Abstract
Background:
Multiple Sclerosis (MS) is a prevalent non-traumatic disabling disease affecting young adults, characterized by complexity in its pathogenesis. Nuclear factor erythroid 2-Related Factor 2 (NRF2) serves as a crucial transcriptional regulator of anti-inflammatory and antioxidant enzymes, influenced by the ubiquitous protein p62. It acts as a scaffold directing substrates to autophagosomes. This study aims to explore the potential association between microRNA 135-5p and p62 and their impact on inflammation and oxidative stress through the NRF2 pathway in MS.
Methods:
The study included 30 healthy controls and 60 MS patients (relapsing-remitting and secondary progressive). Real-time PCR was employed for the detection of Nrf2, p62, miRNA135-5P, and NF-κB in serum, while p53 levels were determined using ELISA.
Results:
Nrf2 and p62 expression was significantly downregulated in the MS group compared to controls. Conversely, miRNA135-5P, NF-κB expression, and P53 levels were significantly elevated in the MS group.
Conclusions
This study reveals a potential association between miRNA 135-5p and p62, indicating their role in the pathogenesis of MS. Results suggest that miRNA 135-5p and p62 may influence inflammation and oxidative stress in MS through the NRF2 pathway, potentially mediated by NF-κB and p53.
Key Words: p62, Microrna135, Multiple sclerosis, NRF2
Introduction
Multiple sclerosis (MS) is a chronic inflammatory condition of the central nervous system (CNS), characterized by demyelination, neuronal degeneration, and concurrent axonal damage (1). It stands as the most prevalent nontraumatic disabling disease among young adults. The exact etiology remains elusive, with environmental, immune, and genetic factors contributing to its pathogenesis. Notably, increased oxidative stress and reactive oxygen species production have been implicated in MS development (2).
The endogenous antioxidant pathway, mediated by the transcription factor NRF2, defends cells against oxidative stress by elevating cytoprotective enzyme expression. NRF2 not only upregulates antioxidant gene expressions but also modulates mitochondrial function, biogenesis, and exerts anti-inflammatory effects (3). Normally bound to KEAP1 in the cytosol, NRF2 is regulated for degradation by proteasomes (4), making it a promising therapeutic target for neurodegenerative disorders characterized by neuroinflammation and mitochondrial dysfunction (5).
p62, a regulator of NRF2, acts as a scaffold protein and an autophagic degradation marker. Involved in autophagy, oxidative stress response, and cell signalling, p62 transports specific cargos to autophagosomes, sustaining NRF2 stabilization and translocation to the nucleus. NRF2 induces gene transcription, forming a positive feedback regulation loop with p62 (6).
The proinflammatory transcription factor NF-κB, a key regulator of genes in adaptive and innate immunity, is activated by oxidative stress. Significantly stimulated in chronic and acute inflammatory disorders, NF-κB plays a crucial role in host defense, triggering the upregulation of proinflammatory genes.
MicroRNAs (miRNAs), small non-coding molecules, regulate gene expression, influencing controlled cell processes such as proliferation, differentiation, and apoptosis. Altered miRNA expression is associated with various neurodegenerative disorders, making them potential diagnostic markers and therapeutic targets (8). miR-135-5p, identified as a negative regulator of p62, has been linked to the regulation of allergic inflammation, cellular interactions, and autophagic flux (10).
Apoptosis, a pivotal intracellular process for organismal homeostasis, plays a role in MS pathogenesis through the involvement of the p53 transcription factor. p53 contributes to processes like DNA repair, cell regulation, and apoptosis and is hypothesized to regulate neuronal death in disorders such as MS (11).
Materials and Methods
Patients and sample collection
The present research was performed in the Unit of Biochemistry and Molecular Biology (UBMB) in the Department of Medical Biochemistry and Molecular Biology in collaboration with the Department of Neurology, Faculty of Medicine, Cairo University. The local ethical committee in Kasr Al-Ainy Hospitals approved the study (Approval number: MD-361-2020).
