Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Sep 3.
Published in final edited form as: Biochem Biophys Res Commun. 2024 May 29;723:150189. doi: 10.1016/j.bbrc.2024.150189

Exploring the role of Casein Kinase 1α Splice Variants Across Cancer Cell Lines

Ricardo A Meléndez 1,2, Daniel T Wynn 2, Siva Bharath Merugu 2, Prerna Singh 2, Kenton P Kaplan 2, David J Robbins 2,*
PMCID: PMC11287285  NIHMSID: NIHMS2003985  PMID: 38852281

Abstract

Casein kinase 1α (CK1α) is a serine/threonine protein kinase that acts in various cellular processes affecting cell division and signal transduction. CK1α is present as multiple splice variants that are distinguished by the presence or absence of a long insert (L-insert) and a short carboxyl-terminal insert (S-insert). When overexpressed, zebrafish CK1α splice variants exhibit different biological properties, such as subcellular localization and catalytic activity. However, whether endogenous, alternatively spliced CK1α gene products also differ in their biological functions has yet to be elucidated. Here, we identify a panel of splice variant specific CK1α antibodies and use them to show that four CK1α splice variants are expressed in mammals. We subsequently show that the relative abundance of CK1α splice variants varies across distinct mouse tissues and between various cancer cell lines. Furthermore, we identify pathways whose expression is noticeably altered in cell lines enriched with select splice variants of CK1α. Finally, we show that the S-insert of CK1α promotes the growth of HCT 116 cells as cells engineered to lack the S-insert display decreased cell growth. Together, we provide tools and methods to identify individual CK1α splice variants, which we use to begin to uncover the differential biological properties driven by specific splice variants of mammalian CK1α.

Keywords: Casein kinase 1α, splice variants, cancer

INTRODUCTION

Casein kinases were among the first protein kinases discovered [1]. Named due to their ability to phosphorylate the non-physiological exogenous substrate casein [2], casein kinases are implicated in multiple cellular roles including signal transduction, cell division, circadian rhythm, and metabolism [3–6]. Two kinases were initially described, casein kinase 1 and casein kinase 2 (CK1 and CK2, respectively), which were later shown to be derived from distinct gene families [7]. Multiple isoforms of CK1 have been characterized, each stemming from separate genes: α, β, γ1, γ2, γ3, δ, and ε [8–11]. These isoforms have been observed in several metazoan species [12–14]. CK1α is the smallest CK1 family member and has functions distinct from the other isoforms [12]. These functions include the attenuation of Wnt signaling via phosphorylation of β-catenin [15, 16], regulation of mitotic spindles during mitosis [17, 18], inhibition of Hedgehog signaling [19, 20], regulating the circadian clock [4], and suppressing RAS-induced autophagy [21].

As CK1α is a component of multiple cellular processes, its dysregulation is implicated in diseases such as cancer, Alzheimer’s disease, and Parkinson’s disease [22–24]. There are multiple instances of CK1α dysregulation in cancer: colorectal cancer (CRC) patients with low levels of CK1α had a worse prognosis than patients with high CK1α levels [25]. Activation of CK1α in prostate cancers leads to degradation of β-Catenin, which in turn leads to a decrease in the expression of MYC [26]. CK1α haploinsufficiency leads to an increase in hematopoietic stem cell populations that may serve as precursors to myeloid malignancies such as del(5q) myelodysplastic syndrome [22, 27]. Conversely, CK1α is present in high levels in malignant melanoma [28] and appears to have a role in promoting lung cancer proliferation [29]. Thus, CK1α appears to have tumor suppressing and promoting functions that are context dependent. All of this has made CK1α a proposed target for therapeutics that either activate or attenuate its activity to halt tumor growth [30].

The CSNK1A1 gene encodes multiple transcripts of CK1α, [11, 31–34] which are distinguished by the presence or absence of two sequences: a long insert (L-insert) found in the kinase domain and a short insert (S-insert) found at the carboxyl terminus (Supplementary Figure S1) [10]. Purified CK1α from chicken and zebrafish show that the largest splice variant has both L and S-inserts (CK1αLS) and the smallest splice variant has neither (CK1αNI). Overexpressed CK1α splice variants from zebrafish and chicken have different biological properties. For example, CK1α splice variants from zebrafish have differential sensitivity to CK1 inhibitors [31]. In addition, overexpressed zebrafish or chicken CK1α splice variants that lack the L-insert localize to the cytoplasm whereas splice variants that have the L-insert localize to the nucleus [31, 35].

As overexpressed splice variants of CK1α have different biological properties, it is reasonable to expect that endogenous CK1α splice variants also have distinct roles. However, it is not known which splice variant enacts the specific functions of CK1α. Here, using antibodies that detect select splice variants of CK1α, we demonstrate that four splice variants of CK1α are expressed in mammals. We show that CK1α splice variant abundance varies across mouse tissue types and human cancer cell lines. In addition, cancer cell lines with high levels of specific CK1α splice variant are enriched in distinct pathways, suggesting that the enriched CK1α splice variants participate in these distinct pathways. Moreover, we show that the S-insert of CK1α promotes the growth of HCT 116 cells as its removal leads to decreased cell growth compared to parental HCT 116 cells.

MATERIAL AND METHODS

Cell culture

HEK 293T cells were provided to us by Dr. Ethan Lee. Modified HEK 293T CK1α KO cells and HCT 116 that lack the S-insert as well as parental cell lines that served as a negative control were obtained from GenScript. The removal of the S-insert from HCT 116 cells was done via CRISPR, using a guide RNA (gRNA) that targets a region of CK1α just upstream of the S-insert (gRNA sequence: 5’GGCCTGCTGACCCTGCCCAC 3’). After the gRNA was transfected into the parental cell line, the transfected cells were plated in 96-well plates by limit dilution to generate isogenic single clones. The clones were picked from wells and screened by dideoxynucleotide sequencing to identify isogenic knockout clones. Cell pellets for various cancer cell lines were obtained from the Georgetown University Tissue Culture Shared Resource. Cells were grown in DMEM (Corning 10-013-CV) with 10% fetal bovine serum (R&D Systems S11150) at 37 °C and 5% CO2. The lab uses a mycoplasma sentinel monitoring system in which select cell lines are tested for mycoplasma monthly by the Georgetown University Tissue Culture Shared Resource.

