Skip to main content
PeerJ logoLink to PeerJ
. 2024 Jul 26;12:e17668. doi: 10.7717/peerj.17668

Identification of the RRM1 gene family in rice (Oryza sativa) and its response to rice blast

Xinlei Jiang 1, Shangwei Yu 1, Yuhan Huang 1, Junying Huang 1, Shaochun Liu 1, Dewei Yang 2, Junru Fu 1, Haohua He 1, Haihui Fu 1,
Editor: Diaa Abd El-Moneim
PMCID: PMC11285362  PMID: 39076776

Abstract

To better understand RNA-binding proteins in rice, a comprehensive investigation was conducted on the RRM1 gene family of rice. It encompassed genome-wide identification and exploration of its role in rice blast resistance. The physicochemical properties of the rice OsRRM1 gene family were analyzed. There genes were also analyzed for their conserved domains, motifs, location information, gene structure, phylogenetic trees, collinearity, and cis-acting elements. Furthermore, alterations in the expression patterns of selected OsRRM1 genes were assessed using quantitative real-time PCR (qRT-PCR). A total of 212 members of the OsRRM1 gene family were identified, which were dispersed across 12 chromosomes. These genes all exhibit multiple exons and introns, all of which encompass the conserved RRM1 domain and share analogous motifs. This observation suggests a high degree of conservation within the encoded sequence domain of these genes. Phylogenetic analysis revealed the existence of five subfamilies within the OsRRM1 gene family. Furthermore, investigation of the promoter region identified cis-regulatory elements that are involved in nucleic acid binding and interaction with multiple transcription factors. By employing GO and KEGG analyses, four RRM1 genes were tentatively identified as crucial contributors to plant immunity, while the RRM1 gene family was also found to have a significant involvement in the complex of alternative splicing. The qRT-PCR results revealed distinct temporal changes in the expression patterns of OsRRM1 genes following rice blast infection. Additionally, gene expression analysis indicates that the majority of OsRRM1 genes exhibited constitutive expressions. These findings enrich our understanding of the OsRRM1 gene family. They also provide a foundation for further research on immune mechanisms rice and the management of rice blast.

Keywords: Rice, Gene family, Rice blast, Bioinformatics

Introduction

Rice (Oryza sativa subsp. japonica) is widely cultivated in warm regions such as Asia. It is one of the world’s main food crops, and plays a vital role in global food security. It is also an important model crop for biological research.

Gene expression follows strict processes, each step of which needs to be strictly regulated. This often occurs at the transcription level through DNA cis-acting elements and transcription factor binding (Jeune & Ladurner, 2004; Latchman, 2011). Studies have shown that post-transcriptional regulation plays an important role in regulating the gene expression of plants. Post-transcriptional regulation involves multiple processes, including alternative splicing, RNA editing, RNA transport from the nucleus to the cytoplasm, RNA stabilization, and translation, which require the help of RNA binding proteins (RBPs) (Jackson, Pombo & Iborra, 2000; Latchman, 2011). To achieve sequence-specific recognition of regulation at different levels and regulatory targets, there are several RNA binding domains with conserved characteristics in RBPs, such as RNA recognition motif (RRM) domains (Burd & Dreyfuss, 1994; Lorković & Barta, 2002).

The RRM, also known as the RNA binding domain (RBD) or ribonucleoprotein domain (RNP), is one of the most abundant protein domains in eukaryotes and was first identified in the late 1980s (Adam et al., 1986; Bandziulis, Swanson & Dreyfuss, 1989; Dreyfuss, Kim & Kataoka, 2002; Dreyfuss, Swanson & Piñol-Roma, 1988). The RRM domain has important roles in the regulation of development, signaling, gene expression, and cell differentiation (Gomes et al., 2001; O’Bryan et al., 2013; Paukku et al., 2012; Zhan et al., 2015). The RRM is a structurally conserved region consisting of about 80–90 amino acids, consisting of two short consensus sequences: RNP1 (hexapeptide) and RNP2 (octapeptide) (Maris, Dominguez & Allain, 2005). It folds into an αβ sandwich with a typical β1α1β2β3α2β4 topology that forms a four-stranded antiparallel β-sheet packed against two α-helices (Nagai et al., 1990). The specificity of RNA binding is determined by multiple exposures to surrounding amino acids (Cléry, Blatter & Allain, 2008; Maris, Dominguez & Allain, 2005). In some cases, a third helix is present during RNA binding (Birney, Kumar & Krainer, 1993). The largest single-stranded RNA-binding proteome is the eukaryotic RRM family, which contains eight amino acid RRM1 consensus sequences (Bandziulis, Swanson & Dreyfuss, 1989; Query, Bentley & Keene, 1989). RRM proteins have a variety of RNA-binding preferences and functions, including heterogeneous nuclear ribonucleoproteins (hnRNPs), proteins associated with alternative splicing regulation (SR, U2AF, Sxl), protein components of small ribonucleoproteins (U1 and U2 snRNPs), and proteins that regulate RNA stability and translation (PABP) (Chambers et al., 1988; Query, Bentley & Keene, 1989; Sachs, Davis & Kornberg, 1987). The RRM in the heterodimer splicing factor U2 snRNP cofactor (U2AF) appears to have two RRM-like domains with special features for protein recognition (Kielkopf, Lücke & Green, 2004). This motif also appears in some single-stranded DNA-binding proteins (Cléry, Blatter & Allain, 2008). However, there are few reports on the OsRRM1 gene family. Previously unknown RRM1 transcription factors have been identified that interact directly with NLR to activate plant defense, establishing a direct link between transcriptional activation of immune responses and NRL-mediated pathogen perception (Zhai et al., 2019). Although the rice genome encodes a large number of OsRRM1 proteins, the exact number and function of these gene families in rice remain unclear.

Rice blast (Magnaporthe oryza) is one of the world’s most widespread and harmful fungal diseases. It may infect rice at all stages of growth and development, seriously reducing the yield and quality of rice and, thus, threatening global food security. Although conventional chemical control methods can quickly and effectively control diseases and pests, long-term use of pesticide can cause severe environmental problems and, incur costs, which are not conducive to sustainable agriculture (Jeon et al., 2020). Germplasm resources of blast resistance have extensive genetic variation. Therefore, improving the host plant’s own resistance is the most effective, economical and environmentally friendly way to combat rice blast (Manandhar et al., 1998). Many studies have shown that the adaptability of rice blast fungus to the host changes frequently and that the resistance of rice varieties can only be maintained for 3 to 5 years (Jeon et al., 2020; Moriyama et al., 2018; Nasir et al., 2018). Plant genomes express a large number of RRM-containing proteins, but only a few of their roles have been identified in plants; these include immunity, possibly through RNA processing (Lee, Kim & Hwang, 2012; Lorković, 2009; Nina & Biology FJCOiP, 2002; Woloshen, Huang & Li, 2011). Some possible members of the RRM transcription factor family have been identified but the roles of all RRM genes in transcriptional activation in rice and other plants have not been predicted (Zhai et al., 2019). Therefore, it is necessary to further study the regulation of the gene network during rice blast occurrence and to explore and identify new blast resistance genes. Such research has important theoretical and practical significance for the breeding of new varieties resistant to rice blast.

RRM1 family members play an important role in the regulation of biological growth and development; however, studies on the resistance function of RRM1 family members to rice blast have not been systematically analyzed. In this study, bioinformatics was used to identify and characterize the whole genome of the RRM1 gene family in rice. The gene structure, physical and chemical properties, and domain and phylogenetic characteristics of the RRM1 gene family in rice were studied. In addition, RNA-seq was used to analyze the expression patterns of the RRM1 gene family in different time periods after rice blast fungus treatment. At the same time, the expression changes of RRM1 family genes in response to stress resistance were analyzed by quantitative real-time PCR. These results increase our understanding of the OsRRM1 gene family and provide a basis for further investigation of its function in response to rice blast infection. This study provides a theoretical foundation for subsequent research into the function of the OsRRM1 gene family.

Materials and Methods

Identification and physicochemical properties of RRM1 gene family members in rice

Rice genome sequence, annotation, protein sequence, and gene structure files were downloaded from the Ensembl Plants database (http://plants.ensembl.org/index.html). The HMM (Hidden Markov Model) PF00076.24 (RRM1 domain) of the RRM1 gene family was downloaded from the Pfam database (http://pfam.xfam.org/). We used HMMER3.2 software to search and analyze the database and predict the RRM1 gene family in rice, obtaining an E-value < 1 × 10−5. Domain analysis of identified RRM1 candidate sequences was performed using conserved RRM1 domain sequences in the Pfam database (PF00076.24) and SMART online analysis software (http://smart.embl.de/). We used the ExPASy (https://www.expasy.org/protparam/) online tools to predict protein isoelectric points, molecular sizes, and the lengths of amino acid protein sequences. Prediction and analysis of protein subcellular locations were performed using the Cell-PLoc 2.0 (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) online tool.

Chromosome location of the OsRRM1 gene family and phylogenetic tree construction

The position of the RRM1 gene on the chromosome was analyzed using the rice gene sequence file downloaded from Ensembl Plants, with a chromosome location map drawn using TBtools software. The NJ (neighbor-joining method) phylogenetic tree of the RRM1 protein was constructed using MEGA11.0 (Molecular Evolutionary Genetics Analysis 11.0) with bootstraps set to 1,000 and other parameters left as their defaults. Then, the online software Itol (https://itol.embl.de/) was used to beautify the tree.