The study was performed on 90 participants; 30 healthy controls with matching sex & age and 60 MS patients (relapsing-remitting & secondary progressive) recruited from the Neurology Department Outpatient Clinic, Kasr Al-Ainy Hospital, Faculty of Medicine, Cairo University. Informed consent was obtained from the participants. Inclusion criteria were patients of both sexes between 20 to 45 years and diagnosed with MS based on the revised McDonald criteria (12). Participants underwent complete medical history taking & clinical examination, including sex, disease course, positive family history, age, presentation mode (initial symptoms), and age of disease onset. Clinical examination, including general and neurological examination, was done.
Sample collection
Three millimeters of venous blood were collected from controls & patients and was left to clot and subsequently centrifuged for 5 min at 8000 x g to separate the serum that was preserved at -80 °C.
Gene Expression of NRF2, p62, and NF-κB in serum by RT-PCR
Qiagen kit (Qiagen, USA) was utilized for total RNA extraction from serum as per the manufacturer’s instructions. RNA quality was evaluated utilizing a NanoDrop® 1000 spectrophotometer (NanoDrop Technologies, Inc. Wilmington, USA). Then, complementary DNA (cDNA) was synthesized using High-Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific Baltics UAB, V.A. Graiciuno 8, LT-02241, Vilnius, Lithuania) following the manufacturer’s utilizing Real time-qPCR and SYBR Premix Ex TaqTM II (Perfect Real Time, TaKaRa, Japan). The PCR reaction conditions were: 5 minutes at 95 °C, then 40 cycles at 95 °C for 15 seconds, and 60 °C for 60 seconds. To quantitatively examine the data, the RQ of each target gene is measured by normalizing against the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase for (NRF2, p62 and NF-κB) using the calculation of the 2 -ΔΔCt. The relative quantitation was calculated using the Applied Biosystem software.
The values of the cycle threshold (Ct) were graphically obtained for both GAPDH as well as different target genes. All target genes’ Ct values were first normalized to GAPDH in the same sample and expressed as ΔCt values. Afterward, ΔΔCt values were determined by the subtraction of the ΔCt values of the control samples from that of the treated samples, whereas 2−ΔΔCt values were determined to represent different target gene amounts. The final values presented were expressed as ratios to control cells. The studied genes’ primer sequence is displayed in Table 1
Table 1.
Primer’s sequence of studied genes.
| Gene symbol | NCBI code | Primer sequence (5'- 3') | |
|---|---|---|---|
| NRF2 | NM_001313904.1 | F | AGCCCAGCACATCCAGTCAG |
| R | TGCATGCAGTCATCAAAGTACAAAG | ||
| p62 | NM_001142299.2 | F | ATACGGGTGGGAATGTTGAG |
| R | TTCTGGCATCTGTAGGGACTG | ||
| NFKB | XM_054350118.1 | F | GCAGCACTACTTCTTGACCACC |
| R | TCTGCTCCTGAGCATTGACGTC | ||
| GAPDH | NM_001289746.2 | F | GCACCGTCAAGGCTGAGAAC |
| R | TGGTGAAGACGCCAGTGGA | ||
| MiRNA 135-5P | NR_029677.1 | F | CAGTGCAGGGTCCGAGGTAT |
| R | CGTCGTATGGCTTTTTATTCC | ||
| U6 | NR_004394 | F | GCTTCGGCAGCACATATACTAAAAT |
| R | CGCTTCACGAATTTGCGTGTCAT | ||
*F: Forward primer, R: Reverse primer.
Gene expression of miRNA-135-5P by RT-PCR
miRNA was extracted from serum samples using mirvana kit, (Thermo Fisher, MA, USA). The TaqMan® Micro RNA Assays are designed to detect and accurately quantify mature miRNAs using Applied Bio systems real time PCR instruments. The process of synthesis of single-stranded cDNA from miRNA samples using the TaqMan® Micro RNA Reverse Transcription Kit, USA, using the U6 snRNA as an endogenous control for normalization. The comparative CT method (ΔΔCT) was utilized to determine the relative expression of the miRNA-135-5P gene within the patient and control groups. The studied gene’ primer sequence is displayed in Table 1.