Transfection

The HA-CK1α plasmids were obtained from Genewiz. An HA-tag was added to the amino terminus of each CK1α splice variant, and CK1α was inserted into a pcDNA 3.1 (+) vector backbone. Transfection of plasmids was performed using the protocol for Lipofectamine 2000 (Thermo Fisher #11668-019). Briefly, 4 μg of plasmid were added to 150 μL of Opti-MEM Reduced Serum Medium (Thermo Fisher #31985-062) and Lipofectamine 2000 was added to a separate container with Opti-MEM Reduced Serum Medium so that 5 μL of Lipofectamine 2000 were added to each well. A 1:1 ratio of plasmid to lipofectamine mixture was used. After incubating for five minutes, the mix was added dropwise to cells in a 6-well plate. Cells were lysed 48 hours after transfection. Transfection of siRNA was similar but Lipofectamine RNAiMax (Thermo Fisher 13778-150) was used. The concentration of siRNA in each well was 50nM. Individual siRNAs were purchased from Horizon Discovery (CK1α: D-003957-09-0002; D-003957-12-0002; non-targeting: D001210-03-05). Custom siRNAs were also purchased from Horizon Discovery (Supplementary Table S2).

Assays

Cell growth assays were conducted as follows: for cell number measurements, 1.8 X 104 cells were seeded in 24-well plates. The next day, the media was changed to DMEM with 5% FBS. After five days, the cells were detached from the wells with trypsin (Corning #25-052-CI) and counted by trypan blue exclusion. Subcellular fractionation of SW480 and HCT 116 cells was done following the protocol for the NE-PER Nuclear and Cytoplasmic Extraction kit (Thermo Fisher #78833).

Biochemistry

Cell pellets were lysed as follows: buffer 1 (25 mM Tris, 150 mM NaCl, 1 mM EDTA, 1X HALT Protease Inhibitor Cocktail (Thermo Fisher #1862209)) that was stored at 4 °C was added to each pellet and left to thaw on ice for 10 minutes. Pellets were briefly vortexed. Then, buffer 2 (25 mM Tris-HCl, pH 7.6; 150 mM NaCl; 1 mM EDTA; 1% NP-40; 1% sodium deoxycholate; 0.1% sodium dodecyl sulfate; 1X HALT Protease Inhibitor Cocktail) was added so that the final concentration of buffer 2 was 0.75X. Pellets were sonicated at 50% amplitude for 30 seconds and then centrifuged at 14,000 x g and 4 °C for 15 minutes. Supernatant was stored and mixed with 4X Laemmli Buffer (Bio-Rad #1610747) with 10% 2-mercaptoethanol (VWR M131-100ML). The mixture was heated at 95 °C for five minutes and then briefly centrifuged before loading on a polyacrylamide gel.

Mice were cared for following the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Research Council and with the policies of the Georgetown University Institutional Animal Care and Use Committee. No live animal studies were conducted: only experiments that used mouse tissues were performed. Male mice were used for tissue harvesting. Mouse tissues were lysed as follows: extracted tissues were weighed and RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate) (Thermo Fisher #89901) supplemented with 1X HALT Protease Inhibitor Cocktail was added to the tissues at a ratio of 10 μL per milligram of tissue. Tissues were homogenized with a tissue homogenizer (VWR #10032-328) and centrifuged twice, keeping the supernatant. The protein concentration of the lysates was obtained by performing a BCA assay (Thermo Fisher #23227). For the human tissue immunoblotting, a membrane containing lysates of several human tissues already transferred was purchased (ProSci Inc. #1521).

Total CK1α (Abcam #ab108296) antibody was used at a 1/1000 (0.654 μg/mL) dilution. CK1α S-insert antibody (Abcam #ab206652) was used at a 1/1000 dilution. α-Tubulin (Sigma-Aldrich #CP06) antibody was used at a 1/5000 dilution. Custom L-insert antibody (Genemed Synthesis, Inc – Peptide used for antibody generation: CLESPVGKRKRSMTVSTSQDPSFSGLNQ) was used at a 20 μg/mL dilution. Anti-rabbit IgG (Cell Signaling Technology #7074S) secondary antibody was used at a 1/10,000 dilution. Anti-mouse IgG (Cell Signaling Technology #7076S) secondary antibody was used at a 1/10,000 dilution. Additional CK1α antibodies tested include GeneTex GT133716; Santa Cruz Biotechnology sc-74582 and sc-74583; Bethyl Laboratories A301-991a; Cell Signaling Technology CST2655; and R&D Systems AF4569.

For CK1α splice variant immunoblotting, 12% polyacrylamide gels were cast. Semi-dry transfer was done with the Trans-blot Turbo (Bio-Rad #1704150) using the preset 1.5 mm settings. Antibodies were diluted in 5% milk (Bio-Rad #1706404) in TBS-T (1X Tris-buffered saline; 0.1% Tween 20). Primary antibody incubation was done at 20-25 °C for one hour. Secondary incubation was done at 20-25 °C for 30 minutes. HRP substrates used were Pierce ECL Western (Thermo Fisher #32106), ECL Prime (Amersham #RPN2232), and SuperSignal West Femto (Thermo Fisher #34096). Membranes were imaged with the ChemiDoc MP imaging system (Bio-Rad #12003154).