Analysis of the conserved domain, gene structure and motif of the OsRRM1 gene family

The conserved domains of the identified gene families were analyzed using the online tool Pfam (http://pfam.xfam.org/) and visualized by TBtools software (Chen et al., 2020).

Rice gene structure annotation files were downloaded from Ensembl Plants (http://plants.ensembl.org/) to identify the structure of the RRM1 gene family, with TBtools software used to draw the genetic structure.

The conserved motif location of the identified RRM1 gene family was predicted using the online tool MEME (https://meme-suite.org/meme/). The parameter settings were: motifs = 10, other parameters = default. The prediction results were plotted using TBtools software.

Interspecies collinearity analysis of the OsRRM1 gene family

Collinearity analysis and prediction of the RRM1 gene in rice and Arabidopsis thaliana were carried out. A collinearity map was drawn using TBtools software.

GO and KEGG analysis of OsRRM1 gene family

GO and KEGG analyses of the OsRRM1 gene family were performed using PlantRegMap (http://plantregmap.gao-lab.org/) and Kobas (https://bio.tools/kobas), respectively. All results were calculated with q < 0.05. Prism8.0 was used to plot the path name as the ordinate and the −log10 (q-value) as the abscissa.

Analysis of presumptive cis-regulatory elements in the promoter region of OsRRM1

We used TBtools to predict cis-regulatory elements in the 2,000 bp upstream gene promoter region of OsRRM1 in the PlantCARE Database (https://bioinformatics.psb.ugent.be/webtools/plantcare/html).

Expression pattern analysis of the RRM1 gene in rice treated with blast fungus

Fungus-inoculated rice seedlings were kept in a dark chamber at 25 °C with 85% humidity for 24 h. They were then maintained in the growth chamber at 26/24 °C under a 14 h light/10 h dark cycle with 85% humidity. Flag leaves were harvested at 24, 36, and 48 h, with three biological replicates collected for each treatment. To study the changes in rice blast gene expression, RNA-seq data were downloaded from the National Center for Biotechnology Information Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/) under accession number GSE157400 (Yang et al., 2020). To present data suitable for clustering display, after data analysis, the absolute FPKM value was obtained by dividing it by the mean of the control group and then performing log2 transformation. TBtools was used to map the expression patterns of OsRRM1 gene family members identified in rice under blast fungus treatment.

Plant materials and rice blast stress treatment

Dried, mature, well-developed rice seeds were treated with 2% sodium hypochlorite solution for 48 h. The seeds were placed in a hydroponic box and divided into control and treatment groups. The hydroponic box was placed in a growth chamber with a 14/10 h light/dark cycle and 28/24 °C temperature cycle.

The rice seedlings were cultivated in the growth chamber until they reached the two-leaf stage at about 14 days. Finally, suspensions of blast fungus (guy11) with concentrations of 1 × 105 /mL were used as stress treatment. At 0, 12, 24, 36, and 48 h after infection with rice blast (guy11), the young rice leaves were immediately frozen in liquid nitrogen and stored at −80 °C for later use.

Analysis of OsRRM1 gene expression by qRT-PCR

Total RNA was extracted from rice materials according to the instructions of the Total RNA Extraction Kit (Takara) and the experimental method of Du et al. (2021). The first-strand cDNA was synthesized with a PrimeScript First-strand cDNA Synthesis Kit (Takara). Specific primers for four candidate genes were designed (Table 1). Quantitative real-time PCR was performed on a quantitative real-time fluorescent quantitative PCR system (ABI 7500). The relative gene expression was calculated by the 2−∆∆CT algorithm. For the experimental stress treatment data, the expression levels of each gene at 0 h were standardized to 1, with the expression levels at other time points calculated relative to this.

Table 1. Specific primers of four candidate RRM1 genes.

Gene F R
RRM1-15 GGATGTGACTGAAGCTCGGGTGATC CTGGAGGTCTCTCATTCGCGAAGTTC
RRM1-61 GGAGGTCTTGGAAGCCAAGGTCATC CCATCCATGTCAGCGCCATCAAG
RRM1-76 CACTGAAGCAAAGGTGGTTTTTGAC GAGCTTTATCGACAGTGATCGCC
RRM1-207 CTTGGATGGAAAGGATCTCGATGG CATAGCCACCGCCTCCATAG
Actin CCAATCGTGAGAAGATGACCCA CCATCAGGAAGCTCGTAGCTCT

Note:

Actin is the internal reference gene used in this experiment. F is the forward primers, R is the reverse primers.

Subcellular analysis of the OsRRM1 gene

Construction of a subcellular carrier plasmid. The plasmid of the subcellular localization system (1300S-EGFP) was used to construct the vector for this experiment. It was subjected to single-enzyme digestion with Kpn I restriction enzyme to prepare a linearized vector. Specific primers were designed according to the candidate OsRRM1 gene sequence (Table S1), and the rice cDNA was used as a template to amplify the fragment. In this experiment, the homologous recombinant ligase ClonExpress II One Step Cloning Kit (Vazyme) was used to construct the recombinant plasmid.

Instantaneous transformation experiment with tobacco leaves. Several tobacco seeds were sown and grown for 28 d under a 12/12 h light/dark cycle for experimental use. The constructed recombinant plasmid was transferred to Agrobacterium EHA105 by the electrochemical method and cultured at 30 °C for 2 d. Agrobacterium was scraped off the surface of a solid culture dish with an inoculation ring and cultured in 10 mL YEB liquid medium at 170 rpm/min for 1 h. The bacteria were re-suspended with 10 mM MgCl2 solution. Tobacco plants with good growth conditions were selected, and the lower epidermis of tobacco leaves was injected with a 1 mL syringe and labeled. After injection, the tobacco plants were cultured in low light for 2 d. Tobacco leaves inoculated with Agrobacterium tumefaciens were selected to make slides, and observed and photographed by confocal laser microscopy.

Results

Screening and identification of RRM1 gene family members in rice

In this study, the domains (Pfam: PF00076.24) predicted that 212 RRM1 genes (all with E values < 1 × 10−5) were identified in the whole rice genome. Their conserved domain was analyzed by Pfam (Fig. 1). The results show that all 212 OsRRM1 genes contained RRM1, but its locations in the genes differed. These genes are named OsRRM1-1OsRRM1-212 based on their physical location on the chromosome (Table 2). We used Expasy (https://web.expasy.org/protparam/) to analyze the 212 OsRRM1 genes’ molecular weights, lengths, isoelectric points, amino acids, etc. The results show that the lengths of amino acids encoding the 212 rice RRM1 genes ranged from 53 to 1,160 aa, the molecular weights ranged from 5,837 to 127,816 Da, and the theoretical isoelectric point distribution ranged from 3.97 to 12.37. Subcellular localization prediction shows that OsRRM1 was mainly located in the nucleus, followed by the extracellular matrix, mitochondria, chloroplast, cell membrane, and intracytoplasmic matrix. This suggests that these proteins mainly function in the nucleus. These variations suggest potential functional diversity and regulatory mechanisms, but they also pose challenges for researchers aiming to elucidate their roles in rice biology. Understanding how these differences impact protein structure, function, and interaction networks will require comprehensive experimental approaches, including functional assays, protein-protein interaction studies, and computational modeling. Moreover, considering the dynamic nature of gene expression and post-translational modifications, integrating multi-omics data and employing systems biology approaches will be essential for gaining deeper insights into the OsRRM1 gene family’s functions and regulatory networks in rice.

Figure 1. The conserved domain of OsRRM1 gene family.

Figure 1

The five most prominently present conserved domains in the upper right corner are represented by different colored boxes. All OsRRM1 genes contain the green RRM1 domain. The length of each conserved domain can be inferred from the scale at the bottom.

Table 2. Basic information of OsRRM1 gene identified in rice.