Statistical analysis
Data analysis, coding, and entry were done utilizing the 22nd version of the SPSS software. Data were summarized as SD and mean quantitative variables as well as relative frequencies (percentages) and frequencies (number of cases) for categorical variables. Comparisons between groups were made utilizing the unpaired t-test when comparing two groups and analysis of variance (ANOVA) when comparing more than two groups. For comparing categorical data, the Chi-square (X2) test was performed. Correlations between quantitative variables were done utilizing the Pearson correlation coefficient (13).
Detection of P53/TP53 level by ELISA
ELISA was done based on the manufacturer’s recommendations of Sun Long Biotech Co., LTD for the estimation of human p53 in serum (Catalog Number# SL 1323Hu).
Results
Demographic and disease characteristics of the study cohort
In our study, the MS patients included two types, the relapsing-remitting type (70%) & the secondary progressive type (30%). The Mean ±SD of age was 32.8±6.9, and females represented a relatively larger proportion (75%) compared to males (25%) among MS patients. The mean age of onset of MS is 27.6±7.14 while the mean disease duration is 5.18±3.4. The most frequent first presentation of MS is motor presentation (46.7%), while the least is urinary symptom (1.7%) (Table 2).
Table 2.
Demographic and disease characteristics of the study cohort.
| Variable | Patients (Total 60), N (%) |
|---|---|
| Sex (count/%) | |
| Females | 45 (75%) |
| Males | 15 (25%) |
| Age (Mean ±SD) | 32.8±6.9 |
| Age at onset (years) | 18-42 |
| Mean ±SD | 27.6±7.14 |
| Disease duration (years) | 0-14 |
| Mean ±SD | 5.18±3.4 |
| EDSS | |
| 0.5 - 3.5 | 42 (70%) |
| 4 – 6 | 18 (30%) |
| First presentation | |
| Ataxia | 7 (11.7%) |
| motor | 28 (46.7%) |
| sensory | 12 (20%) |
| urinary | 1 (1.7%) |
| visual | 12 (20%) |
Biochemical and molecular results Gene expression of p62, NRF2, NF-κB, and miRNA135
Concerning the expression levels of NRF2 (transcriptional factor that regulates antioxidative response) & p62 (positive regulator of NRF2) genes, there was a substantial decline in their expression in the MS group than the control group (p-value < 0.001) (Fig. 1A).
Fig. 1.
A: comparison of NRF2 and p62 genes expression between studied group. B: comparison of NFKβ gene expression between studied groups. C: comparison of miRNA135 expression between studied groups. D: comparison of P53 level between studied groups. (*) Denotes significant difference compared to controls.
Regarding the gene expression of NF-κB, there was a substantial elevation in its expression in MS than controls (P-value < 0.001) (Fig. 1B).
According to Fig. 1C, our results showed that miRNA 135-5P gene expression in the MS group was substantially elevated than controls (P value < 0.001).
P53 serum level Our results concerning the P53 level demonstrated a substantial elevation in the MS group compared to controls (P value < 0.001) (Fig. 1D).
Correlations
In our study, there was an inverse correlation between relapse and both NRF2 & p62 (r= -0.347, p-value =0.007) & (r= -0.343, p-value =0.007) respectively (Figs. 2A & B).
Fig. 2.
A: Correlation between relapse and p62. B: Correlation between relapse and NRF2. C: Correlation between miRNA 135 and NFKB.
This study revealed a positive significant correlation between miRNA 135-5P and NF-κB (r= 0.289, p value =0.025) (Fig. 2C).
Discussion
This study highlights significant alterations in miRNA135-5p, NF-κB expression, P53 levels, NRF2, and p62 in multiple sclerosis (MS) patients compared to controls. Also, miRNA135-5p was positively correlated with NFκB, which highlights the possible role of miRNA135-5p in MS pathogenesis through its inflammatory effect.