RNA extraction was done using the Qiacube Connect MDx instrument (Qiagen #9003070) and the RNeasy Plus RNA extraction kit (Qiagen #74136). Isolated RNA was quantitated with the CLARIOstar Plus plate reader (BMG LABTECH). Reverse transcription was done using the High Capacity cDNA Reverse Transcription kit (Thermo Fisher #4368814). Primers for CSNK1A1 and GAPDH were obtained from Thermo Fisher (Supplementary Table 1). PCR was done as follows: initial denaturation at 98 °C for 30 seconds; 26 cycles of denaturation at 98 °C for 10 seconds; annealing at 64 °C for 30 seconds; extension at 72 °C for 30 seconds; final extension at 72 °C for 5 minutes. The Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB #M0531S) was used for PCR. The amplified product was mixed with loading dye (NEB #B7025S) and loaded onto 2% agarose gels (agarose from Axygen #AGR-LE-500) in 1X TAE buffer (VWR #K915-1.6L). The gels were stained with 1X SybrSafe (ApexBio #A8743) in 1X TAE buffer. Gels were imaged with the ChemiDoc MP imaging system.

Quantitation of CK1α PCR products and protein was done with the Image Lab software. The “Bands” setting under the “Lanes and Bands” tab was used to mark each splice variant. In experiments where the bands needed to be normalized to an endogenous control, each lane from the Ponceau stain was quantified using the “Lanes” setting from the “Lanes and Bands” tab. The signal from each splice variant was then divided by the signal from the corresponding lane. In experiments with samples across multiple membranes, a reference sample (such as 293T lysates) was included in each membrane and used to normalize the signal across all the membranes. This was achieved by dividing the signal of CK1αS in the reference sample on the first membrane by that of a subsequent membrane. The result was then multiplied by the signal of each CK1α splice variant in the samples on all subsequent membranes.

RESULTS

Four human CK1α splice variants are expressed.

While lower organisms such as chicken and zebrafish possess four splice variants of CK1α [31, 32], it is unclear whether mammals have the same four splice variants. To determine whether multiple splice variants of CK1α are expressed in mammals, we designed PCR primers flanking the region of the human CSNK1A1 gene (which encodes the CK1α protein) that contained both inserts (Figure 1A). Using RNA obtained from a human cell line (HEK 293T), we performed reverse transcription PCR with these primers, varying the number of reaction cycles to ensure the various cDNA products were being amplified in a linear range. After agarose gel electrophoresis, four amplified products corresponding to the expected product size of the four CSNK1A1 splice variants were observed (Figure 1B). The expression of the endogenous housekeeping control gene, GAPDH, was used as a loading control.

Figure 1: Four splice variants of human CSNK1A1 are expressed.

Figure 1:

Open in a new tab

(A) Schematic of a CSNK1A1 transcript (CK1αLS) and the target sites for the siRNA. The sites where the PCR primers anneal to the transcripts are also indicated. The L-insert is represented as a blue rectangle and the S-insert is represented as a gold rectangle. (B) Expression of four splice variants of CSNK1A1. RNA from HEK 293T cells was extracted, reverse transcribed to cDNA and used for PCR (RT-PCR) using either primers flanking the region of the CSNK1A1 transcripts that contains both inserts (see schematic in (A)), or primers for GAPDH transcripts. The reaction proceeded for the number of cycles indicated, at which point the reaction was stopped and the products resolved by agarose gel electrophoresis. The predicted size of each amplified product is labeled next to the product. (C) Knockdown of CSNK1A1 splice variants. HEK 293T cells were transfected with the indicated siRNAs for 48 hours. RNA was subsequently extracted from these cells and analyzed by RT-PCR using the primers shown in (A). Products were resolved by agarose gel electrophoresis. (D) Knockdown of CSNK1A1 splice variants its effect on CK1α protein levels. HEK 293T cells were transfected as in (C) and the resulting protein lysates used for immunoblotting of the indicated proteins. The total CK1α antibody ab108296 was used in this figure. (E) The relative abundance of the CSNK1A1 transcripts and of CK1α splice variant proteins from the “no siRNA” sample in the PCR and immunoblotting figures, respectively, was calculated with the Image Lab software and the graph with the signal of each amplified transcript is shown to the right. Representative images of three independent replicates are shown.

To verify that the amplified PCR products correspond to CK1α splice variants, we designed two distinct siRNA that targeted the L-insert, two that targeted the S-insert, and another two that targeted a sequence common in all CSNK1A1 transcripts. After transfecting the siRNA into HEK 293T cells, we extracted RNA and performed RT-PCR using the primers described above. After separating the resulting amplified products by agarose gel electrophoresis, we observed that the L-insert siRNA decreased the abundance of the two largest products. The S-insert siRNA decreased the abundance of the largest and third-largest products. The Pan-CK1α siRNA designed to target the conserved region of CSNK1A1 decreased the abundance of all the CSNK1A1 splice variants (Figure 1C). These results, and the observation that the size of the PCR products is similar to the predicted size of four splice variants of CK1α, suggest that the amplified products correspond to CK1αNI, CK1αS, CK1αL, and CK1αLS, in ascending order. We used the same siRNA to identify endogenous CSNK1A1 splice variant products by immunoblotting. As with the amplified PCR products, we observed that the insert-specific siRNA decreased the abundance of their corresponding CK1α splice variant products, whereas the Pan-CK1α siRNA decreased the abundance of all the CK1α splice variants (Figure 1D). We then quantitated the abundance of each splice variant of CK1α for both PCR products and protein levels from the “no siRNA” samples in the PCR and Western blot images. We saw similar results from the quantitation of amplified PCR products and protein: CK1αS was the most abundant splice variant in HEK 293T, followed by CK1αNI, CK1αLS, and lastly CK1αL (Figure 1E). The abundance of CK1αS was noticeably higher than that of CK1αNI, and the abundance of CK1αL and CK1αLS was noticeably lower. In addition, we observed that knockdown of CK1αS led to an increase in the abundance of CK1αNI. Together, these results show that four individual splice variant products of human CK1α, CK1αNI, CK1αS, CK1αL, and CK1αLS, are expressed in HEK 293T.

