ng et al. showed that all males with ‘-Sperm’ had consistently low levels of the gene IGSF11-AS1 expressed in the testis and associated with spermatid development. These patients were divided into groups according to whether or not spermatozoa were later extracted at micro-TESE; (+Sperm) or not (-Sperm) [23]. The present study demonstrated that IGSF11-AS1 expression is decreased in males with azoospermia and that IGSF11-AS1 can be used as a diagnostic biomarker for azoospermia.
Studies on lncRNAs in spermatogenesis have recently been the focus of attention. MRNAs' and lncRNAs' expression profiles were examined using microarray technology at various crucial phases in male germ cell lines. According to the findings, coordinated expression is displayed by mRNAs and lncRNAs. For instance, by controlling the miR-19b-3p-ETV5 signaling pathway, increased levels of the lncRNA AK015322 promote spermatogonial stem cell proliferation [12].
A study by Wen discovered that individuals with colon adenocarcinoma (COAD) had low levels of the BVES-AS1. Researchers have shown that BVES-AS1 overexpression increased cell apoptosis while inhibiting COAD migration, invasion, cell proliferation and epithelial–mesenchymal transition. The adjacent gene blood vessel epicardial substance (BVES) expression was controlled by BVES-AS1, acting as a competitive endogenous RNA sponge for miR-522-3p. In addition, BVES-AS1 enlisted TATA-box binding protein associated factor 15 (TAF15) to support BVES messenger RNA stability [24]. Additionally, a recent study found that the lncRNA BVES-AS1 can act as a tumor suppressor in colorectal cancer (CRC) through inhibiting colon adenocarcinoma cell proliferation, metastasis and motility via the miR-522-3p/BVES cascade [24]. According to studies by Zhang et al., NOA patients (hypospermatogenesis to spermatogenesis arrest [SA] and Sertoli cell-only syndrome [SCOS]) have lower levels of miR-522-3p expression than healthy fertile controls [25]. Our findings showed that azoospermia patients have low levels of BVES-AS1, which is consistent with all of these research’ suggestions that BVES-AS1 may play a part in the spermatogenesis regulation through the miR-522-3p/BVES-AS1 signaling pathway.
5. Conclusion
The current research aims to determine the expression level of IGSF11-AS1 and BVES-AS lncRNAs in the tissue specimens of azoospermia patients. The results illustrate significant downregulation with p-value <0.0001 and p-value = 0.0015, respectively. However, only IGSF11-AS1 with AUC = 0.84 showed a potential biomarker role in diagnosing azoospermia. Additionally, we looked into the sex hormone levels and how they related to gene expression in patients with azoospermia, demonstrating changes in hormonal levels and the correlation between the expression profile of these lncRNAs and hormonal states.
Acknowledgments
The authors thank the patients who participated in this project.
Author contributions
Conceptualization: MIIJ, NJKM, RS. Data curation: MIIJ, NJKM, AHSS. Formal analysis: MIIJ, AHSS, RS. Methodology: MIIJ, NJKM, RS. Visualization: MIIJ, RS. Writing-original draft: MIIJ, NJKM, RS. Writing-review and editing: MIIJ, AHSS, RS.
Financial disclosure
The authors have no financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.
Competing interests disclosure
The authors have no competing interests or relevant affiliations with any organization or entity with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, stock ownership or options and expert testimony.
Writing disclosure
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have obtained appropriate institutional review board approval (no. 52/422368/1) and/or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations.
In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.
References
Papers of special note have been highlighted as: • of interest; •• of considerable interest
- 1.Katz DJ, Teloken P, Shoshany O. Male infertility – the other side of the equation. Aust Fam Physician. 2017;46(9):641–646. [PubMed] [Google Scholar]
- 2.Vander Borght M, Wyns C. Fertility and infertility: definition and epidemiology. Clin Biochem. 2018;62:2–10. doi: 10.1016/j.clinbiochem.2018.03.012 [DOI] [PubMed] [Google Scholar]
- 3.Han F, Jiang X, Li ZM, et al. Epigenetic inactivation of SOX30 is associated with male infertility and offers a therapy target for non-obstructive azoospermia. Mol Ther Nucleic Acids. 2020;19:72–83. doi: 10.1016/j.omtn.2019.10.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Omolaoye TS, Hachim MY, du Plessis SS. Using publicly available transcriptomic data to identify mechanistic and diagnostic biomarkers in azoospermia and overall male infertility. Sci Rep. 2022;12(1):2584. doi: 10.1038/s41598-022-06476-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cannarella R, Condorelli RA, Mongioì LM, et al. Molecular biology of spermatogenesis: novel targets of apparently idiopathic male infertility. Int J Mol Sci. 2020;21(5):1728. doi: 10.3390/ijms21051728 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tang D, Xu C, Geng H, et al. A novel homozygous mutation in the meiotic gene MSH4 leading to male infertility due to non-obstructive azoospermia. Am J Transl Res. 2020;12(12):8185–8191. [PMC free article] [PubMed] [Google Scholar]
- 7.Peña VN, Kohn TP, Herati AS. Genetic mutations contributing to non-obstructive azoospermia. Best Pract Res Clin Endocrinol Metab. 2020;34(6):101479. doi: 10.1016/j.beem.2020.101479 [DOI] [PubMed] [Google Scholar]
- 8.Sahlu BW, Zhao S, Wang X, et al. Long noncoding RNAs: new insights in modulating mammalian spermatogenesis. J Anim Sci Biotechnol. 2020;11:16. doi: 10.1186/s40104-019-0424-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Joshi M, Rajender S. Long noncoding RNAs (lncRNAs) in spermatogenesis and male infertility. Reprod Biol Endocrinol. 2020;18(1):103. doi: 10.1186/s12958-020-00660-6 [DOI] [PMC free article] [PubMed] [Google Scholar]; •• Suggesting LncRNAs as biomarkers or targets to diagnose and treat infertility.