The pathogenesis of multiple sclerosis (MS) remains unclear and complex, with various theories under consideration (14,15). Oxidative stress plays a crucial role in MS pathophysiology, as reactive oxygen species (ROS) are generated during cellular respiration and neurotransmission at concentrations deleterious to cell survival. In relation to NRF2, a transcription factor that regulates antioxidative responses, it was substantially diminished in the MS group compared to the controls. This finding aligns with the studies of (16,19), indicating a decrease in NRF2 expression in MS patients. Consequently, there is a reduction in antioxidant capacity, and mesenchymal stem cells (MSC) exhibit decreased secretion of GSTP and SOD1. This decrease may contribute to the pathogenic mechanisms observed in MS.
Consistent with our findings, a study by (20) reported that NRF2 induction through activators such as resveratrol and melatonin contribute to the regeneration of antioxidant responses and attenuation of inflammation in MS. Furthermore, another study demonstrated the beneficial effects of DMF (Dimethyl fumarate) on the clinical outcome in MS through the induction of the NRF2 pathway (21).
In addition to its antioxidant activity, NRF2 controls biogenesis and mitochondrial function, addressing symptoms associated with neuroinflammation and mitochondrial malfunction observed in various neurodegenerative disorders (3).
Furthermore, p62, a recently discovered ubiquitin-binding protein, is considered a positive regulator of NRF2 (17). In our study, p62 gene expression exhibited a significant decline in the MS group compared to controls. This finding is consistent with a study by (22), which demonstrated that the oxidative effects of diabetes in testicular tissues might be mediated by reduced p62 expression.
Another study (23) supports our results, reporting diminished p62 expression in Alzheimer’s Disease (AD), and loss of p62 function leading to neurodegeneration. This finding aligns with another study indicating reduced levels of p62 in mice's spinal cord at all stages of experimental autoimmune encephalomyelitis (EAE) (24). Additionally, P62 negatively regulates the inflammasome pathway through the degradation of ubiquitinated inflammasome proteins via autophagy (25). P62 protects against neuroinflammation and neuronal death by eliminating toxic tau species in a mouse model brain (26).
In contrast to our study, in a spinal muscular atrophy (SMA) mouse model, p62 protein levels were elevated in spinal cord lysates, indicating autophagy dysregulation (27).
The current study demonstrated a negative correlation between relapse and p62 and NRF2 levels. This result suggests using them as a predictor of relapse in MS patients.
Due to the crosstalk between anti-inflammatory and antioxidant pathways, several of NRF2’s mitochondrial and anti-inflammatory actions are deemed secondary to its antioxidant actions, as NF-κB is upregulated via oxidative stress, can be blocked by induction of the NRF2-dependent antioxidant target genes. Additionally, Nrf2 inhibits NF-κB nuclear translocation (30). Evidently, NF-κB and Nrf2 interact in neurodegenerative disorders, where the elevation in NF-κB exacerbates neuroinflammation, whereas elevated Nrf2 provides neuroprotection (31).
Regarding NF-κB, the proinflammatory transcription factor, our observations indicate a substantial upregulation of NF-κB expression in MS cases compared to controls. This aligns with findings from (28,29), which demonstrated NF-κB activation in various cell types within MS and CNS cases, including neurons, oligodendrocytes, astrocytes, microglia/macrophages, and T cells (15). NF-κB serves as a significant gene regulator in both adaptive and innate immunity, displaying heightened activity in chronic and acute inflammatory conditions and being responsible for the upregulation of proinflammatory genes (7).
Another study by (28) supports our findings, reporting that aberrant NF-κB activation contributes to MS by increasing proinflammatory cytokines, leading to inflammatory demyelination of the CNS.
Concerning miRNAs, they play a crucial role in regulating gene expression, controlling cell proliferation, differentiation, and apoptosis (8). Altered miRNA expression has been linked to various neurodegenerative disorders, including miRNA-135-5p (18). To our knowledge, miRNA-135-5p expression had not been determined in MS before this study. Our findings reveal a substantial elevation of miRNA-135-5p in MS patients compared to controls. This aligns with the results from (33), who discovered that high expression of miRNA-135-5p contributes to epilepsy-induced nerve cell apoptosis, while a miRNA-135-5p inhibitor protects nerve cells against epilepsy-induced apoptosis, presenting a novel strategy for treating seizure-induced neural damage. MiRNA-135-5p is expressed in various tissues, including the brain, cerebellum, ovary, prostate, and others (32).