Gene RAP NAA MW pI Subcellular localization
RRM1-1 Os01g0101600 978 106,323.33 9.56 Nucleus
RRM1-2 Os01g0155600 324 36,893.16 11.27 Nucleus
RRM1-3 Os01g0209400 308 33,656.38 8.94 Nucleus
RRM1-4 Os01g0265800 490 49,279.96 5.09 Nucleus
RRM1-5 Os01g0316600 124 13,965.3 9.91 Chloroplast
RRM1-6 Os01g0367300 698 79,763.67 10.57 Nucleus
RRM1-7 Os01g0502800 53 5,837.75 10.27 Chloroplast
RRM1-8 Os01g0614500 447 44,269.69 8.43 Nucleus
RRM1-9 Os01g0619000 163 18,016.54 5.76 Extracellular space
RRM1-10 Os01g0636700 469 52,108.23 8.63 Nucleus
RRM1-11 Os01g0867800 439 49,316.8 6.46 Nucleus
RRM1-12 Os01g0876500 100 11,385 7.72 Chloroplast
RRM1-13 Os01g0876800 300 31,951.79 8.91 Extracellular space
RRM1-14 Os01g0907900 683 71,779.19 6.37 Nucleus
RRM1-15 Os01g0916600 150 15,546.9 8.01 Chloroplast thylakoid lumen
RRM1-16 Os01g0938200 460 48,888.22 8.72 Nucleus
RRM1-17 Os01g0945800 363 40,073.63 6.61 Nucleus
RRM1-18 Os01g0956600 608 68,184.84 7.8 Nucleus
RRM1-19 Os01g0958500 310 31,802.78 8.34 Nucleus
RRM1-20 Os01g0959000 432 48,111.49 12.37 Chloroplast thylakoid lumen
RRM1-21 Os01g0974701 116 12,459.19 9.74 Mitochondrion
RRM1-22 Os02g0122800 249 28,953.55 10 Nucleus
RRM1-23 Os02g0131700 448 49,261.45 5.02 Nucleus
RRM1-24 Os02g0167500 957 105,767.07 7.88 Extracellular space
RRM1-25 Os02g0179900 240 28,105.95 8.85 Nucleus
RRM1-26 Os02g0221500 397 40,265.08 5.63 Nucleus
RRM1-27 Os02g0244600 359 38,737.53 5.62 Nucleus
RRM1-28 Os02g0252100 265 30,466.57 11.09 Nucleus
RRM1-29 Os02g0319100 811 90,295.23 6.27 Nucleus
RRM1-30 Os02g0497700 480 50,879.51 5.01 Nucleus
RRM1-31 Os02g0517531 1,001 110,368.83 6.39 Nucleus
RRM1-32 Os02g0536400 656 74,812.42 9.43 Nucleus
RRM1-33 Os02g0567900 259 28,284.5 9.18 Nucleus
RRM1-34 Os02g0602600 386 41,584.82 7.67 Nucleus
RRM1-35 Os02g0610400 467 51,689.83 5.56 Nucleus
RRM1-36 Os02g0610600 200 22,797.31 11.33 Nucleus
RRM1-37 Os02g0612300 243 28,573.22 5.44 Chloroplast
RRM1-38 Os02g0714000 287 30,609.94 9.32 Nucleus
RRM1-39 Os02g0719800 428 47,331.12 5.57 Nucleus
RRM1-40 Os02g0730800 399 43,547.8 6.15 Extracellular space
RRM1-41 Os02g0755400 176 18,512.61 9.99 Mitochondrion
RRM1-42 Os02g0757900 212 24,083.82 5.07 Nucleus
RRM1-43 Os02g0788300 295 32,235.18 7.72 Nucleus
RRM1-44 Os02g0788400 289 32,009.09 8.66 Nucleus
RRM1-45 Os02g0789400 185 21,023.33 11.24 Nucleus
RRM1-46 Os02g0815200 316 34,612.01 5.17 Chloroplast thylakoid lumen
RRM1-47 Os03g0123200 252 28,108.69 7.64 Nucleus
RRM1-48 Os03g0136800 296 32,305.94 9.02 Nucleus
RRM1-49 Os03g0174100 416 46,056.33 5.35 Nucleus
RRM1-50 Os03g0265600 125 13,993.55 7.86 Chloroplast
RRM1-51 Os03g0278300 238 24,720.42 9.83 Chloroplast
RRM1-52 Os03g0278500 647 72,627.76 8.43 Nucleus
RRM1-53 Os03g0278800 173 18,433.86 9.3 Chloroplast outer membrane
RRM1-54 Os03g0285900 330 37,042.2 11 Nucleus
RRM1-55 Os03g0286500 310 32,704.09 9 Extracellular space
RRM1-56 Os03g0298800 232 26,100.86 9.44 Chloroplast
RRM1-57 Os03g0326600 467 51,073.78 9.06 Nucleus
RRM1-58 Os03g0344100 264 29,782.1 10.08 Nucleus
RRM1-59 Os03g0363800 243 27,781.69 10.83 Nucleus
RRM1-60 Os03g0374575 217 25,589.48 11.17 Nucleus
RRM1-61 Os03g0376600 265 28,556.57 4.5 Chloroplast outer membrane
RRM1-62 Os03g0376900 464 49,564.37 6.39 Nucleus
RRM1-63 Os03g0388000 205 24,739.51 10.27 Nucleus
RRM1-64 Os03g0418800 523 56,761.18 8.75 Chloroplast
RRM1-65 Os03g0566500 429 46,194.37 9.62 Chloroplast
RRM1-66 Os03g0569900 402 43,945.82 5.34 Extracellular space
RRM1-67 Os03g0670700 196 20,375.4 6.73 Nucleus
RRM1-68 Os03g0681900 308 34,036.6 9.05 Nucleus
RRM1-69 Os03g0713600 284 30,904.71 5.06 Nucleus
RRM1-70 Os03g0748900 278 29,986.94 9.23 Nucleus
RRM1-71 Os03g0801800 959 105,396.52 9.48 Nucleus
RRM1-72 Os03g0809900 197 21,969.34 5.2 Nucleus
RRM1-73 Os03g0811700 130 14,710.82 9.49 Cloroplast
RRM1-74 Os03g0824300 523 58,186.08 7.22 Nucleus
RRM1-75 Os03g0826400 312 36,258.57 9.25 Nucleus
RRM1-76 Os03g0836200 205 21,823.38 8.29 Nucleus
RRM1-77 Os03g0854300 441 48,288.94 10.11 Nucleus
RRM1-78 Os04g0118900 245 28,783.89 9.94 Nucleus
RRM1-79 Os04g0306800 649 72,026.14 9.09 Nucleus
RRM1-80 Os04g0372800 486 51,446 5.1 Nucleus
RRM1-81 Os04g0394300 903 97,243.83 8.7 Nucleus
RRM1-82 Os04g0414300 137 15,074.25 9.93 Chloroplast
RRM1-83 Os04g0449900 387 41,807.64 8.68 Extracellular space
RRM1-84 Os04g0467300 484 51,314.72 7.33 Nucleus
RRM1-85 Os04g0496400 476 53,576.63 4.69 Nucleus
RRM1-86 Os04g0497600 435 48,295.81 5.49 Nucleus
RRM1-87 Os04g0504800 659 71,231.24 8.95 Extracellular space
RRM1-88 Os04g0510500 462 51,785.72 5.01 Nucleus
RRM1-89 Os04g0543200 774 86,649.43 5.64 Nucleus
RRM1-90 Os04g0591000 291 31,672.86 6.05 Mitochondrion
RRM1-91 Os04g0611500 536 60,240.64 9.16 Nucleus
RRM1-92 Os04g0620700 707 75,253.44 4.85 Nucleus
RRM1-93 Os04g0624800 376 40,858.93 5.59 Nucleus
RRM1-94 Os04g0625800 425 46,195.8 5.99 Extracellular space
RRM1-95 Os04g0636900 515 52,204.84 5.79 Nucleus
RRM1-96 Os04g0641400 144 16,026.58 4.61 Nucleus
RRM1-97 Os04g0682400 1,008 110,200.99 6.17 Nucleus
RRM1-98 Os04g0684500 901 101,135.53 6.65 Chloroplast inner membrane
RRM1-99 Os05g0102800 955 104,522 6.01 Nucleus
RRM1-100 Os05g0105900 380 42,434.11 12.18 Nucleus
RRM1-101 Os05g0114500 290 32,890.31 6.85 Nucleus
RRM1-102 Os05g0120100 323 36,222.41 10.83 Nucleus
RRM1-103 Os05g0140500 204 22,104.33 5.18 Nucleus
RRM1-104 Os05g0154800 253 28,203.66 9.2 Cytoplasm
RRM1-105 Os05g0162600 338 39,019.1 9.83 Nucleus
RRM1-106 Os05g0223200 104 11,486.44 8.03 Nucleus
RRM1-107 Os05g0223300 102 11,702.99 5.06 Nucleus
RRM1-108 Os05g0303700 254 29,800.11 8.77 Nucleus
RRM1-109 Os05g0364600 319 36,105.16 11.2 Nucleus
RRM1-110 Os05g0373400 466 50,213.29 8.1 Nucleus
RRM1-111 Os05g0376000 209 23,394.61 9.14 Nucleus
RRM1-112 Os05g0437300 444 49,754.23 6.41 Nucleus
RRM1-113 Os06g0112400 261 27,763.35 6.23 Nucleus
RRM1-114 Os06g0127500 265 28,209.55 7.14 Nucleus
RRM1-115 Os06g0151200 300 32,650.85 5 Nucleus
RRM1-116 Os06g0170500 482 54,009.89 8.12 Nucleus
RRM1-117 Os06g0187900 185 21,183.36 11.29 Nucleus
RRM1-118 Os06g0219600 204 23,178.94 5.19 Nucleus
RRM1-119 Os06g0220600 343 36,170.91 9.63 Chloroplast outer membrane
RRM1-120 Os06g0248200 164 17,952.57 5.98 Nucleus
RRM1-121 Os06g0256200 294 31,817.7 10.97 Nucleus
RRM1-122 Os06g0566100 292 29,810.49 9.33 Nucleus
RRM1-123 Os06g0589700 399 43,823.12 9.17 Nucleus
RRM1-124 Os06g0622900 275 29,594.2 8.39 Nucleus
RRM1-125 Os06g0670400 469 53,864.27 5.38 Nucleus
RRM1-126 Os06g0670500 564 64,975.32 5.63 Nucleus
RRM1-127 Os06g0687500 219 23,922.07 9.52 Endomembrane system
RRM1-128 Os06g0698400 123 13,222.7 5 Nucleus
RRM1-129 Os06g0724600 164 18,503.88 10.31 Nucleus
RRM1-130 Os07g0102500 438 47,703.93 9.53 Nucleus
RRM1-131 Os07g0124600 377 41,006.31 6.68 Nucleus
RRM1-132 Os07g0158300 364 39,084.91 4.61 Mitochondrion
RRM1-133 Os07g0180800 411 46,253.74 9.65 Nucleus
RRM1-134 Os07g0237100 340 36,144.67 10.27 Chloroplast
RRM1-135 Os07g0281000 486 54,334.99 6.72 Nucleus
RRM1-136 Os07g0296200 394 43,291.14 8.3 Nucleus
RRM1-137 Os07g0516900 251 27,613.79 6.3 Extracellular space
RRM1-138 Os07g0549800 133 14,421.25 9.41 Chloroplast outer membrane
RRM1-139 Os07g0583500 474 54,197.46 6.55 Extracellular space
RRM1-140 Os07g0584500 472 50,477.44 5.94 Nucleus
RRM1-141 Os07g0602600 238 23,564.23 8.54 Mitochondrion
RRM1-142 Os07g0603100 569 62,175.74 6.15 Nucleus
RRM1-143 Os07g0615400 427 46,723.56 7.19 Nucleus
RRM1-144 Os07g0623300 275 32,242.91 11.35 Nucleus
RRM1-145 Os07g0631900 264 28,099.31 4.75 Chloroplast thylakoid lumen
RRM1-146 Os07g0633200 213 24,820.57 10.68 Nucleus
RRM1-147 Os07g0663300 427 46,493.89 9.17 Nucleus
RRM1-148 Os07g0673500 296 33,141.48 10.64 Nucleus
RRM1-149 Os08g0113200 838 95,016.62 5.47 Endomembrane system
RRM1-150 Os08g0116400 302 32,739.26 6.4 Nucleus
RRM1-151 Os08g0117100 319 35,941.88 6.02 Chloroplast outer membrane
RRM1-152 Os08g0139000 111 11,938.8 9.55 Chloroplast outer membrane
RRM1-153 Os08g0190200 442 47,809.63 5.86 Extracellular space
RRM1-154 Os08g0192900 572 60,393.68 4.98 Nucleus
RRM1-155 Os08g0314800 660 71,558.46 7.55 Nucleus
RRM1-156 Os08g0320100 350 36,738.65 9.22 Nucleus
RRM1-157 Os08g0385900 279 32,947.48 11.88 Nucleus
RRM1-158 Os08g0412200 214 25,104.07 10.05 Chloroplast
RRM1-159 Os08g0416400 503 54,742.2 7.66 Nucleus
RRM1-160 Os08g0427900 286 30,491.17 11.05 Nucleus
RRM1-161 Os08g0436000 461 49,888.14 6.46 Nucleus
RRM1-162 Os08g0483200 269 29,132.14 9.39 Mitochondrion
RRM1-163 Os08g0486200 289 33,541.09 11.8 Nucleus
RRM1-164 Os08g0490300 603 64,733.85 6.09 Nucleus
RRM1-165 Os08g0492100 362 38,125.83 9.22 Nucleus
RRM1-166 Os08g0504600 684 75,299.38 6.19 Nucleus
RRM1-167 Os08g0520300 447 48,765.28 6.86 Nucleus
RRM1-168 Os08g0547000 294 31,708.05 7.08 Nucleus
RRM1-169 Os08g0557100 194 21,388.83 4.95 Chloroplast
RRM1-170 Os08g0567200 235 26,254.56 9.77 Nucleus
RRM1-171 Os09g0115400 662 71,630.27 6.45 Mitochondrion
RRM1-172 Os09g0123200 738 79,658.29 9.09 Nucleus
RRM1-173 Os09g0279500 245 26,681.14 8.53 Chloroplast thylakoid lumen
RRM1-174 Os09g0298700 1,005 110,844.59 6.79 Nucleus
RRM1-175 Os09g0299500 160 17,315.17 5.76 Extracellular space
RRM1-176 Os09g0314500 353 38,868.39 5.96 Nucleus
RRM1-177 Os09g0462700 441 46,949.78 8.52 Chloroplast
RRM1-178 Os09g0476100 604 64,263.07 6.3 Nucleus
RRM1-179 Os09g0491756 290 34,087.52 8.92 Nucleus
RRM1-180 Os09g0513700 375 43,193.42 9.74 Nucleus
RRM1-181 Os09g0516300 900 97,198.57 6.85 Nucleus
RRM1-182 Os09g0527100 149 16,616.66 8.8 Nucleus
RRM1-183 Os09g0527500 235 25,960.25 8.81 Nucleus
RRM1-184 Os09g0549500 276 29,500.33 9.18 Nucleus
RRM1-185 Os09g0565200 322 35,425.05 4.41 Mitochondrion
RRM1-186 Os10g0115600 463 55,113.96 9.1 Nucleus
RRM1-187 Os10g0151800 438 47,821.62 4.98 Nucleus
RRM1-188 Os10g0167500 374 40,267.56 3.97 Nucleus
RRM1-189 Os10g0321700 317 32,244.11 4.59 Chloroplast thylakoid lumen
RRM1-190 Os10g0439600 330 34,829.59 4.96 Nucleus
RRM1-191 Os10g0457000 355 38,849.39 8.55 Nucleus
RRM1-192 Os10g0470900 464 45,620.47 6.24 Nucleus
RRM1-193 Os10g0569200 719 83,181.8 4.98 Nucleus
RRM1-194 Os11g0100200 219 24,033.05 9.87 Nucleus
RRM1-195 Os11g0133600 298 32,998.39 7.65 Nucleus
RRM1-196 Os11g0139500 189 21,471.25 4.13 Extracellular space
RRM1-197 Os11g0176100 495 52,955.01 6.43 Extracellular space
RRM1-198 Os11g0250000 441 48,446.94 5.68 Nucleus
RRM1-199 Os11g0549537 242 26,479.77 6.08 Chloroplast
RRM1-200 Os11g0620100 441 47,561.26 6.86 Nucleus
RRM1-201 Os11g0636900 550 61,141.76 7.78 Nucleus
RRM1-202 Os11g0637700 467 49,048.64 8.44 Nucleus
RRM1-203 Os11g0704700 511 57,960.23 10.14 Chloroplast
RRM1-204 Os12g0100100 228 24,809.9 9.87 Nucleus
RRM1-205 Os12g0131000 300 33,277.87 8.81 Chloroplast
RRM1-206 Os12g0136200 502 55,072.87 5.03 Nucleus
RRM1-207 Os12g0502200 258 25,044.52 4.74 Mitochondrion
RRM1-208 Os12g0572400 263 30,186.19 10.9 Nucleus
RRM1-209 Os12g0572800 1,160 127,816.97 8.61 Plasma membrane
RRM1-210 Os12g0577100 414 47,380.57 9.1 Nucleus
RRM1-211 Os12g0587100 947 106,893.09 9.14 Nucleus
RRM1-212 Os12g0632000 162 16,083.1 6.31 Nucleus