We next engineered constructs expressing various HA-tagged-CK1α splice variants to screen for antibodies capable of recognizing the four CK1α splice variant proteins. We transfected HEK 293T cells with individual CK1α splice variant constructs and immunoblotted the resulting lysates to validate antibodies for their ability to identify specific CK1α splice variants (Table 1). The four overexpressed splice variants differed in molecular size, with CK1αNI being the smallest and CK1αLS being the largest (Figure 2B). We found that some antibodies, such as ab108296 (generated with an antigen of CK1α residues 250-350), detected all four overexpressed splice variants. Other antibodies, such as ab206652 (generated with an antigen of CK1α residues 50-150), only detected proteins that possessed the S-insert (Figure 2B). The CK1α antibodies could also detect endogenous CK1α in these cells, as seen in the Total CK1α immunoblot. These were of smaller molecular size than the corresponding overexpressed splice variant, a difference attributed to the presence of an HA-tag on the latter. As we were unable to identify a commercially available antibody capable of specifically identifying the L-insert, we generated a novel, custom antibody using an L-insert peptide as an antigen. This antibody only detected the CK1α splice variants that possess an L-insert (Figure 2B). These results identified antibodies capable of recognizing specific splice variants of CK1α (additional characterized antibodies are shown in Supplementary Figure S2).

Table 1:

CK1α antibodies and the splice variants they detect.

Company Product Number Immunogen Splice Variants Detected:
Abcam ab206652 Human CK1α residues 50-150 CK1αS and CK1αLS.
Abcam ab108296 Human CK1α residues 250-350 CK1αNI, CK1αS, CK1αL, and CK1αLS.
GeneTex GTX133716 Carboxyl terminus of CK1α. CK1αS and CK1αLS.
Santa Cruz Biotechnology sc-74583 Human CKIα residues 281-337 None.
Santa Cruz Biotechnology sc-74582 Human CKIα residues 281-337 None.
Bethyl Laboratories A301-991a Human CK1α residues 287-337 CK1αNI, CK1αS, CK1αL, and CK1αLS.
Cell Signaling Technology CST 2655 Central region of human CK1α CK1αNI, CK1αS, CK1αL, and CK1αLS.
R&D Systems AF4569 Human CK1α residues 255-365 CK1αS and CK1αLS.
Genemed Synthesis Custom L-insert antibody Human CK1α residues 152-180 CK1αL and CK1αLS
Open in a new tab

Figure 2: Characterization of antibodies against Casein Kinase 1α.

Figure 2:

Open in a new tab

(A) Schematic showing the four prospective splice variants of CK1α. The kinase domain in each splice variant is highlighted in green. The blue rectangle represents the L-insert whereas the gold rectangle represents the S-insert. (B) Ectopic expression of the four CK1α splice variants. HEK 293T cells were transfected with the indicated HA-tagged CK1α splice variants. Cell lysates were subsequently resolved by SDS-PAGE and immunoblotted using an HA-tag antibody, an antibody that detects all splice variants of CK1α (#ab108296), an antibody that detects only CK1α splice variants with the S-insert (#ab206652), and a custom antibody that only detects CK1α splice variants with the L-insert. A representative immunoblot of three independent replicates is shown.

CK1α splice variant abundance varies across tissues.

As the abundance of protein between tissues could provide insight into potential unique functions of CK1α splice variants, we determined the levels of each splice variant protein across various mouse organs. We harvested such tissues, extracted protein by tissue homogenization, and solubilized them in a detergent-based lysis buffer. The lysates were normalized to total protein, resolved by SDS-PAGE, and analyzed by immunoblotting using antibodies capable of detecting all four splice variants of CK1α. We observed that CK1α splice variant abundance differed between tissues (Figure 3A). After quantitating the four splice variants, we found that the liver had the highest levels of CK1αLS, the spleen had the highest levels of CK1αS and CK1αL, and that the testis had the highest levels of CK1αNI (Figure 3B). CK1αL was also observed in the cerebellum and testis. In addition, the relative ratio between the four CK1α splice variants varied in different mouse tissues. Some tissues, such as the thyroid and the lung, had higher levels of CK1αS than CK1αNI. Other tissues like the heart and the ileum had similar levels of the same two splice variants (Figure 3B). When surveying CK1α splice variant abundance in select human tissues, we found that CK1α abundance varied between tissues. One of the splice variants that varies in abundance was detected by the S-insert antibody (Supplementary Figure S3). It is possible, then, that CK1α splice variants that are very abundant in a tissue enact functions that are not performed by other, less abundant splice variants.

Figure 3: CK1α splice variant abundance varies across mouse tissues.

Figure 3:

Open in a new tab

(A) Immunoblot of CK1α splice variants in various mouse tissues. Tissues were harvested from a mouse, homogenized, equal amounts of protein resolved by SDS-PAGE, and immunoblotted for total CK1α. Total CK1α antibody used was #ab108296. A darker exposure of the total CK1α immunoblot and a segment of the Ponceau total protein stain is also shown. (B) The abundance of each splice variant of CK1α was quantified with Image Lab and then normalized to total protein. Green asterisks indicate tissues whose abundance of a given CK1α splice variant was greater than two standard deviations from the mean abundance of that splice variant across all tissues.

CK1α splice variant abundance varies across distinct cancer cell lines.