- 10.Xie Y, Yao J, Zhang X, et al. A panel of extracellular vesicle long noncoding RNAs in seminal plasma for predicting testicular spermatozoa in nonobstructive azoospermia patients. Hum Reprod. 2020;35(11):2413–2427. doi: 10.1093/humrep/deaa184 [DOI] [PubMed] [Google Scholar]; • Verification of 19 lncRNAs in seminal plasma from normozoospermic men and NOA patients including IGSF11-AS1.
- 11.Zhou F, Chen W, Cui Y, et al. miRNA-122-5p stimulates the proliferation and DNA synthesis and inhibits the early apoptosis of human spermatogonial stem cells by targeting CBL and competing with lncRNA CASC7. Aging (Albany NY). 2020;12(24):25528–25546. doi: 10.18632/aging.104158 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Liang M, Hu K, He C, et al. Upregulated lncRNA Gm2044 inhibits male germ cell development by acting as miR-202 host gene. Anim Cells Syst (Seoul). 2019;23(2):128–134. doi: 10.1080/19768354.2019.1591506 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kim H, Takegahara N, Walsh MC, et al. IgSF11 regulates osteoclast differentiation through association with the scaffold protein PSD-95. Bone Res. 2020;8:5. doi: 10.1038/s41413-019-0080-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.National Center for Biotechnology Information, gene database [Internet]. Available from: https://www.ncbi.nlm.nih.gov/gene/?term=BVES-AS1
- 15.Choksi YA, Reddy VK, Singh K, et al. BVES is required for maintenance of colonic epithelial integrity in experimental colitis by modifying intestinal permeability. Mucosal Immunol. 2018;11(5):1363–1374. doi: 10.1038/s41385-018-0043-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Shetty MS, Ris L, Schindler RFR, et al. Mice lacking the cAMP effector protein POPDC1 show enhanced hippocampal synaptic plasticity. Cereb Cortex. 2022;32(16):3457–3471. doi: 10.1093/cercor/bhab426 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Han P, Lei Y, Li D, et al. Ten years of research on the role of BVES/POPDC1 in human disease: a review. Onco Targets Ther. 2019;12:1279–1291. doi: 10.2147/OTT.S192364 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Feng K, Ge H, Chen H, et al. Novel exon mutation in SYCE1 gene is associated with non-obstructive azoospermia. J Cell Mol Med. 2022;26(4):1245–1252. doi: 10.1111/jcmm.17180 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Huang Y. The novel regulatory role of lncRNA-miRNA-mRNA axis in cardiovascular diseases. J Cell Mol Med. 2018;22(12):5768–5775. doi: 10.1111/jcmm.13866 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172(3):393–407. doi: 10.1016/j.cell.2018.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lu H, Xu D, Wang P, et al. RNA-sequencing and bioinformatics analysis of long noncoding RNAs and mRNAs in the asthenozoospermia. Biosci Rep. 2020;40(7):BSR20194041. doi: 10.1042/BSR20194041 [DOI] [PMC free article] [PubMed] [Google Scholar]; • Introducing several dysregulated lncRNAs to function as male infertility biomarkers by bioinformatics analysis.
- 22.Sung C, Xie P, Cheung S, et al. O-314 epigenetic profiling of seminal plasma in NOA men to predict successful testicular sperm retrieval. Hum Reprod. 2022;37(Suppl. 1):deac106. [Google Scholar]
- 23.Ng L, Cheung S, Xie P, et al. P-079 transcriptomic analysis of seminal plasma in NOA men as a predictor of successful testicular sperm extraction. Hum Reprod. 2023;38(Suppl. 1):dead093. [Google Scholar]
- 24.Wen W, Wang H, Xie S, et al. BVES-AS1 inhibits the malignant behaviors of colon adenocarcinoma cells via regulating BVES. Cell Biol Int. 2021;45(9):1945–1956. doi: 10.1002/cbin.11634 [DOI] [PubMed] [Google Scholar]
- 25.Zhang W, Zhang Y, Zhao M, et al. MicroRNA expression profiles in the seminal plasma of nonobstructive azoospermia patients with different histopathologic patterns. Fertil Steril. 2021;115(5):1197–1211. doi: 10.1016/j.fertnstert.2020.11.020 [DOI] [PubMed] [Google Scholar]