MiRNA-135-5p exhibits multiple functions in both neoplastic and non-neoplastic conditions and holds potential applications as a marker for both. Our results are consistent with another study demonstrating that the upregulation of miRNA-135-5P plays a crucial anticancer role in ovarian cancer by significantly reducing cell proliferation while promoting cell apoptosis (34). Additionally, (35) demonstrated a high expression level of miRNA-135-5P associated with disease activity in rheumatoid arthritis patients.
A prior study discovered that miRNA-135-5p may contribute to depression by reducing SIRT1 expression. Inhibiting miRNA-135-5p alleviates neuronal apoptosis, substantially reduces the expression levels of cleaved caspase-3, and decreases inflammatory responses by upregulating the expression of SIRT1. Consequently, it contributes to the antidepressant effect of the miRNA-135-5p inhibitor (36).
In contrast to our study, the inhibition of miRNA-135-5p induced memory impairment and synaptic disorders in Alzheimer's disease (AD), suggesting a potential therapeutic role of miRNA-135-5p in AD (37). Kim et al. found that the miRNA-135-5p-p62 axis regulates allergic inflammation mediated by extracellular vesicles in rat basophilic leukemia (RBL2H3) cells (10). They observed that miRNA-135-5p diminished the p62 expression level, and thus, they reported that miRNA-135-5p acts as a negative regulator of p62. These results coincide with our work, as we hypothesize that miRNA-135-5p may act as a negative regulator of p62 in MS.
Our findings also revealed a positive association between miRNA-135-5p and NF-κB, aligning with (38), who illustrated that miR-135-5p induction is mediated by NF-κB's activation and inflammatory responses in gastric cancer cells.
P53, a transcription factor involved in apoptosis (39), acts as a tumor inhibitor, limiting cell proliferation, stimulating apoptosis, and inducing cell cycle arrest in response to cellular stresses (40). In this study, the p53 level was considerably elevated in MS cases compared to controls. This finding aligns with Valiullina et al., who observed elevated expression levels of p53 in MS patients compared to healthy controls, indicating induction of apoptosis and neuronal death (11).
Wild-type p53 functions both as an antioxidant and pro-oxidant factor, regulating intracellular ROS levels. Under basal stress levels, basal p53 reduces ROS production by inducing several antioxidant gene expressions. However, under severe stress, p53 is elevated, leading to the induction of pro-oxidant and proapoptotic genes (41).
The crosstalk between p53 and Nrf2 is crucial for maintaining cellular homeostasis. In prior research, Nrf2 was shown to be required for the basal transcription of E3 ubiquitin ligase MDM2, which regulates p53 by poly-ubiquitinating it for proteasomal degradation, ultimately promoting p53 degradation (42). This is consistent with our results, indicating that a low expression level of NRF2 is associated with elevated P53 levels.
In conclusion, our study revealed a significant increase in miRNA-135-5p, NF-κB expression, and P53 levels, while there is a substantial decline in NRF2 and p62 expression in MS patients compared to controls. These findings suggest the potential use of miRNA-135-5p, NF-κB, and P53 as therapeutic targets and diagnostic markers in MS.
Ethical approval
All measures were carried out following the ethical considerations of the Research Committee of Kasr Al-Ainy, Cairo University Hospitals, Approval number: MD-361-2020. All subjects provided informed consent prior to data collection and following the explanation of research objectives.
Funding
This research was funded by Cairo University.
Conflicts of interest
All authors declare no conflicts of interest.
Acknowledgments
Gratitude and much appreciation to Medical Biochemistry & Molecular Biology, and Neurology departments, Faculty of Medicine, Cairo University.