Similarly, differences in the abundance of CK1α splice variants between cancer cell lines might suggest unique functions of the enriched splice variants. To determine differences between such cancer cell lines, we obtained cell lines derived from cancers originating in multiple tissues and lysed them with a detergent-based buffer (Table 2). Using the resulting lysates, normalized to protein concentration, we performed an immunoblot and quantitated the abundance of the CK1α splice variants. In general, the abundance of CK1α splice variants varied between cancer cell lines (Figure 4A). To identify cell lines enriched for distinct CK1α splice variants, we quantitated the levels of each splice variant in each cell line and compared them to the average signal amongst all the cancer cell lines tested. SCaBER and HeLa, a urinary bladder and a cervix cancer cell line respectively, had the highest levels of CK1αNI. HCT 116 and SW480, both colorectal cancer cell lines, had the highest levels of CK1αS. SW756, NCIH292, and SW900, the first of which is a cervical cancer cell line and the latter two are lung cancer cell lines, had the highest levels of CK1αLS (Figure 4B). In addition, the relative ratio of the four CK1α splice variants differed among cell lines. Some cell lines had high levels of CK1αS compared to the other splice variants whereas others had similar levels of CK1αNI and CK1αS (Figure 4B). This raises the possibility that CK1α splice variants that are highly abundant in a cancer cell line perform functions that are not done by less abundant splice variants.

Table 2:

List of Cancer Cell Lines Surveyed.

Tissue of origin Cell line Species Tissue of origin Cell line Species
Adrenal Gland SW-13 Human Liver Hep 3B2. 1-7 Human
Blood HL-60 Human Hep G2 Human
THP-1 Human SK-HEP-1 Human
Bone marrow RS4; 11 Human Lung Calu-3 Human
TF-1 Human NCI-H292 Human
Bone Sk-Es-1 Human SW900 Human
UMR-106 Rat Ovary Caov-3 Human
Brain A-172 Human PA-1 Human
Daoy Human SK-OV-3 Human
SH-SY5Y Human Pancreas AsPC-1 Human
U-138 MG Human COLO-357 Human
Breast BT-20 Human PANC-1 Human
MCF7 Human Placenta BeWo Human
Cervix Caski Human JAR Human
HeLa Human Prostate PC-3 Human
SW756 Human Tramp-C1 Mouse
Colon CT26.WT Mouse Tsu Human
HCT 116 Human Skin B16-F0 Mouse
HT-29 Human Hs 68 Human
SW480 Human SK-MEL-24 Human
SW620 Human Stomach Hs 746.T Human
Kidney ACHN Human KATO III Human
Caki-1 Human Testis F9 Mouse
769-P Human Urinary Bladder SCaBER Human
Open in a new tab

Figure 4: CK1α splice variant abundance varies across cancer cell lines.

Figure 4:

Open in a new tab

(A) Immunoblot of CK1α splice variants from cancer cell lines. Multiple cancer cell lines were lysed and equal amounts of protein analyzed by immunoblotting for total CK1α (#ab108296). A darker exposure of the total CK1α immunoblot and a segment of the Ponceau total protein stain is included. (B) The abundance of each splice variant of CK1α was quantified across cancer cell lines with Image Lab and then normalized to total protein. The abundance of each CK1α splice variant was obtained with Image Lab and then normalized to total protein by dividing the signal of each splice variant with the total protein signal. Green asterisks indicate cell lines whose abundance of a given CK1α splice variant was greater than two standard deviations above the mean abundance of that CK1α splice variant across all cancer cell lines.

To identify pathways and processes that are distinct in cell lines with enriched levels of distinct CK1α splice variants, we performed a bioinformatic analysis of the transcriptome of the various cancer cell lines we used. We divided the cell lines into two categories: one category contained cell lines that had an abundance of a particular splice variant of CK1α that was over two standard deviations above the mean abundance of that splice variant across all cancer cell lines surveyed, and the other contained all the other cancer cell lines. Then the differential gene expression profile between the two categories of cancer cell lines was obtained using raw RNAseq count data obtained from the Cancer Cell Line Encyclopedia. This was followed by gene set enrichment analysis (GSEA) to identify differences in pathway expression between the two groups of cancer cell lines. We found that cell lines with high levels of CK1αNI, such as SCaBER, and the cell lines with high CK1αLS, such as SW900, had similar upregulated pathways compared to the rest of the cancer cell lines. Among the enriched pathways were type I interferon signaling and anchoring fibril formation. Cell lines with high levels of CK1αS, such as HCT 116, were relatively enriched in gene products involved in the assembly of the pre-replicative complex (Supplementary Figure S4). In general, the tissues of origin of the cancer cell lines with high CK1α splice variant levels, and the mouse tissues with high CK1α levels, were not the same. However, we observed that both colon tissues and CRC had CK1αS as the most abundant splice variant. Thus, cancer cell lines are enriched for distinct CK1α splice variants and such enrichment may give rise to distinct transcriptional outputs or vice versa. One of the upregulated pathways in the cell lines with high CK1αS was assembly of the pre-replicative complex, which takes place in the nucleus. It was previously reported that overexpressed zebrafish lacking the L-insert, such as CK1αS, localize to the cytoplasm. To determine whether human endogenous CK1α splice variants localize to different cellular compartments, we performed a subcellular fractionation of HCT 116 and SW480 cells. We found that CK1αNI, CK1αS, and CK1αLS were observed in both the cytoplasm and the nucleus (Supplementary Figure S5), consistent with endogenous CK1αS performing a role in the nucleus.

CRC is the third most diagnosed cancer type in the United States as well as the third deadliest [36]. There has been considerable work on identifying the mutations that lead to CRC formation to identify potential targets for treatments. One outcome is that CRC was recently classified into four consensus molecular subtypes (CMS 1-4), each one exhibiting distinct molecular and pathological phenotypes [37]. For example, CMS2 includes CRC cell lines with high Wnt and Myc activity [38]. Given the important role CK1α plays in CRC as a negative regulator of Wnt signaling, we next examined CK1α splice variant abundance between CRC cell lines belonging to these four CMS subtypes [39]. We therefore obtained CRC cell lines representative of each CMS and lysed them with a detergent-based buffer. With the resulting lysates, normalized to α-Tubulin, we performed an immunoblot and quantitated the abundance of CK1α splice variants. We note that although CK1α abundance varied between CRC cell lines, these differences did not appear to be significant (Supplementary Figure S6) and, in general, CK1αS was the most abundant splice variant. This observation is limited by the small number of cell lines we examined in each CMS subgroup.