Note:

RAP represents the gene ID of OsRRM1 gene, NAA represents the number of amino acids of the OsRRM1 gene, MW represents the molecular weight of OsRRM1 gene, and PI represents the isoelectric point of OsRRM1 gene. On the far right is the subcellular localization of the OsRRM1 gene.

Chromosome localization and phylogenetic tree analysis of the OsRRM1 gene family

The positions of 212 OsRRM1 genes on chromosomes were mapped using TBtools software (Fig. 2). There were 212 OsRRM1 genes distributed on all 12 chromosomes, among which the 31 OsRRM1 genes on chromosome 3 were the most distributed, and only eight OsRRM1 genes were on chromosome 10, being the least distributed. Distinct gene clusters were formed on chromosomes 1, 2, and 3.

Figure 2. Chromosome mapping of OsRRM1 gene family.

Figure 2

OsRRM1 gene is widely distributed in twelve chromosomes of rice, and the position of OsRRM1 gene of chromosome in rice can be inferred according to the picture.

Phylogenetic trees of the 212 OsRRM1 proteins were constructed (Fig. 3). By analyzing the structure of the evolutionary tree, these proteins could be divided into five classes. The group V contained the highest number of OsRRM1 proteins (61). The group III contained 58 RRM1 proteins, while the group II and group IV contained 33 and 53 RRM1 proteins, respectively. The group I had the lowest number of RRM1 proteins (7). These groupings reflect the correlation and kinship between OsRRM1 protein sequences. By studying the differences and similarities between these groups, we can better understand the evolution and functions of OsRRM1 proteins.

Figure 3. Phylogenetic tree of OsRRM1 gene family.

Figure 3

MEGA11.0 with the bootstrap value of 1,000 and use default for other parameters. Different subfamilies are highlighted using different colors.

Motif analysis and gene structure analysis of the OsRRM1 gene family

Gene structures and conserved motifs are one of the conserved expression modes of gene families. To better understand the structure of the OsRRM1 gene, the exon intron structure of the OsRRM1 gene was analyzed using annotated information from the rice reference genome (Fig. S1). The results show that the number, type, and order of conserved motifs in the OsRRM1 gene family were different. The sequence length and gene structure were also very different. This may be the result of replication of these sequences. However, according to the cluster analysis, the conserved motifs and gene structures of each category had similar distributions, which proves that the classification results are reliable.