References
- 1.Reich DS, Lucchinetti CF, Calabresi PA. Multiple Sclerosis. N Engl J Med. 2018;378(2):169–180. doi: 10.1056/NEJMra1401483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Nellessen A, Nyamoya S, Zendedel A, Slowik A, Wruck C, Beyer C, et al. Nrf2 deficiency increases oligodendrocyte loss, demyelination, neuroinflammation and axonal damage in an MS animal model. Metab Brain Dis. 2020;35(2):353–362. doi: 10.1007/s11011-019-00488-z. [DOI] [PubMed] [Google Scholar]
- 3.Brandes MS, Gray NE. NRF2 as a Therapeutic Target in Neurodegenerative Diseases. ASN Neuro. 2020;12:1759091419899782. doi: 10.1177/1759091419899782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.He F, Ru X, Wen T. NRF2, a Transcription Factor for Stress Response and Beyond. Int J Mol Sci. 2020;21(13):4777. doi: 10.3390/ijms21134777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bakhtiyari N, Sharifi A, Aftabi Y, Gilani N, Zafari V, Ansarin A, Seyedrezazadeh E. Association Between NOX4 And Nrf2 Genes in Non-Small-Cell Lung Carcinoma: A Case-Control Study. Rep Biochem Mol Biol. 2021;10(2):327–333. doi: 10.52547/rbmb.10.2.327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Robledinos-Antón N, Fernández-Ginés R, Manda G, Cuadrado A. Activators and Inhibitors of NRF2: A Review of Their Potential for Clinical Development. Oxid Med Cell Longev. 2019;2019:9372182. doi: 10.1155/2019/9372182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zheng K, Hu F, Zhou Y, Zhang J, Zheng J, Lai C, et al. miR-135a-5p mediates memory and synaptic impairments via the Rock2/Adducin1 signaling pathway in a mouse model of Alzheimer’s disease. Nat Commun. 2021;12(1):1–16. doi: 10.1038/s41467-021-22196-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Han D, Dong X, Zheng D, Nao J. MiR-124 and the Underlying Therapeutic Promise of Neurodegenerative Disorders. Front Pharmacol. 2020;10:1555. doi: 10.3389/fphar.2019.01555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Saad El-Din S, Ahmed Rashed L, Eissa M, Eldemery AB, Abdelkareem Mohammed O, Abdelgwad M. Potential Role of circRNA- HIPK3/microRNA-124a Crosstalk in the Pathogenesis of Rheumatoid Arthritis. Rep Biochem Mol Biol. 2022;10(4):527–536. doi: 10.52547/rbmb.10.4.527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kim M, Park Y, Kwon Y, Kim Y, Byun J, Jeong MS, et al. MiR-135-5p-p62 Axis Regulates Autophagic Flux, Tumorigenic Potential, and Cellular Interactions Mediated by Extracellular Vesicles During Allergic Inflammation. Front Immunol. 2019;10:738. doi: 10.3389/fimmu.2019.00738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Valiullina AY, Gomzikova M, Garanina EE, Khaibullin T, Rizvanov A, Bulatov E. Small Molecule p53-MDM2 Inhibitors as Potential Regulators of p53-Dependent Genes Expression in Multiple Sclerosis. Blood. 2017;130(Sup 1):4820. [Google Scholar]
- 12.Thompson AJ, Banwell BL, Barkhof F, Carroll WM, Coetzee T, Comi G, et al. Diagnosis of multiple sclerosis: 2017 revisions of the McDonald criteria. Lancet Neurol. 2018;17(2):162–173. doi: 10.1016/S1474-4422(17)30470-2. [DOI] [PubMed] [Google Scholar]
- 13.Chan YH. Biostatistics 102: quantitative data--parametric & non-parametric tests. Singapore Med J. 2003;44(8):391–6. [PubMed] [Google Scholar]