The S-insert of CK1α promotes cell growth.

CK1α affects cell cycle progression at different points, such as promoting G2-M transition by lowering p53 protein levels [40] and promoting mitosis through the phosphorylation of FAS-associated death domain protein (FADD) [41]. Our survey of cancer cell lines showed that CK1αS was often the most abundant splice variant and was noticeably high in HCT 116 cells. To determine whether the S-insert of CK1α promotes cell growth we engineered multiple clonal HCT 116 cell lines (clones 1, 2, and 3) that lack the S-insert via CRISPR. Multiple clones were used to account for potential off-target effects of each guide RNA. Sequencing of the three clonal cell lines revealed that they possessed frameshift mutations in a region upstream of the S-insert, resulting in distinct missense mutations (Supplementary Figure S7). To validate that the clonal HCT 116 cell lines did not express the S-insert, we lysed these cells and performed an immunoblot with the resulting lysates. Using antibodies capable of recognizing all CK1α splice variants, we noted that CK1α migrated at a different molecular size in the clonal cell lines relative to the parental WT cell lines- consistent with their underlying missense mutations. Importantly, none of the CK1α splice variants in the engineered HCT 116 cell lines could be detected by an S-insert specific antibody (Figure 5A), validating that the CK1α splice variants in the modified cell lines lack the S-insert.

Figure 5: The S-insert of CSNK1A1 promotes cell growth.

Figure 5:

Open in a new tab

(A) Immunoblot of HCT 116 cell lines that lack the S-insert. HCT 116 clonal and parental cell lines were lysed and the resulting protein lysates analyzed by immunoblotting with total CK1α (#ab108296), S-insert (#ab206652), and α-tubulin. (B) HCT 116 clonal cells that lacked the S-insert, and the parental cell line, were grown for five days. The number of live cells after five days was counted via trypan blue exclusion and then plotted. Error bars represent the standard deviation of three technical replicates.

To measure changes in cell growth between the clonal cell lines and the parental cell line, we seeded an equal number of each cell line in a culture plate. After five days, we performed trypan blue exclusion to count the number of live cells in each well. We observed that there were fewer total cells in cell lines lacking the S-insert compared to the parental cell line (Figure 5B). Growth in clones 1 and 2 were 75% reduced compared to the parental cell line and clone 3 had the fewest number of cells among all cell lines after five days of growth. These results suggest that the carboxyl terminus of CK1α that includes the S-insert exerts a positive regulatory effect on the growth of HCT 116 cells.

DISCUSSION

We found that CK1α splice variant abundance varies across murine tissues and across cancer cell lines. The relative ratio of specific CK1α splice variants within cell lines also differed. Moreover, using transcriptome comparisons we identified pathways whose expression is distinct in cell lines enriched for specific splice variants of CK1α. Two of the top three pathways that are enriched in cells with high CK1αNI are signaling pathways, whereas two of the top three pathways enriched in cells with high CK1αS are part of cell cycle progression. The latter finding is corroborated by experiments with engineered HCT 116 clonal cell lines in which the cells that lacked the S-insert displayed decreased growth compared to the parental cell line. Of note is that CK1αL was not detected in the immunoblots for the cancer cell line survey, and therefore it was not feasible to identify cancer cell lines that were enriched for that splice variant. Due to it being the least abundant splice variant in HEK 293T cells, we cannot rule out that cancer cell lines possess CK1αL at low levels.

When examining the pathways that are altered in cells enriched with particular splice variants of CK1α, interferon α/β signaling is high in cell lines with high levels of CK1αNI or CK1αLS. CK1α is reported to phosphorylate interferon α and β receptor subunit 1 (IFNAR1), priming it for ubiquitination and degradation by the β-TrCP E3 ubiquitin ligase [24] and ultimately attenuates interferon signaling in cells. As these pathways are both upregulated in cancer cell lines with high CK1αNI or high CK1αLS, it is likely that the pathways are upregulated by factors independent of CK1α splice variant abundance. Alternatively, the pathways could be upregulated by an increase in the levels of total CK1α. We also found that CK1αS is enriched in cells with high expression of genes involved in the assembly of the pre-replicative complex. CK1α is not reported to be involved in the assembly of the pre-replicative complex but it is involved in other stages of cell cycle progression. For example, CK1α phosphorylates CDC25, which primes it for eventual degradation [3] and prevents G1-S transition. It is possible that CK1αS performs an uncharacterized function in this assembly, and that this function is upregulated in cancer cell lines to promote its proliferation. Alternatively, these distinct cancer cell line enriched pathways might regulate the relative abundance of the distinct CK1αS splice variants.

One notable observation from the survey of cancer cell lines is that CK1α levels were high even in Wnt-activity dependent CRC cancer cell lines, such as HCT 116 and SW480. Both CRC cell lines proliferate through hyperactive Wnt signaling: HCT 116 has a mutation in the gene encoding the transcriptional cofactor β-Catenin that removes the CK1α phosphorylation site and SW480 has an APC mutation. As CK1α is a negative regulator of Wnt signaling, and since we previously found that CK1α levels are lower in Apcmin organoids compared to WT organoids [25], we anticipated that CK1α levels would be low in these cell lines compared to non-CRC cell lines, which would not proliferate primarily through hyperactive Wnt signaling. Instead, we found that the most abundant splice variant in these two cells was CK1αS and that this splice variant was enriched in these two cell lines compared to the rest of the cancer cell lines surveyed. Despite the role of CK1α as a negative regulator of Wnt signaling, we found that HCT 116 that lacked the S-insert sequence grew slower than the parental HCT 116 cell line, suggesting that the S-insert provides a positive regulator of cell growth. We also observed that CK1αS was the most abundant splice variant in murine colon tissue, which might suggest that CK1αS function in colon cells and tissues are similar in tumor and non-tumor cells. In our survey of CK1α abundance in human tissues, we observed that the colon and the spleen were among the tissues with the highest levels of CK1α protein, though due to limitations of the membrane with human tissues we were unable to obtain enough separation of the splice variants to detect all CK1α splice variants. As both CRC cells with high levels of CK1αS proliferate through hyperactive Wnt signaling, the heightened levels of CK1αS in these cell lines and tissues suggests that the kinases perform a growth-promoting function that is independent of its role as a negative regulator of Wnt signaling.