The MEME online prediction tool was used to identify the conserved motifs of rice OsRRM1 proteins. Multiple motifs existed in the 212 OsRRM1 protein sequences (Fig. S1), and the types and numbers of motifs were highly overlapping. In addition, gene families within the same subfamily in the evolutionary tree were composed similarly on the motif. The gene families of the same subfamily in the phylogenetic tree were similar in motif composition, reflecting the sharing or similarity of their functions.

Evolutionary analysis of the OsRRM1 gene family and collinearity analysis between rice and Arabidopsis

A phylogenetic tree was constructed by comparing 212 and 230 AtRRM1—a total of 442 members. According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five groups (Figs. S2S7). Most of the RRM1 protein members of rice and Arabidopsis do not cluster into their own clades. Each subfamily contains members of the RRM1 family of Arabidopsis and rice, and the members of each subfamily may have similar functions and domains. According to the phylogenetic relationship of the protein sequences, the function of the OsRRM1 protein can be predicted by the function of the plant RRM1 protein, the function of which is known.

To further explore the evolutionary relationships of the OsRRM1 gene family, collinearity analysis between rice and Arabidopsis was conducted. The results (Fig. 4) show that 20 pairs of RRM1 genes in the two species were collinear, while no collinearity was found on chromosomes 8, 9, 10, 11, and 12 of rice or chromosome 4 of Arabidopsis. The analysis suggests that 20 pairs of RRM1 genes may have similar functions in rice and Arabidopsis, and were conserved during evolution.

Figure 4. The synteny analysis RRM1 gene family in Arabidopsis and rice.

Figure 4

The segmental duplication gene pairs were linked by the lines between chromosomes.

GO and KEGG analysis of the OsRRM1 gene family

GO annotation results (Fig. 5A) show that the OsRRM1 gene family plays an important role in the alternative mRNA splicing, pre-spliceosome, RNA splicing, U2-type spliceosomal complex, defense response, immune response, immune system process, innate immune response. KEGG analysis (Fig. 5B) showed that the OsRRM1 gene family plays an important role in spliceosome, RNA processing and transport. For example, RRM1-185 (Os09g0565200) enhances rice resistance. By regulating the stability of chloroplast mRNA, it is important for the mRNA stability of NAD (P) H dehydrogenase (NDH) complex (Bang et al., 2021). RRM1-212 (Os12g0632000) is related to mRNA splice and ribosome synthesis. Under heat shock conditions, it may be involved in regulating RNA transport from specific stress-related genes to the nucleus, maintaining RNA stability and protein translation, etc. Overdosage of RRM1-212 can improve its tolerance to high temperature stress (Sahi et al., 2007). RRM1-113 (Os06g0112400), named PigmR, promotes the accumulation of PIBP in the nucleus to activate immunity (Zhai et al., 2019). As a transcription factor, PIBP1 can directly bind to the promoters of defense genes OsWAK14 and OsPAL1 to activate their expression. When PIBP1 and Os06g02240 were knocked out, blast resistance was greatly reduced (Zhai et al., 2019). Overexpression of RRM1-208 (Os12g0572400) (OsSCL30-OE) decreased the resistance of rice to low temperature, drought and salt stress, and led to the accumulation of reactive oxygen species (Zhang et al., 2022). These results further confirm the reported function of the OsRRM1 gene.

Figure 5. Gene function enrichment analysis.

Figure 5

(A) Analysis of GO of OsRRMl gene family; (B) KEGG annotation of OsRRMl gene family.

Characterization of presumptive cis-regulatory elements in the promoter region of the OsRRM1 gene

In plants’ response to stress, gene expression is closely related to cis-regulatory elements in the promoter region. Using the PlantCARE online analysis tool, the promoter of the rice OsRRM1 gene was predicted in the 2,000 bp region, and five stress-response regulatory elements were found, including the TGACG motif (involved in the JA response), CGTCA motif (involved in the MeJA response), ABRE motif (involved in abscisic acid stress), TCA element (involved in salicylic acid reactivity) and WUN motif (wound response element). In the OsRRM1 gene family, the element associated with the largest number of stress response elements was ABRE (Fig. S8), and ABA was synthesized mainly in response to blast stress. These results show that the stress-related response elements of the OsRRM1 gene were relatively intact, suggesting that it might be involved in regulation of the stress response in rice. However, the types and amounts of stress-related elements contained in each OsRRM1 gene promoter were different, which also indicates that each OsRRM1 had different responses to different stresses.

Expression pattern of the RRM1 gene family in rice after treatment with blast fungus

Using RNA-seq data, heat maps of the 212 OsRRM1 genes represented by log2-fold-change values were constructed at different time periods after infection with rice blast (Fig. 6). All OsRRM1 genes were expressed, and three major clusters of expression patterns were distinguished according to the expression specificity at different time periods after treatment. The RRM1 gene in two clusters showed an obvious up-regulation trend.

Figure 6. Expression heat map of OsRRM1 gene family treated with rice blast.

Figure 6

Expression level is expressed by color and intensity: dark red indicates highest expression level, dark blue indicates lowest expression level. Other colors represent intermediate levels of expression.

Expression analysis of the OsRRM1 gene in response to biological stress

To further investigate the expression changes of OsRRM1 gene under biological stress, we selected eight OsRRM1 genes from five phylogenetic groups by analyzing GO and KEGG results and expression heat maps. The transcription level of eight OsRRM1 genes was measured by qRT-PCR. Rice seedlings were cultured in an artificial growth chamber until the two-leaf stage (about 14 d), and qRT-PCR was performed at 0, 12, 24, 36 and 48 h after infection with P. oryzae. Disease spots were observed on rice leaves after 7 days (Fig. S9). As shown in the figure (Fig. 7), there was no significant difference in the expression level of RRM1-193 (group I) under blast stress. The expression level of RRM1-79 (group II) was slightly down-regulated under blast stress, but the difference was not obvious. There was no significant difference in the expression of RRM1-10 (group III) under blast stress. The expression level of RRM1-37 (group IV) decreased significantly under blast stress. However, the expression levels of RRM1-15, RRM1-61, RRM1-76 and RRM1-207 (group V) were significantly increased under blast stress. Therefore, it is speculated that the RRM1 gene in group V plays a role in rice blast response.

Figure 7. Expression levels of OsRRM1 gene at different time periods under rice blast stress.

Figure 7

OsRRM1 gene expression levels at different periods under rice blast stress. Four OsRRM1 candidate genes were identified by GO and KEGG results analysis combined with expression heat maps, and their relative expression levels at different periods were verified by qRT-PCR. The X-axis represents 12, 24, 26 and 48 h after rice blast treatment, respectively. Error bars were obtained from three measurements. Note: The “stars” above the column indicated significant differences (p < 0.05) and (p < 0.01) respectively between different time stages.

Subcellular analysis of OsRRM1 genes

To further explore the subcellular localization of the OsRRM1 protein, transient expression of OsRRM1-15 and OsRRM1-207 was performed in tobacco epidermal cells. Confocal laser microscopy revealed green fluorescent protein signals of OsRRM1-15 on the nucleus and cell membrane (Fig. 8) and of OsRRM1-207 on the nucleus, cell membrane, and cytoplasm, indicating the locations of these genes.

Figure 8. Subcellular localization of OsRRM1 protein.

Figure 8

Green fluorescent protein signals were detected on the nucleus and cell membrane of OsRRM1-15, while green fluorescent protein signals were detected on the nucleus, cell membrane and cytoplasm of OsRRM1-207. “GFP” stands for RRM1 gene green fluorescence. “BFP” stands for marker gene blue fluorescence. Bright field and superimposed are in the back.

Discussion

This study used bioinformatics to identify and characterize the whole genome of the RRM1 gene family in rice. The family’s gene structure, physical and chemical properties, and domain and phylogenetic characteristics were also studied. In addition, RNA-seq was used to analyze the expression patterns of the RRM1 gene family at different times after rice blast fungus treatment. Expression changes in RRM1 family genes in response to stress were analyzed by quantitative real-time PCR. This study increases our understanding of the OsRRM1 gene family, providing (1) a basis for further investigation of its functions in response to rice blast infection and (2) a theoretical basis for more general study of its functions.

Bioinformatics has been used to identify the whole genome of the rice OsRRM1 gene family. The length of amino acids encoded by 212 OsRRM1 genes ranges from 53 to 1,160 aa. Cléry, Blatter & Allain (2008) indicate that the length of RRM is 90 amino acids, indicating that there are a large number of introns in the RRM1 gene in rice that are largely discarded during transcription and translation (Fig. 3). It is now clear that RRM1 is an important domain that needs to be further understood and that further biochemical and structural studies are needed to obtain a complete model of its role in cell (Cléry, Blatter & Allain, 2008). The RRM1 gene family is found in many species, with 230 of its genes having been identified in Arabidopsis and 212 in rice. Previous studies have shown that the complete Arabidopsis genome contains proteins with RRM and KH RNA binding domains, and encodes 196 RRM proteins (Lorković & Barta, 2002). The phylogenetic tree of the RRM1 protein in rice and Arabidopsis shows that there are multiple pairs of RRM1 homologous genes in these species, suggesting that these genes have similar amino acid sequences and may have similar functions. Since rice is a monocotyledonous plant and Arabidopsis is a dicotyledonous plant, it can be inferred that the time of RRM1 gene evolution may be earlier than the time of species differentiation. In addition, there were multiple gene clusters on some chromosomes, which may be attributed to tandem duplication, resulting in gene amplification, which is of great significance in evolution.