- 14.Walton C, King R, Rechtman L, Kaye W, Leray E, Marrie RA, et al. Rising prevalence of multiple sclerosis worldwide: Insights from the Atlas of MS, third edition. Mult Scler. 2020;26(14):1816–1821. doi: 10.1177/1352458520970841. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pegoretti V, Swanson KA, Bethea JR, Probert L, Eisel ULM, Fischer R. Inflammation and Oxidative Stress in Multiple Sclerosis: Consequences for Therapy Development. Oxid Med Cell Longev. 2020;2020:7191080. doi: 10.1155/2020/7191080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Maldonado PP, Guevara C, Olesen MA, Orellana JA, Quintanilla RA, Ortiz FC. Neurodegeneration in Multiple Sclerosis: The Role of Nrf2-Dependent Pathways. Antioxidants (Basel). 2022;11(6):1146. doi: 10.3390/antiox11061146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gureev AP, Sadovnikova IS, Starkov NN, Starkov AA, Popov VN. p62-Nrf2-p62 Mitophagy Regulatory Loop as a Target for Preventive Therapy of Neurodegenerative Diseases. Brain Sci. 2020;10(11):847. doi: 10.3390/brainsci10110847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hussein M, Magdy R. MicroRNAs in central nervous system disorders: current advances in pathogenesis and treatment. Egypt J Neurol Psychiatry Neurosurg. 2021;57(1):1–11. [Google Scholar]
- 19.Redondo J, Sarkar P, Kemp K, Heesom KJ, Wilkins A, Scolding NJ, Rice CM. Dysregulation of Mesenchymal Stromal Cell Antioxidant Responses in Progressive Multiple Sclerosis. Stem Cells Transl Med. 2018;7(10):748–758. doi: 10.1002/sctm.18-0045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Michaličková D, Hrnčíř T, Canová NK, Slanař O. Targeting Keap1/Nrf2/ARE signaling pathway in multiple sclerosis. Eur J Pharmacol. 2020;873:172973. doi: 10.1016/j.ejphar.2020.172973. [DOI] [PubMed] [Google Scholar]
- 21.Hammer A, Waschbisch A, Kuhbandner K, Bayas A, Lee DH, Duscha A, et al. The NRF2 pathway as potential biomarker for dimethyl fumarate treatment in multiple sclerosis. Ann Clin Transl Neurol. 2018;5(6):668–676. doi: 10.1002/acn3.553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Samir SM, Elalfy M, Nashar EME, Alghamdi MA, Hamza E, Serria MS, Elhadidy MG. Cardamonin exerts a protective effect against autophagy and apoptosis in the testicles of diabetic male rats through the expression of Nrf2 via p62-mediated Keap-1 degradation. Korean J Physiol Pharmacol. 2021;25(4):341, 354. doi: 10.4196/kjpp.2021.25.4.341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nilsson P, Sekiguchi M, Akagi T, Izumi S, Komori T, Hui K, et al. Autophagy-related protein 7 deficiency in amyloid β (Aβ) precursor protein transgenic mice decreases Aβ in the multivesicular bodies and induces Aβ accumulation in the Golgi. Am J Pathol. 2015;185(2):305, 13. doi: 10.1016/j.ajpath.2014.10.011. [DOI] [PubMed] [Google Scholar]
- 24.Bhattacharya A, Parillon X, Zeng S, Han S, Eissa NT. Deficiency of autophagy in dendritic cells protects against experimental autoimmune encephalomyelitis. J Biol Chem. 2014;289(38):26525, 26532. doi: 10.1074/jbc.M114.575860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Biasizzo M, Kopitar-Jerala N. Interplay Between NLRP3 Inflammasome and Autophagy. Front Immunol. 2020;11:591803. doi: 10.3389/fimmu.2020.591803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ono M, Komatsu M, Ji B, Takado Y, Shimojo M, Minamihisamatsu T, et al. Central role for p62/SQSTM1 in the elimination of toxic tau species in a mouse model of tauopathy. Aging Cell. 2022;21(7):e13615. doi: 10.1111/acel.13615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Custer SK, Androphy EJ. Autophagy dysregulation in cell culture and animals models of spinal muscular atrophy. Mol Cell Neurosci. 2014;61:133–40. doi: 10.1016/j.mcn.2014.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zhang T, Ma C, Zhang Z, Zhang H, Hu H. NF-κB signaling in inflammation and cancer. MedComm (2020). 