However, we noted that depletion of splice variants that possess the S-insert leads to increased CK1αNI levels, possibly through a compensatory mechanism that activates when CK1αS levels decrease (see Figure 1C and Figure 1D). Thus, an alternate interpretation of the reduced growth of HCT 116 clonal lines engineered to lack the S-insert is that the subsequent increased amount of CK1αNI, resulting from loss of the S-insert, attenuates the growth of these cells. Finally, the clonal HCT 116 cells have their entire carboxyl terminus sequence of CK1α altered due to the modification that resulted in the removal of the S-insert. There is a possibility that the alteration of the carboxyl terminus may have led to the decrease in cell growth, though further validation is needed to determine whether specific splice variants of CK1α promote cell growth

Supplementary Material

1

Highlights.

  • CK1α splice variant abundance varies across normal tissues and cancer cell lines.

  • Cancer cell lines with high levels of select CK1α splice variants express distinct biological pathways.

  • The S-insert of CK1α promotes cell growth in a cancer cell line.

ACKNOWLEDGEMENTS

We thank the other members of the Robbins Lab for their advice on this project. We also thank the Georgetown University Tissue Culture Shared Resource for providing samples for this project. We would like to thank the following organizations for funding our research: the National Institutes of Health (NIH) for awarding a Diversity Supplement for R01CA219189-01A1; the National Cancer Institute for awarding a T32 (CA009686 to D.T.W.), and a T32 (GR414758 to P.S.); the Edwin H. Richard and Elisabeth Richard von Matsch Endowed Chair in Experimental Therapeutics and J.P. Morgan Private Bank.

Financial Support:

This work was supported by a National Institutes of Health (NIH) Diversity Supplement for R01CA219189-01A1, a National Cancer Institute T32 (CA009686 to D.T.W.), a National Cancer Institute T32 (GR414758 to P.S.), the Edwin H. Richard and Elisabeth Richard von Matsch Endowed Chair in Experimental Therapeutics and J.P. Morgan Private Bank.

Declaration of interests

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

David J. Robbins reports financial support was provided by National Institutes of Health. Ricardo A. Melendez reports financial support was provided by National Institutes of Health. Daniel T. Wynn reports financial support was provided by National Institutes of Health. Prerna Singh reports financial support was provided by National Institutes of Health. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosure of Potential Conflicts of Interest: D.J.R. is a founder of StemSynergy Therapeutics Inc., a company commercializing small-molecule cell signaling inhibitors.