Subcellular localization prediction showed that the OsRRM1 gene was mainly located in the nucleus and less so in the extracellular matrix, mitochondria, chloroplast, cell membrane, and intracytoplasmic matrix, indicating that the above proteins mainly function in the nucleus. Subcellular localization of the two OsRRM1 proteins was performed. Confocal laser microscopy revealed GFP signals of OsRRM1-15 in the nucleus and cell membrane (Fig. 7), while signals of OsRRM1-207 were detected in the nucleus, cell membrane, and cytoplasm, indicating these genes’ locations (Fig. 8) and confirming the predicted results. According to subcellular localization prediction tools, 23 Arabidopsis RRM proteins are reported to be located in chloroplasts and 10 in mitochondria (Shi, Hanson & Bentolila, 2017). This may be because the main function of RRM genes is to participate in post-transcriptional regulation. Only fully transcribed transcripts can exit the nucleus, which also occurs to a small extent in mitochondria and chloroplasts. In chromosome localization, 212 RRM1 genes were found to be distributed on 12 chromosomes.

Among the 212 OsRRM1 gene sequences, CDS and introns had different numbers and large spans. However, analysis of 10 amino-acid-conserved motifs showed that the conserved sequences of OsRRM1 were mostly similar, especially in homologous sequences (Fig. S1). The results also show that OsRRM1 genes among the same group have a similar structure, but there are differences in intron length, which may be related to alternative splicing combined with KEGG junctions. By using MEME, multiple conserved motifs were found to exist in 212 OsRRM1 protein sequences, and the types and quantities of these motifs were highly overlapping (Fig. S1). The similarity in motif composition of OsRRM1 gene families in different subfamilies reflects their functional similarity.

Studies have shown that RRM1-69 can specifically interact with PigmR and other similar NLRs to trigger resistance to blast in rice. PigmR promotes the accumulation of PIBP1 in the nucleus and improves the resistance of rice to blast (Zhai et al., 2019). This gene is located in the third subgroup and is homologous to PIBP2, which has the function of regulating an antifungal innate immune response. PIBP2 is the RRM1-113 in this study, which is also located in the third subgroup and is very closely related (Fig. 3), which validates our results to a certain extent. In this study, RRM1-93 also had a strong homology relationship with PIBP1 and PIBP2 (Fig. 5).

As previous studies have shown, the RRM protein in plant organelles is involved in various RNA processes, regulating plant development (such as flowering) and plant stress responses (Shi, Hanson & Bentolila, 2017). Moreover, this gene family is highly enriched in alternative splicing and mRNA assembly processes (Zhan et al., 2015). Studies have shown that both PSRP2 and ORRM5 have RNA-binding activity, and it is speculated that RRM proteins increase their RNA-binding energy as RNA chaperones under stress conditions (Jin et al., 2007; Kim et al., 2007; Xu et al., 2013). They are also involved in plant development and stress responses, sometimes acting as proteins or RNA-binding proteins (Shi et al., 2016; Wang et al., 2016). In addition, several RRM proteins have been reported to be involved in plant development and stress response (Kim et al., 2007; Kwak, Kim & Kang, 2005; Lorković, 2009; Vermel et al., 2002). It can be inferred that this gene family may be involved in immunity in rice by regulating downstream gene alternative splicing. Interestingly, the cis-regulatory elements in the promoter region play an important role in plant responses to stress. We identified five stress response cis-regulatory elements (Fig. S8) in the upstream 2,000 bp of these OsRRM1 genes, including the TGACG motif (involved in JA response), CGTCA motif (involved in MeJA response), ABRE motif (involved in abscisic acid stress), TCA element (involved in salicylic acid reactivity), TGACG motif (involved in JA response), TCA motif (involved in salicylic acid reactivity), and WUN motif (wound response element). These results indicate that the stress-related response elements of the OsRRM1 gene are relatively complete, suggesting that members of the OsRRM1 gene family regulate stress to a certain extent. To further explore the expression changes of OsRRM1 gene in response to biological stress, qRT-PCR was performed on four OsRRM1 genes candidates via GO and KEGG analyses, and the results combined with an expression heat map to measure the transcription level of OsRRM1 gene. There were differences in the expression levels of four OsRRM1 genes under rice blast stress, all of which were up-regulated after treatment (Fig. 7), indicating that OsRRM1 plays a certain role in the response to rice blast, which also verifies the results of Wang et al. (2016).

Conclusions

RRM is one of the most abundant protein domains in eukaryotes and is an important player in the regulation of development, signaling, gene expression and cell differentiation. In this study, the RRM1 gene family and its role in rice blast resistance were investigated by bioinformatics. There are 212 OsRRM1 genes, distributed across 12 chromosomes, with conserved structure and similar patterns. The study also revealed cis-acting elements related to rice stress resistance. GO and KEGG analyses shows that four of these genes play a key role in plant immunity. Gene expression analysis shows that most OsRRM1 had tissue-specific expression that changed significantly after rice blast treatment. These results contribute to the in-depth understanding of the OsRRM1 gene family and provide a basis for further study of its role in resisting rice blast infection.

Supplemental Information

Supplemental Information 1. Specific primers for subcellular localization of OsRRM1 gene.

Note: F is the forward primers, R is the reverse primers.

peerj-12-17668-s001.docx (11.7KB, docx)
DOI: 10.7717/peerj.17668/supp-1
Supplemental Information 2. Real-time quantitative fluorescent PCR (qRT-PCR) was used to evaluate the expression pattern of selected OsRRM1 gene after rice blast infection.

Above are the Cq values of the four candidate OsRRM1 genes and the internal reference gene actin. Samples were collected at 0, 12, 24, 36 and 48h after infection with Rice blast fungus (guy11). The table includes three experimental replicates and three biological replicates.

peerj-12-17668-s002.xlsx (22.8KB, xlsx)
DOI: 10.7717/peerj.17668/supp-2
Supplemental Information 3. Phylogenetic relationship, gene structure and conserved motif analysis of OsRRM1 genes.

Phylogenetic tree of 212 OsRRM1 proteins (left). Distributions of conserved motifs in OsRRM1 genes (middle). Ten putative motifs are indicated in different colored boxes. Exon/intron organization of OsRRM1 genes (right). Yellow boxes represent exons and black lines with same length represent introns. The upstream/ downstream region of OsRRM1 genes are indicated in green boxes. The length of exons can be inferred by the scale at the bottom.

peerj-12-17668-s003.pdf (276.2KB, pdf)
DOI: 10.7717/peerj.17668/supp-3
Supplemental Information 4. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis.

Phylogenetic tree was constructed by comparing 212 OsRRM1 and 230 AtRRM1 a total of 442 members. According to the topological structure of the evolutionary tree, RRM1 proteins of the two species can be divided into five groups.

DOI: 10.7717/peerj.17668/supp-4
Supplemental Information 5. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group I.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The red part is the first group, with a total of 18 RRM1 genes.

peerj-12-17668-s005.pdf (332.6KB, pdf)
DOI: 10.7717/peerj.17668/supp-5
Supplemental Information 6. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group II.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The orange part is the first group, with a total of 52 RRM1 genes.

peerj-12-17668-s006.pdf (643.6KB, pdf)
DOI: 10.7717/peerj.17668/supp-6
Supplemental Information 7. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group II.

According to the topological structure of the evolutionary tree, the R RM1 proteins of the two species can be divided into five classes. The green part is the first group, with a total of 66 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-7
Supplemental Information 8. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group IV.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The blue part is the first group, with a total of 142 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-8
Supplemental Information 9. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group V.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The purple part is the first group, with a total of 164 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-9
Supplemental Information 10. Predictive cis-regulatory elements in the promoter of OsRRM1 gene family.

Phylogenetic tree of 212 OsRRM1 proteins (left). Predictive cis-regulatory elements in OsRRM1 promoters (right). The five putative cis-regulating elements in the upper right corner are represented by different colored boxes. The length of the cis-regulating element can be inferred by the scale at the bottom.

DOI: 10.7717/peerj.17668/supp-10
Supplemental Information 11. Blast fungus was used to infect rice leaves.

(A) Rice leaves that grow normally for 21 days. (B) Rice leaves after seven days of blast fungus infection.

peerj-12-17668-s011.pdf (204.4KB, pdf)
DOI: 10.7717/peerj.17668/supp-11
Supplemental Information 12. MIQE checklist.

To determine the relative expression levels of four candidate OsRRM1 genes (OSRRM1-15, OSRRM1-61, OSRRM1-76, OSRRM1-207) after 12, 24, 36 and 48h of rice blast infection. Therefore, Comprehensive analysis of gene expression using quantitative real-time PCR and adherence to MIQE guidelines.

DOI: 10.7717/peerj.17668/supp-12

Funding Statement

This work was supported by the Double Thousand Plan of Jiangxi Province (No. jxsq2019101057). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Xinlei Jiang conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.

Shangwei Yu performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.