2021;2(4):618–653. doi: 10.1002/mco2.104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yue Y, Stone S, Lin W. Role of nuclear factor κB in multiple sclerosis and experimental autoimmune encephalomyelitis. Neural Regen Res. 2018;13(9):1507–1515. doi: 10.4103/1673-5374.237109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Davinelli S, Saso L, D'Angeli F, Calabrese V, Intrieri M, Scapagnini G. Astaxanthin as a Modulator of Nrf2, NF-κB, and Their Crosstalk: Molecular Mechanisms and Possible Clinical Applications. Molecules. 2022;27(2):502. doi: 10.3390/molecules27020502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sivandzade F, Prasad S, Bhalerao A, Cucullo L. NRF2 and NF-κB interplay in cerebrovascular and neurodegenerative disorders: Molecular mechanisms and possible therapeutic approaches. Redox Biol. 2019;21:101059. doi: 10.1016/j.redox.2018.11.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kadkhoda S, Eslami S, Mahmud Hussen B, Ghafouri-Fard S. A review on the importance of miRNA-135 in human diseases. Front Genet. 2022;13:973585. doi: 10.3389/fgene.2022.973585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wang Y, Yang Z, Zhang K, Wan Y, Zhou Y, Yang Z. miR-135a-5p inhibitor protects glial cells against apoptosis via targeting SIRT1 in epilepsy. Exp Ther Med. 2021;21(5):431. doi: 10.3892/etm.2021.9848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ren R, Wu J, Zhou MY. MiR-135b-5p affected malignant behaviors of ovarian cancer cells by targeting KDM5B. Eur Rev Med Pharmacol Sci. 2020;24(22):11469. doi: 10.26355/eurrev_202011_23761. [DOI] [PubMed] [Google Scholar]
- 35.Liu C, Pan A, Chen X, Tu J, Xia X, Sun L. MiR-5571-3p and miR-135b-5p, derived from analyses of microRNA profile sequencing, correlate with increased disease risk and activity of rheumatoid arthritis. Clin Rheumatol. 2019;38(6):1753–1765. doi: 10.1007/s10067-018-04417-w. [DOI] [PubMed] [Google Scholar]
- 36.Tao Y, Gao K, Shen B, Zhang K, Zhang Z, Wang C. MicroRNA-135b-5p Downregulation Causes Antidepressant Effects by Regulating SIRT1 Expression. Biochem Genet. 2021;59(6):1582–1598. doi: 10.1007/s10528-021-10076-5. [DOI] [PubMed] [Google Scholar]
- 37.Zhou Y, Cui C, Ma X, Luo W, Zheng SG, Qiu W. Nuclear Factor κB (NF-κB)-Mediated Inflammation in Multiple Sclerosis. Front Immunol. 2020;11:391. doi: 10.3389/fimmu.2020.00391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Shao L, Chen Z, Soutto M, Zhu S, Lu H, Romero-Gallo J, et al. Helicobacter pylori-induced miR-135b-5p promotes cisplatin resistance in gastric cancer. FASEB J. 2019;33(1):264–274. doi: 10.1096/fj.201701456RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Joerger AC, Fersht AR. Structural biology of the tumor suppressor p53. Annu Rev Biochem. 2008;77:557–82. doi: 10.1146/annurev.biochem.77.060806.091238. [DOI] [PubMed] [Google Scholar]
- 40.Feroz W, Sheikh AMA. Exploring the multiple roles of guardian of the genome: P53. Egypt J Med Hum Genet. 2020;21:49. [Google Scholar]
- 41.Geismann C, Arlt A, Sebens S, Schäfer H. Cytoprotection "gone astray": Nrf2 and its role in cancer. Onco Targets Ther. 2014;7:1497–518. doi: 10.2147/OTT.S36624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.You A, Nam CW, Wakabayashi N, Yamamoto M, Kensler TW, Kwak MK. Transcription factor Nrf2 maintains the basal expression of Mdm2: An implication of the regulation of p53 signaling by Nrf2. Arch Biochem Biophys. 2011;507(2):356–64. doi: 10.1016/j.abb.2010.12.034. [DOI] [PubMed] [Google Scholar]