REFERENCES

  • 1.Matsumura S and Takeda M, Phosphoprotein kinases from rat liver cytosol. Biochim Biophys Acta, 1972. 289(1): p. 237–41. [DOI] [PubMed] [Google Scholar]
  • 2.Hathaway GM and Traugh JA, Cyclic nucleotide-independent protein kinases from rabbit reticulocytes. Purification of casein kinases. J Biol Chem, 1979. 254(3): p. 762–8. [PubMed] [Google Scholar]
  • 3.Honaker Y and Piwnica-Worms H, Casein kinase 1 functions as both penultimate and ultimate kinase in regulating Cdc25A destruction. Oncogene, 2010. 29(23): p. 3324–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hirota T, et al. , High-throughput chemical screen identifies a novel potent modulator of cellular circadian rhythms and reveals CKIalpha as a clock regulatory kinase. PLoS Biol, 2010. 8(12): p. e1000559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Matsubayashi H, et al. , Biochemical characterization of the Drosophila wingless signaling pathway based on RNA interference. Mol Cell Biol, 2004. 24(5): p. 2012–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kattapuram T, et al. , Protein kinase CK1alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein C in response to physiologic levels of hydrogen peroxide. J Biol Chem, 2005. 280(15): p. 15340–7. [DOI] [PubMed] [Google Scholar]
  • 7.Venerando A, Ruzzene M, and Pinna LA, Casein kinase: the triple meaning of a misnomer. Biochem J, 2014. 460(2): p. 141–56. [DOI] [PubMed] [Google Scholar]
  • 8.Zhai L, et al. , Casein kinase I gamma subfamily. Molecular cloning, expression, and characterization of three mammalian isoforms and complementation of defects in the Saccharomyces cerevisiae YCK genes. J Biol Chem, 1995. 270(21): p. 12717–24. [DOI] [PubMed] [Google Scholar]
  • 9.Graves PR, et al. , Molecular cloning, expression, and characterization of a 49-kilodalton casein kinase I isoform from rat testis. J Biol Chem, 1993. 268(9): p. 6394–401. [PubMed] [Google Scholar]
  • 10.Fish KJ, et al. , Isolation and characterization of human casein kinase I epsilon (CKI), a novel member of the CKI gene family. J Biol Chem, 1995. 270(25): p. 14875–83. [DOI] [PubMed] [Google Scholar]
  • 11.Rowles J, et al. , Purification of casein kinase I and isolation of cDNAs encoding multiple casein kinase I-like enzymes. Proc Natl Acad Sci U S A, 1991. 88(21): p. 9548–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Knippschild U, et al. , The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal, 2005. 17(6): p. 675–89. [DOI] [PubMed] [Google Scholar]
  • 13.Pulgar V, et al. , The recombinant alpha isoform of protein kinase CK1 from Xenopus laevis can phosphorylate tyrosine in synthetic substrates. Eur J Biochem, 1996. 242(3): p. 519–28. [DOI] [PubMed] [Google Scholar]
  • 14.Zhai L, et al. , Recombinant rabbit muscle casein kinase I alpha is inhibited by heparin and activated by polylysine. Biochem Biophys Res Commun, 1992. 189(2): p. 944–9. [DOI] [PubMed] [Google Scholar]
  • 15.Amit S, et al. , Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev, 2002. 16(9): p. 1066–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liu C, et al. , Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell, 2002. 108(6): p. 837–47. [DOI] [PubMed] [Google Scholar]
  • 17.Brockman JL, et al. , Cell cycle-dependent localization of casein kinase I to mitotic spindles. Proc Natl Acad Sci U S A, 1992. 89(20): p. 9454–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gross SD, et al. , A casein kinase I isoform is required for proper cell cycle progression in the fertilized mouse oocyte. J Cell Sci, 1997. 110 (Pt 24): p. 3083–90. [DOI] [PubMed] [Google Scholar]
  • 19.Lum L, et al. , Identification of Hedgehog pathway components by RNAi in Drosophila cultured cells. Science, 2003. 299(5615): p. 2039–45. [DOI] [PubMed] [Google Scholar]
  • 20.Pan Y, et al. , Sonic hedgehog signaling regulates Gli2 transcriptional activity by suppressing its processing and degradation. Mol Cell Biol, 2006. 26(9): p. 3365–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cheong JK, et al. , Casein kinase 1alpha-dependent feedback loop controls autophagy in RAS-driven cancers. J Clin Invest, 2015. 125(4): p. 1401–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Schneider RK, et al. , Role of casein kinase 1A1 in the biology and targeted therapy of del(5q) MDS. Cancer Cell, 2014. 26(4): p. 509–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ghoshal N, et al. , A new molecular link between the fibrillar and granulovacuolar lesions of Alzheimer’s disease. Am J Pathol, 1999. 155(4): p. 1163–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chia R, et al. , Phosphorylation of LRRK2 by casein kinase 1alpha regulates trans-Golgi clustering via differential interaction with ARHGEF7. Nat Commun, 2014. 5: p. 5827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li B, et al. , Differential abundance of CK1alpha provides selectivity for pharmacological CK1alpha activators to target WNT-dependent tumors. Sci Signal, 2017. 10(485). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li L, et al. , GLIPR1 suppresses prostate cancer development through targeted oncoprotein destruction. Cancer Res, 2011. 71(24): p. 7694–704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Minzel W, et al. , Small Molecules Co-targeting CKIalpha and the Transcriptional Kinases CDK7/9 Control AML in Preclinical Models. Cell, 2018. 175(1): p. 171–185 e25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sun D, et al. , Differential expression patterns of capping protein, protein phosphatase 1, and casein kinase 1 may serve as diagnostic markers for malignant melanoma. Melanoma Res, 2011. 21(4): p. 335–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bowman BM, et al. , Phosphorylation of FADD by the kinase CK1alpha promotes KRASG12D-induced lung cancer. Sci Signal, 2015. 8(361): p. ra9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kronke J, et al. , Lenalidomide induces ubiquitination and degradation of CK1alpha in del(5q) MDS. Nature, 2015. 523(7559): p. 183–188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Burzio V, et al. , Biochemical and cellular characteristics of the four splice variants of protein kinase CK1alpha from zebrafish (Danio rerio). J Cell Biochem, 2002. 86(4): p. 805–14. [DOI] [PubMed] [Google Scholar]
  • 32.Green CL and Bennett GS, Identification of four alternatively spliced isoforms of chicken casein kinase I alpha that are all expressed in diverse cell types. Gene, 1998. 216(1): p. 189–95. [DOI] [PubMed] [Google Scholar]
  • 33.Yong TJ, et al. , Human CKIalpha(L) and CKIalpha(S) are encoded by both 2.4- and 4. 2-kb transcripts, the longer containing multiple RNA-destablising elements. Biochim Biophys Acta, 2000. 1492(2-3): p. 425–33. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang J, et al. , Casein kinase I alpha and alpha L: alternative splicing-generated kinases exhibit different catalytic properties. Biochemistry, 1996. 35(50): p. 16319–27. [DOI] [PubMed] [Google Scholar]
  • 35.Fu Z, et al. , Four casein kinase I isoforms are differentially partitioned between nucleus and cytoplasm. Exp Cell Res, 2001. 269(2): p. 275–86. [DOI] [PubMed] [Google Scholar]
  • 36.Siegel RL, et al. , Cancer statistics, 2022. CA Cancer J Clin, 2022. 72(1): p. 7–33. [DOI] [PubMed] [Google Scholar]
  • 37.Bugter JM, Fenderico N, and Maurice MM, Mutations and mechanisms of WNT pathway tumour suppressors in cancer. Nat Rev Cancer, 2021. 21(1): p. 5–21. [DOI] [PubMed] [Google Scholar]
  • 38.Guinney J, et al. , The consensus molecular subtypes of colorectal cancer. Nat Med, 2015. 21(11): p. 1350–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Berg KCG, et al. , Multi-omics of 34 colorectal cancer cell lines - a resource for biomedical studies. Mol Cancer, 2017. 16(1): p. 116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Chen L, et al. , Regulation of p53-MDMX interaction by casein kinase 1 alpha. Mol Cell Biol, 2005. 25(15): p. 6509–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Alappat EC, et al. , Phosphorylation of FADD at serine 194 by CKIalpha regulates its nonapoptotic activities. Mol Cell, 2005. 19(3): p. 321–32. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS2003985-supplement-1.docx (3.5MB, docx)

RESOURCES