Yuhan Huang performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.

Junying Huang performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.

Shaochun Liu performed the experiments, prepared figures and/or tables, and approved the final draft.

Dewei Yang conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Junru Fu conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Haohua He conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Haihui Fu conceived and designed the experiments, analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Data Availability

The following information was supplied regarding data availability:

The raw measurements are available in the Supplemental File.

References

  • Adam et al. (1986).Adam SA, Nakagawa T, Swanson MS, Woodruff TK, Dreyfuss G. mRNA polyadenylate-binding protein: gene isolation and sequencing and identification of a ribonucleoprotein consensus sequence. Molecular and Cellular Biology. 1986;6(8):2932–2943. doi: 10.1128/mcb.6.8.2932-2943.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bandziulis, Swanson & Dreyfuss (1989).Bandziulis RJ, Swanson MS, Dreyfuss G. RNA-binding proteins as developmental regulators. Genes & Development. 1989;3(4):431–437. doi: 10.1101/gad.3.4.431. [DOI] [PubMed] [Google Scholar]
  • Bang et al. (2021).Bang SW, Lee HS, Park SH, Lee DK, Seo JS, Kim YS, Park SC, Kim JK. OsCRP1, a ribonucleoprotein gene, regulates chloroplast mRNA stability that confers drought and cold tolerance. International Journal of Molecular Sciences. 2021;22(4):1673. doi: 10.3390/ijms22041673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Birney, Kumar & Krainer (1993).Birney E, Kumar S, Krainer AR. Analysis of the RNA-recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Research. 1993;21(25):5803–5816. doi: 10.1093/nar/21.25.5803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Burd & Dreyfuss (1994).Burd CG, Dreyfuss G. Conserved structures and diversity of functions of RNA-binding proteins. Science. 1994;265(5172):615–621. doi: 10.1126/science.8036511. [DOI] [PubMed] [Google Scholar]
  • Chambers et al. (1988).Chambers JC, Kenan D, Martin BJ, Keene JD. Genomic structure and amino acid sequence domains of the human La autoantigen. Journal of Biological Chemistry. 1988;263(34):18043–18051. doi: 10.1016/S0021-9258(19)81321-2. [DOI] [PubMed] [Google Scholar]
  • Chen et al. (2020).Chen C, Chen H, Zhang Y, Thomas HR, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant. 2020;13(8):1194–1202. doi: 10.1016/j.molp.2020.06.009. [DOI] [PubMed] [Google Scholar]
  • Cléry, Blatter & Allain (2008).Cléry A, Blatter M, Allain FH. RNA recognition motifs: boring? Not quite. Current Opinion in Structural Biology. 2008;18(3):290–298. doi: 10.1016/j.sbi.2008.04.002. [DOI] [PubMed] [Google Scholar]
  • Dreyfuss, Kim & Kataoka (2002).Dreyfuss G, Kim VN, Kataoka N. Messenger-RNA-binding proteins and the messages they carry. Nature Reviews Molecular Cell Biology. 2002;3(3):195–205. doi: 10.1038/nrm760. [DOI] [PubMed] [Google Scholar]
  • Dreyfuss, Swanson & Piñol-Roma (1988).Dreyfuss G, Swanson MS, Piñol-Roma S. Heterogeneous nuclear ribonucleoprotein particles and the pathway of mRNA formation. Trends in Biochemical Sciences. 1988;13(3):86–91. doi: 10.1016/0968-0004(88)90046-1. [DOI] [PubMed] [Google Scholar]
  • Du et al. (2021).Du Z, Su Q, Wu Z, Huang Z, Bao J, Li J, Tu H, Zeng C, Fu J, He H. Genome-wide characterization of MATE gene family and expression profiles in response to abiotic stresses in rice (Oryza sativa) BMC Ecology and Evolution. 2021;21:141. doi: 10.1186/s12862-021-01873-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Gomes et al. (2001).Gomes J-E, Encalada SE, Swan KA, Shelton CA, Carter JC, Bowerman B. The maternal gene spn-4 encodes a predicted RRM protein required for mitotic spindle orientation and cell fate patterning in early C. elegans embryos. Development. 2001;128(21):4301–4314. doi: 10.1242/dev.128.21.4301. [DOI] [PubMed] [Google Scholar]
  • Jackson, Pombo & Iborra (2000).Jackson DA, Pombo A, Iborra F. The balance sheet for transcription: an analysis of nuclear RNA metabolism in mammalian cells. The FASEB Journal. 2000;14(2):242–254. doi: 10.1096/fasebj.14.2.242. [DOI] [PubMed] [Google Scholar]
  • Jeon et al. (2020).Jeon J, Lee GW, Kim KT, Park SY, Kim S, Kwon S, Huh A, Chung H, Lee DY, Kim CY, Lee YH. Transcriptome profiling of the rice blast fungus magnaporthe oryzae and its host Oryza sativa during infection. Molecular Plant-Microbe Interactions®. 2020;33(2):141–144. doi: 10.1094/MPMI-07-19-0207-A. [DOI] [PubMed] [Google Scholar]
  • Jeune & Ladurner (2004).Jeune EL, Ladurner AG. Book review. Protein Science. 2004;13(7):1950–1952. doi: 10.1110/ps.04753404. [DOI] [Google Scholar]
  • Jin et al. (2007).Jin SK, Su JP, Kyung JK, Yeon OK, Joo YK, Jinkyung S, Boseung J, Che-Hun J, Hunseung K. Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli. Nucleic Acids Research. 2007;35(2):506–516. doi: 10.1093/nar/gkl1076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kielkopf, Lücke & Green (2004).Kielkopf CL, Lücke S, Green MR. U2AF homology motifs: protein recognition in the RRM world. Genes & Development. 2004;18(13):1513–1526. doi: 10.1101/gad.1206204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kim et al. (2007).Kim JY, Park SJ, Jang B, Jung CH, Ahn S-j, Goh CH, Cho K, Han O, Kang H. Functional characterization of a glycine-rich RNA-binding protein 2 in Arabidopsis thaliana under abiotic stress conditions. The Plant Journal. 2007;50(3):439–451. doi: 10.1111/j.1365-313X.2007.03057.x. [DOI] [PubMed] [Google Scholar]
  • Kwak, Kim & Kang (2005).Kwak KJ, Kim YO, Kang H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. Journal of Experimental Botany. 2005;56(421):3007–3016. doi: 10.1093/jxb/eri298. [DOI] [PubMed] [Google Scholar]
  • Latchman (2011).Latchman DS. Transcriptional gene regulation in eukaryotes. Chicago: eLS; 2011. [Google Scholar]
  • Lee, Kim & Hwang (2012).Lee DH, Kim DS, Hwang BK. The pepper RNA-binding protein CaRBP1 functions in hypersensitive cell death and defense signaling in the cytoplasm. The Plant Journal. 2012;72(2):235–248. doi: 10.1111/j.1365-313X.2012.05063.x. [DOI] [PubMed] [Google Scholar]
  • Lorković (2009).Lorković ZJ. Role of plant RNA-binding proteins in development, stress response and genome organization. Trends in Plant Science. 2009;14(4):229–236. doi: 10.1016/j.tplants.2009.01.007. [DOI] [PubMed] [Google Scholar]
  • Lorković & Barta (2002).Lorković ZJ, Barta A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Research. 2002;30(3):623–635. doi: 10.1093/nar/30.3.623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Manandhar et al. (1998).Manandhar HK, Lyngs Jørgensen HJ, Mathur SB, Smedegaard-Petersen V. Suppression of rice blast by preinoculation with avirulent pyricularia oryzae and the nonrice pathogen bipolaris sorokiniana. Phytopathology. 1998;88(7):735–739. doi: 10.1094/PHYTO.1998.88.7.735. [DOI] [PubMed] [Google Scholar]
  • Maris, Dominguez & Allain (2005).Maris C, Dominguez C, Allain FH. The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression. The FEBS Journal. 2005;272(9):2118–2131. doi: 10.1111/j.1742-4658.2005.04653.x. [DOI] [PubMed] [Google Scholar]
  • Moriyama et al. (2018).Moriyama H, Urayama SI, Higashiura T, Le TM, Komatsu K. Chrysoviruses in Magnaporthe oryzae. Viruses. 2018;10(12):697. doi: 10.3390/v10120697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Nagai et al. (1990).Nagai K, Oubridge C, Jessen TH, Li J, Evans PR. Crystal structure of the RNA-binding domain of the U1 small nuclear ribonucleoprotein A. Nature. 1990;348(6301):515–520. doi: 10.1038/348515a0. [DOI] [PubMed] [Google Scholar]
  • Nasir et al. (2018).Nasir F, Tian L, Chang C, Li X, Gao Y, Tran LP, Tian C. Current understanding of pattern-triggered immunity and hormone-mediated defense in rice (Oryza sativa) in response to Magnaporthe oryzae infection. Seminars in Cell & Developmental Biology. 2018;83(4):95–105. doi: 10.1016/j.semcdb.2017.10.020. [DOI] [PubMed] [Google Scholar]
  • Nina & Biology FJCOiP (2002).Nina VF, Biology FJCOiP RNA-binding proteins in plants: the tip of an iceberg? Current Opinion in Plant Biology. 2002;5(5):452–459. doi: 10.1016/s1369-5266(02)00280-7. [DOI] [PubMed] [Google Scholar]
  • O’Bryan et al. (2013).O’Bryan MK, Clark BJ, McLaughlin EA, D’Sylva RJ, O’Donnell L, Wilce JA, Sutherland J, O’Connor AE, Whittle B, Goodnow CC, Ormandy CJ, Jamsai D. RBM5 is a male germ cell splicing factor and is required for spermatid differentiation and male fertility. PLOS Genetics. 2013;9(7):e1003628. doi: 10.1371/journal.pgen.1003628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Paukku et al. (2012).Paukku K, Backlund M, De Boer RA, Kalkkinen N, Kontula KK, Lehtonen JY. Regulation of AT1R expression through HuR by insulin. Nucleic Acids Research. 2012;40(12):5250–5261. doi: 10.1093/nar/gks170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Query, Bentley & Keene (1989).Query CC, Bentley RC, Keene JD. A common RNA recognition motif identified within a defined U1 RNA binding domain of the 70K U1 snRNP protein. Cell. 1989;57(1):89–101. doi: 10.1016/0092-8674(89)90175-X. [DOI] [PubMed] [Google Scholar]
  • Sachs, Davis & Kornberg (1987).Sachs AB, Davis RW, Kornberg RD. A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability. Molecular and Cellular Biology. 1987;7(9):3268–3276. doi: 10.1128/mcb.7.9.3268-3276.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sahi et al. (2007).Sahi C, Agarwal M, Singh A, Grover A. Molecular characterization of a novel isoform of rice (Oryza sativa L.) glycine rich-RNA binding protein and evidence for its involvement in high temperature stress response. Plant Science. 2007;173(2):144–155. doi: 10.1016/j.plantsci.2007.04.010. [DOI] [Google Scholar]
  • Shi et al. (2016).Shi X, Germain A, Hanson MR, Bentolila S. RNA recognition motif-containing protein ORRM4 broadly affects mitochondrial RNA editing and impacts plant development and flowering. Plant Physiology. 2016;170(1):294–309. doi: 10.1104/pp.15.01280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shi, Hanson & Bentolila (2017).Shi X, Hanson MR, Bentolila S. Functional diversity of Arabidopsis organelle-localized RNA-recognition motif-containing proteins. Wiley Interdisciplinary Reviews: RNA. 2017;8(5):1105. doi: 10.1002/wrna.1420. [DOI] [PubMed] [Google Scholar]
  • Vermel et al. (2002).Vermel M, Guermann B, Delage L, Grienenberger JM, Maréchal-Drouard L, Gualberto JM. A family of RRM-type RNA-binding proteins specific to plant mitochondria. Proceedings of the National Academy of Sciences USA. 2002;99(9):5866–5871. doi: 10.1073/pnas.092019599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2016).Wang S, Bai G, Wang S, Yang L, Yang F, Wang Y, Zhu JK, Hua J. Chloroplast RNA-binding protein RBD1 promotes chilling tolerance through 23S rRNA processing in Arabidopsis. PLOS Genetics. 2016;12(5):e1006027. doi: 10.1371/journal.pgen.1006027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Woloshen, Huang & Li (2011).Woloshen V, Huang S, Li X. Review article RNA-binding proteins in plant immunity. Journal of Pathogens. 2011;2011:278697. doi: 10.4061/2011/278697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xu et al. (2013).Xu T, Lee K, Gu L, Kim J-I, Kang H. Functional characterization of a plastid-specific ribosomal protein PSRP2 in Arabidopsis thaliana under abiotic stress conditions. Plant Physiology and Biochemistry. 2013;73:405–411. doi: 10.1016/j.plaphy.2013.10.027. [DOI] [PubMed] [Google Scholar]
  • Yang et al. (2020).Yang D, Li S, Zheng Z, Lu L, Cui H. Transcriptome analysis of the rice response to blast fungus identified core genes involved in immunity. Plant Cell and Environment. 2020;44(9):3103–3121. doi: 10.1111/pce.14098. [DOI] [PubMed] [Google Scholar]
  • Zhai et al. (2019).Zhai K, Deng Y, Liang D, Tang J, Liu J, Yan B, Yin X, Lin H, Chen F, Yang D, Xie Z, Liu J-Y, Li Q, Zhang L, He Z. RRM transcription factors interact with NLRs and Regulate broad-spectrum blast resistance in rice. Molecular Cell. 2019;74(5):996–1009.e1007. doi: 10.1016/j.molcel.2019.03.013. [DOI] [PubMed] [Google Scholar]
  • Zhan et al. (2015).Zhan X, Qian B, Cao F, Wu W, Yang L, Guan Q, Gu X, Wang P, Okusolubo TA, Dunn SL, Zhu J-K, Zhu J. An Arabidopsis PWI and RRM motif-containing protein is critical for pre-mRNA splicing and ABA responses. Nature Communications. 2015;6(1):8139. doi: 10.1038/ncomms9139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zhang et al. (2022).Zhang J, Sun Y, Zhou Z, Zhang Y, Yang Y, Zan X, Li X, Wan J, Gao X, Chen R, Huang Z, Li L, Xu Z. OsSCL30 overexpression reduces the tolerance of rice seedlings to low temperature, drought and salt. Scientific Reports. 2022;12:8385. doi: 10.1038/s41598-022-12438-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information 1. Specific primers for subcellular localization of OsRRM1 gene.

Note: F is the forward primers, R is the reverse primers.

peerj-12-17668-s001.docx (11.7KB, docx)
DOI: 10.7717/peerj.17668/supp-1
Supplemental Information 2. Real-time quantitative fluorescent PCR (qRT-PCR) was used to evaluate the expression pattern of selected OsRRM1 gene after rice blast infection.

Above are the Cq values of the four candidate OsRRM1 genes and the internal reference gene actin. Samples were collected at 0, 12, 24, 36 and 48h after infection with Rice blast fungus (guy11). The table includes three experimental replicates and three biological replicates.

peerj-12-17668-s002.xlsx (22.8KB, xlsx)
DOI: 10.7717/peerj.17668/supp-2
Supplemental Information 3. Phylogenetic relationship, gene structure and conserved motif analysis of OsRRM1 genes.

Phylogenetic tree of 212 OsRRM1 proteins (left). Distributions of conserved motifs in OsRRM1 genes (middle). Ten putative motifs are indicated in different colored boxes. Exon/intron organization of OsRRM1 genes (right). Yellow boxes represent exons and black lines with same length represent introns. The upstream/ downstream region of OsRRM1 genes are indicated in green boxes. The length of exons can be inferred by the scale at the bottom.

peerj-12-17668-s003.pdf (276.2KB, pdf)
DOI: 10.7717/peerj.17668/supp-3
Supplemental Information 4. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis.

Phylogenetic tree was constructed by comparing 212 OsRRM1 and 230 AtRRM1 a total of 442 members. According to the topological structure of the evolutionary tree, RRM1 proteins of the two species can be divided into five groups.

DOI: 10.7717/peerj.17668/supp-4
Supplemental Information 5. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group I.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The red part is the first group, with a total of 18 RRM1 genes.

peerj-12-17668-s005.pdf (332.6KB, pdf)
DOI: 10.7717/peerj.17668/supp-5
Supplemental Information 6. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group II.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The orange part is the first group, with a total of 52 RRM1 genes.

peerj-12-17668-s006.pdf (643.6KB, pdf)
DOI: 10.7717/peerj.17668/supp-6
Supplemental Information 7. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group II.

According to the topological structure of the evolutionary tree, the R RM1 proteins of the two species can be divided into five classes. The green part is the first group, with a total of 66 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-7
Supplemental Information 8. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group IV.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The blue part is the first group, with a total of 142 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-8
Supplemental Information 9. Evolutionary analysis of RRM1 gene family between rice and Arabidopsis in Group V.

According to the topological structure of the evolutionary tree, the RRM1 proteins of the two species can be divided into five classes. The purple part is the first group, with a total of 164 RRM1 genes.

DOI: 10.7717/peerj.17668/supp-9
Supplemental Information 10. Predictive cis-regulatory elements in the promoter of OsRRM1 gene family.

Phylogenetic tree of 212 OsRRM1 proteins (left). Predictive cis-regulatory elements in OsRRM1 promoters (right). The five putative cis-regulating elements in the upper right corner are represented by different colored boxes. The length of the cis-regulating element can be inferred by the scale at the bottom.

DOI: 10.7717/peerj.17668/supp-10
Supplemental Information 11. Blast fungus was used to infect rice leaves.

(A) Rice leaves that grow normally for 21 days. (B) Rice leaves after seven days of blast fungus infection.

peerj-12-17668-s011.pdf (204.4KB, pdf)
DOI: 10.7717/peerj.17668/supp-11
Supplemental Information 12. MIQE checklist.

To determine the relative expression levels of four candidate OsRRM1 genes (OSRRM1-15, OSRRM1-61, OSRRM1-76, OSRRM1-207) after 12, 24, 36 and 48h of rice blast infection. Therefore, Comprehensive analysis of gene expression using quantitative real-time PCR and adherence to MIQE guidelines.

DOI: 10.7717/peerj.17668/supp-12

Data Availability Statement

The following information was supplied regarding data availability:

The raw measurements are available in the Supplemental File.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES