Identification and genomic analysis of a pathogenic circovirus associated with maricultured Scophthalmus maximus L. in China

Highlights

• •Discovered and identified a new type of aquaculture virus turbot circovirus (TurCV);.
• •The entire genome of TurCV was sequenced and its intracellular colonization morphology was identified.
• •TurCV mainly infects spleen and kidney in turbot.

Abstract

In China, a novel pathogen within the genus Circovirus has been identified as a causative agent of the ‘novel acute hemorrhage syndrome’ (NAHS) in aquacultured populations of turbot (Scophthalmus maximus L.). Histopathological examination using light microscopy revealed extensive necrosis within the cardiac, splenic, and renal tissues of the afflicted fish. Utilizing transmission electron microscopy (TEM), we detected the presence of circovirus particles within the cytoplasm of these cells, with the virions consistently exhibiting a spherical morphology of 20–40 nm in diameter. TEM inspections confirmed the predominance of these virions in the heart, spleen, and kidney. Subsequent molecular characterization through polymerase chain reaction (PCR) analysis corroborated the TEM findings, with positive signals in the aforementioned tissues, in stark contrast to the lack of detection in gill, fin, liver, and intestinal tissues. The TEM observations, supported by PCR electrophoresis data, strongly suggest that the spleen and kidney are the primary targets of the viral infection. Further characterization using biophysical, biochemical assays, and genomic sequencing confirmed the viral classification within the genus Circovirus, resulting in the nomenclature of turbot circovirus (TurCV). The current research endeavors to shed light on the pathogenesis of this pathogen, offering insights into the infection mechanisms of TurCV in this novel piscine host, thereby contributing to the broader understanding of its impact on turbot health and aquaculture.

1. Introduction

Our recent epidemiological survey among farmed turbot (Scophthalmus maximus L.) populations has identified a previously unrecognized condition, termed ‘novel acute hemorrhage syndrome’ (NAHS), which affects both juvenile and adult fish. Clinical presentations in affected individuals include pale gills with localized hemorrhaging and petechial hemorrhages, particularly evident around the fin bases and in close proximity to the circumfin and gill covers (Fig. 1). This lack of detectable parasites in tissue samples, coupled with the inconsistent recovery of bacteria from affected individuals, suggested a possible viral etiology. Subsequent analyses employing light microscopy and transmission electron microscopy (TEM) confirmed the presence of a pathogen resembling a Circovirus.

Fig. 1.

Outbreaks and clinical symptoms in turbot infected with turbot circovirus (TurCV). (A) A lot of foam appeared on the surface of the aquaculture pond 1–2 days before the onset. (B) In about a week, almost all the turbots in the entire breeding pool died. (C) After death, it manifests as bleeding from the fins of the turbot. Hemorrhagic symptoms (arrows) in blind side (D) and ocular side (E) of diseased turbot. (F) Turbot disease outbreak in pond-cultured farms results in massive mortality (October 2020; Rizhao, Shandong Province, China).

To date, only a few studies have documented Circovirus infections in fish, including Barbel (Barbus barbus) (Lőrincz et al., 2011) and European catfish (Silurus glanis) (Lőrincz et al., 2012). While the circovirus was identified in the infected specimens, its definitive role as a pathogen is yet to be established. Viruses within the family Circoviridae are distinguished as some of the smallest non-enveloped viruses identified, possessing a single-stranded circular DNA genome that ranges from 1.7 to 2.3 kilobases in size. The initial discovery of a circovirus in porcine cell culture by Tischer et al. (1982) paved the way for the subsequent characterization of numerous novel viruses exhibiting analogous traits. These discoveries collectively contributed to the formal establishment of the family Circoviridae. As of the latest taxonomic classification (Fauquet et al., 2005), the family comprises two well-defined genera. Random PCR amplification and sequencing, as described by Blinkova et al. (2010), revealed circular viral genomes that resemble circoviruses, plant geminiviruses, and nanoviruses in size and genome organization. Besides the members of the genus Circovirus of this family, new circular genomes of similar nature have been described in different environmental and marine samples (Rosario et al., 2009a, 2009b; Li, Linlin et al., 2010, 2010), showing that they are more widespread than previously thought, and samples from water sources suggest that fish might also be carriers of circoviruses. Extensive research was initiated after the detection of a fish circovirus (Lőrincz et al., 2011, 2012) in order to assess the presence and importance of these viruses in other fish species.

Scophthalmus maximus L., commonly known as turbot, has long been a staple in European aquaculture and was introduced to China in 1992. It has since become a significant species in the mariculture industry, particularly along the northern coastal regions of China (Gao et al., 2023). As reported by the China Fishery Statistical Yearbook, the production of flatfish with turbot being the primary contributor, reached 100.694 thousand tons in 2022. Despite its economic importance, the turbot industry has suffered substantial losses due to a spectrum of diseases caused by bacteria, viruses, and parasites. A period of heightened mortality, exceeding 95 %, was observed in S. maximus populations at various aquatic farms in provinces including Liaoning, Shandong, Hebei, Tianjin, and Jiangsu, predominantly from October and January between 2019 and 2023.

This study presents the discovery of a new Circovirus infecting the turbot species S. maximus in China. Polymerase chain reaction (PCR) amplification and subsequent sequencing were instrumental in the identification of this novel circular DNA virus. Comprehensive genomic characterization and phylogenetic analysis have classified the virus within the genus Circovirus, family Circoviridae, and it have designated as turbot circovirus (TurCV). This marks the inaugural report of a circovirus infection in farmed turbot within China. Additionally, the study assesses the biological characteristics and virulence of TurCV strains, providing valuable insights for subsequent research into the pathogenesis of this newly identified pathogen. The purpose of this study was to identify and analyze turbot circovirus.

2. Materials and methods

2.1. Infected and healthy turbots

Fish exhibiting the characteristic ‘novel acute hemorrhage symptom’ (NAHS), as depicted in Fig. 1, and healthy counterparts were sourced from a turbot farm in Huludao, Liaoning Province, P.R. China, in October 2023. The mean weight of the fish was between 30 and 500 g. For laboratory assessment, turbot with an average weight of 30.0 g (± 5.0 g) were procured from a commercial aquaculture facility in Yantai. These fish were confirmed to be free of bacterial infections upon necropsy. The specimens were transported to our laboratory in aerated conditions and were in a viable state prior to examination. Upon arrival, they were housed in tanks with a continuous supply of sand-filtered seawater at a temperature of 15.0 °C (± 1.0 °C) and a stocking density of approximately 6 kg/m³. The fish were acclimated to these conditions for a period of one week before the commencement of experiments. They were fed a commercial dry feed pellet twice daily throughout the experimental period. This study adhered to the ethical guidelines and regulations for the use of laboratory animals as outlined by East China University of Science and Technology, under the protocol number 2006272.

2.2. Histopathological analysis by light electron microscope

Post-mortem tissue samples, including those from the gill, liver, spleen, heart, kidney, intestine, and fin, were extracted from deceased fish and subsequently immersed in a 4 % neutral buffered formalin solution for a period of 48 h at ambient temperature to ensure fixation. Following fixation, the tissues underwent a dehydration process using a graded ethanol series and were subsequently cleared with dimethylbenzene prior to infiltration. The prepared tissues were embedded in paraffin blocks, from which sections of 5–7 micrometers in thickness were meticulously cut. Each section was then stained using hematoxylin and eosin (H & E) staining protocol to facilitate cellular contrast. The stained slides were examined under a light microscope (provided by Biomed World, China) for histological assessment.

2.3. Transmission electron microscopy observation

For the preparation of samples for transmission electron microscopy (TEM), tissue fragments measuring 1–2 mm³ from the heart, spleen, and kidney were fixed in a solution of 2.5 % glutaraldehyde in 0.1 M cacodylate buffer at a pH of 7.4 for a duration of 24 h at 4 °C. After fixation, the tissues were subjected to three successive rinses in 0.1 M PBS buffer for 10 min each. Subsequently, the specimens were postfixed in 1 % OsO₄, also in 0.1 M cacodylate buffer at a pH of 7.4, for a period of 1.5 h. Following postfixation, the tissues were rinsed once more in the same buffer before undergoing a dehydration series in graded concentrations of ethyl alcohol. The tissues were then embedded in Epon812 resin (Serva, NY, USA). Ultra-thin sections were prepared using a Reichert-Jung Ultracut-E microtome with a diamond knife, transferred onto copper grids, and stained with a mixture of 2 % uranyl acetate and lead citrate. The stained sections were subsequently examined and photographed using a JEM-1200EX TEM. The dimensions of the virus particles were measured directly from the TEM images.

2.4. PCR test of NAHS associated virus

To ascertain the molecular biological similarities between the NAHS virus and other known fish viruses, a polymerase chain reaction (PCR) analysis was conducted. Tissues including gill, liver, spleen, heart, kidney, intestine, and fin were aseptically excised from NAHS-affected turbot specimens. Total genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Tiangen, China), while RNA was extracted with Trizol reagent (Invitrogen, USA). Complementary DNA (cDNA) was subsequently synthesized utilizing the FastQuant RT Kit (Tiangen, China). DNA and cDNA samples were then used as templates and combined with primers specific to common fish viruses and PrimerSTAR polymerase (Takara, Japan) for PCR amplification. The specificity of the primers is detailed in Table 1. The resultant PCR products were resolved by electrophoresis on both 1 % (w/v) and 2 % (w/v) agarose gels. The DNA fragments were either directly sequenced or cloned using the pEASY-Blunt Zero Cloning Kit (Transgene, China) prior to sequencing, with the latter service provided by BGI (China).

Table 1.

PCR primers used in present work.

Name	GeneBank accession no.	Forward sequence (5′ → 3′)	Reverse sequence (5′ → 3′)	Amplicon size
Cap	PP417825	TCACCTCCATGTCAAAGTTGAC	AGGTCAAGCAGAAGGGCGTG	208
Out-cap	PP417825	GTCAACTTTGACATGGAGGTGA	CACGCCCTTCTGCTTGACCT	1566
LCDV	AF126405.1	CATCATGCCTTTGACAGC	GGATCAGCAGCAATACCC	348
LMBV	FR682503	GATCTCGCCACTTATGAC	GTCTCTGCCGAAAAAGAA	531
EHNV	AY187045	CGCCAAGATGTCGGGCAACC	TGGAGAAGAAGAATGGGAGGG	410
CCV	M75136	ACGTGTATCACGGTCTCACT	TTCGAGAATCGGGTCTCTGT	335
ISKNV	KC775382	CGTGAGACCGTGCGTAGT	AGGGTGACAGTCGATATG	562
RBIV	AY532606	ATGTACCCTGACTGTCCCAG	TTATTTCATAAGCCTTGCACA	429
SAV	JX163854	CCGTTGCGGCCACACTGGATG	CCTCGTAGGTAATCGACGGCAG	516
HRV	NC_005093	GTGCCAATGGTACACGGACAA	TGATCTCCGCATGTGCCTCTA	515
IHNV	X89213	ACAACCGCAGCCGCTCTGTA	CAGCGACCGTCATGCACATC	673
SVCV	AJ318079	TCTGTTCATTTAGAGCCA	GGATTTCATCGTCATCAT	850
VNNV	D30814	CGTGTCAGTCATGTGTCGCT	CGAGTCAACACGGGTGAAGA	426
CSBV	OM830952	CAAAACTACGGCCCCTGCTA	CGTGAATTGTTGTGCGGGTT	521

2.5. Whole viral TurCV's genome sequencing

The genomic DNA of the purified virions was successfully extracted utilizing the High Pure PCR Template Preparation Kit, as provided by Tiangen, China. Subsequently, the coding sequences within the viral genomes were determined using an ABI 3730 genome sequencer. The resultant sequences were aligned to form overlapping consensus sequences, which were subsequently assembled. Open reading frames (ORFs) within these assembled sequences were identified with the aid of DNAman version 5.2.2, a widely recognized molecular biology software (Wen et al., 2012).

To delineate the potential ORFs, the complete genome sequence of the turbot circovirus (TurCV) was deposited for analysis on the Softberry Inc.’s web server (http://www.softberry.com), a reputable provider of bioinformatics tools based in Mount Kisco, NY, USA. Furthermore, the conserved motifs and domains within the deduced proteins, which consisted of more than 50 amino acids, were examined using the National Center for Biotechnology Information's (NCBI) Conserved Domains Database (CDD) available at http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi. This approach is in accordance with established methodologies as described by Huang et al. (2021).

2.6. Evolutionary tree analysis and grading

Sequence similarity was assessed by comparing the deduced amino acid sequences using the Basic Local Alignment Search Tool (BLAST), which is accessible through the National Center for Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov/blast. The sequences were further analyzed utilizing the Expert Protein Analysis System (ExPASy), a platform provided by the Swiss Institute of Bioinformatics, available at http://www.expasy.org. Multiple sequence alignments were conducted for the deduced amino acid sequences employing the Muscle package with default settings, as per the methodology established by Liu et al. (2020). To investigate the phylogenetic relationships, whole-genome sequences from various strains of the genus Circovirus, within the family Circoviridae and order strains, were aligned using ClustalW software. Subsequently, a phylogenetic tree was constructed employing the Maximum Likelihood method with 1000 bootstrap replicates, as performed with Molecular Evolutionary Genetics Analysis (MEGA) version 11, following the protocol outlined by Li et al. (2015).

2.7. Artificial regression infection

In accordance with Koch's postulates as referenced by Blevins and Bronze (2010), challenge experiments were conducted on a cohort of healthy turbot (n = 20), with an average length of 12.8 cm. These fish were administered an intraperitoneal injection of 0.1 ml of a prepared virus suspension. Subsequently, kidney tissues harvested from the infected fish were homogenized at a ratio of 1:10 with sterile phosphate-buffered saline (PBS) and centrifuged at 1000 × g for 10 min to pellet the viral particles. The supernatant was filtered through a 0.22 μm pore-sized membrane to obtain a purified viral preparation, which was then directly injected intraperitoneally into a new set of healthy turbot to serve as the experimental group. A concurrent control group was injected with an equal volume of sterile PBS. The fish were housed in 40-liter tanks filled with artificial seawater, with the temperature maintained at 15.6 °C. Mortality was monitored daily, and the cumulative mortality rate was determined from the recorded data up to 21 days post-challenge.

3. Results

3.1. Outbreaks and gross signs of infection

According to the current epidemiological investigation, there is massive outbreak of Scophthalmus maximus L. in spring and winter, when the water temperature ranged from 13 to 18 °C. However, when the water temperature was below 13 °C or above 18 °C, fish mortality seldom occurred. The temperature pattern of the disease is similar to other reported occurrences (Gao et al., 2023; Ke et al., 2011; Shi et al., 2004). Species such as Japanese Flounder (Paralichthys olivaceus) (Gong et al., 2022), spotted knifejaw (Oplegnathus punctatus) (Huang et al., 2021), and Chinese tongue sole (Cynoglossus semilaevis) (Zhou et al., 2022), co-cultured with S. maximus in the same pond, were unaffected by the disease.

There are many signals before the onset of the disease, such as a large amount of foam appearing on the surface of the aquaculture pond 1–2 days before the onset (Fig. 1A). In about a week, almost all the turbots in the entire breeding pool had died (Fig. 1B). Signs of infected fish included lethargy, inappetence, petechial and eccymotic hemorrhages in gills and around the fin bases (Fig. 1C). The most prominent external gross pathology included red hemorrhage patches on the gills, petechial hemorrhage in fins and at the fin bases (Fig. 1D, E), and muscle punctate bleeding (Fig. 1D). Notably, this disease has caused widespread mortality among farmed turbot in China (Fig. 1B, F).

3.2. Histopathology assessment

Semithin sections of gill, liver, spleen, kidney, and heart from infected S. maximus showed pronounced infiltration of hemocytes compared with those from healthy fish. The most prominent histopathological changes were observed in the gill, spleen, kidney, and heart, exhibiting infiltration of hemocytes and lymphoid cells. Under a microscope, H & E staining revealed that the gills of turbot show the typical gill structure of teleost fish, consisting of a gill arch and gill filaments with supporting and epithelial cells. The gill structure was intact in the control group, with densely arranged and orderly gill filaments (Fig. 2A). Pathological changes in the gills of infected turbot included swelling of the ends of the branchial lamellae, proliferation of epithelial cells resulting in a stick-like structure of the branchial lamellae, and an increase in mucous secreting cells (Fig. 2B). In the control group, hepatocytes were arranged in cords with homogeneous cytoplasm and clear nuclei (Fig. 2C). In the infected group, hepatocytes swelled, underwent vacuolar degeneration, and hepatic tissue necrosis was also observed (Fig. 2D). Compared to the spleen of healthy fish, necrotic lesions often appeared in the splenic pulp, and many splenocytes were necrotized, showing nuclear degeneration and cytoplasmic hypertrophy and vacuolation (Fig. 2E, F). The kidney of healthy turbot showed a clear and complete structure (Fig. 2G). In contrast, in the infected fish kidney, hematopoietic cells exhibited marginal chromatin and karyorrhexis (Fig. 2H). In the control group, a clear structure of myocardial cells and tissue was observed (Fig. 2I). However, in the infected fish, there was cellular necrosis and an increase in interstitial spaces between muscle fibers (Fig. 2J). No obvious histopathological changes were observed in intestine and fins of infected S. maximus.

Fig. 2.

Histopathology of turbot infected with turbot circovirus (TurCV). The tissues of fish were fixed in total and longitudinal sections were prepared and stained with hematoxylin and eosin (H & E). Gill (A), liver (C), spleen (E), kidney (G) and heart (I) of control turbot. Pathological lesions of gill (B), liver (D), spleen (F), kidney (H) and heart (J) from infected turbot. The swelling of branchial lamellae ends (red arrows), proliferation of branchial lamella epithelial cells (black arrow) and increased of chlorine secreting cells (asterisks) were shown in gills. Vacuolar degenerated hepatocytes (white arrows) were shown in liver. The huge nodule (yellow cycle) and the necrotic tissue (white asterisks) were shown in spleen. Extensive granular degeneration with remained nuclei of renal tubular epithelial cells (blue arrows), necrotic renal tubular epithelial cells with nucleolysis and only the outline of nucleus (yellow arrow) and necrotic renal intestine (yellow asterisk) were shown in kidney. Myocardial filament rupture (purple arrow) and enlargement of muscle cell gap (green arrow) were shown in heart. Scale bars: 100 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.3. Ultrastructural pathology by TEM

The ultrastructural pathology showed obvious pathological changes and evidence of virus infection in the tissues of the heart, spleen, and kidney (Fig. 3). Typical circovirus-like particles were observed in the heart, spleen, and kidney of the infected fish. Numerous virions aggregated within the cytoplasm of infected cells, and virus particles exhibited a regular shape in the ultrathin sections. Representative spherical virions, approximately 30 nm in diameter, were observed (Fig. 3A). Electron microscopy revealed large aggregates of circovirus particles located in the cytoplasm and nuclei of cells. The distribution of the virus in infected fish varied across different tissues and cell types examined. Virions were predominantly observed in heart cells, spleen cells, and glomerular capillary basement membranes of infected fish.

Fig. 3.

The electron microscope analysis of heart, spleen and kidney from the infected turbot. (A-C) Large aggregates of turbot circovirus (TurCV) particles were present in the heart. Virus particles (white arrows) were located in the cytoplasm. (D-F) Detailed images of viruses multiplying and assembling in hematopoietic cells of spleen occurrence of some mature virus, whose finished packaging (red arrow) were observed in an enveloped virion within a cellular vesicle (black arrow). (G-I) Many virus particles of TurCV occur in infected leukocytes in kidney (purple arrows). Scale bars: 100 nm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

In the heart, free virions were sometimes found between myocardial fibers (Fig. 3B), and high, electron-dense nucleoids were observed with a diameter of 20–35 nm (Fig. 3C). High magnification TEM images provided clear evidence of the virus multiplying and assembling within hematopoietic cells of the spleen (Fig. 3D). The viruses were observed at different stages of assembly, ranging from complete particles containing electron-dense cores to incomplete particles with empty or partially full cores. The maturing process of the turbot circovirus (TurCV) occurred in the cytoplasm, particularly in the Golgi apparatus. Additionally, lysosomes were abundantly detected, and this phenomenon appeared to coincide with the appearance of viral particles (Fig. 3E, F). We hypothesized that the accumulation of invading pathogens may have influenced the lysosome density. The highest number of virus particles was seen in the kidney, and they generally aggregated at the assembly sites in the cytoplasm (Fig. 3G). After viral infection, mitochondrial structures were damaged, and granular osmiophilic substances, such as spherical virions, were found within the mitochondria (Fig. 3H, I). We conducted qRT-PCR experiments, which revealed lower cycle threshold (Ct) values in kidney cDNA amplifications, ranging from approximately 15 to 20 (data not shown), indicating a higher viral load in the kidneys compared to other tissues. This finding indicated that the kidney was the major target organ of the virus.

3.4. PCR results’ analysis

To compare the molecular biological similarity of the ‘novel acute hemorrhage syndrome’ (NAHS) virus and other fish viruses, a polymerase chain reaction (PCR) test was conducted. Amplification results showed that no PCR or RT-PCR positive samples were found for TRBIV (Shi et al., 2004), LCDV (Zhan et al., 2010), ISKNV (Dong et al., 2008), RBIV (Kim et al., 2007), LMBV (Plumb et al., 1999), EHNV (Jinghe et al., 1999), CCV (Wolf and Darlington Robert, 1971), or SAV (Shi et al., 2017), HRV (Zhang et al., 2017), IHNV (Wu et al., 2023), CSBV (Zhang et al., 2022), SVCV (Teng et al., 2007), VNNV (Nishizawa et al., 1995), or SMReV (Ke et al., 2011) in naturally or artificially infected turbot. Through metavirus omics analysis, we found a high abundance of circovirus genomic fragments. Meanwhile, PCR results showed several fragments ranging from 200 to 300 base pairs (bp) in length following amplification of the DNA template (Fig. 4A), but no fragments were obtained from the RNA template (Fig. 4B). We conducted nucleic acid testing for the turbot circovirus in diseased turbot from Shandong, Liaoning, Hebei, Jiangsu, and Tianjin from 2020 to 2023, with a turbot circovirus positive rate of about 80 % (Table 2). Nucleotide sequence similarity searches using BLASTX found no significant matches with any other virus, while at the amino acid levels, sequence comparison did show a certain degree of similarity with circovirus capsid (Cap) protein listed in the GenBank database (http://www.ncbi.nlm.nih.gov/genbank). The genome sequence of Cap revealed a novel Circovirus identified from infected turbot, which was subsequently named turbot circovirus (TurCV). All infected turbot samples were TurCV positive (Fig. 4C). This result demonstrated that the TurCV virus could be detected using PCR technology and specific primers. Polymerase gene-specific PCR amplification products were obtained from the tissues of the heart, spleen, and kidney from infected fish, but none in tissue from gill, liver, intestine, and fins, as well as those from healthy fish (Fig. 4D). The PCR amplification products were sequenced and aligned with different Circovirus using the Muscle package (Fig. 4E). The deduced TurCV Cap protein has the highest similarity with common circovirus and cyclovirus capsid proteins.

Fig. 4.

PCR detection of TurCV in different samples. Amplification of fish samples (a mixture of their spleen and kidney tissues) with PCR primer pairs targeted to common DNA viruses (A), and to common RNA viruses (B) with RT-PCR. (C) All samples with hemorrhagic symptoms were turbot circovirus (TurCV) positive. (D) TurCV detected in spleen, kidney, and heart of infected turbot. (E) Nucleotide sequence alignment of conserved DNA fragments of different circovirus or cyclovirus by Muscle package.

Table 2.

The Source and detection results of TurCV positive fish tissue samples.

Province Year	Liaoning		Shandong		Jiangsu		Hebei		Tianjin
	S	S+	S	S+	S	S+	S	S+	S	S+
2020	15	12	20	17	15	13	10	7	7	5
2021	25	23	30	26	20	17	20	16	10	8
2022	30	27	25	23	18	15	30	25	25	21
2023	24	19	21	17	31	19	24	21	20	18

“S” means the number of fish tissue samples. “S+” means the detection results of TurCV positive.

3.5. Sequencing and functional annotation of TurCV genome

The TurCV genome was sequenced using next-generation technology (NGS) on the Illumina Novaseq platform, as shown in Fig. 5A and B. After assembly, the whole-genome sequence of the turbot circovirus strain (TurCV10LN-18/2021) has been deposited in DDBJ/ENA/GenBank under the accession number PP417825 (BioProject number PRJNA1099169). The raw sequencing reads have also been submitted to the Sequence Read Archive (SRA) under accession number SRR28624788. The full-length genome sequence of TurCV was 1774 bp in length, within the characteristic range of recognized circoviruses, with a GC content of 49 % (Fig. 5C). Two major open reading frames (ORFs), arranged in opposite directions and typical for viruses of the genus Circovirus, could be identified. The longer ORF (ORF1), located between nucleotiede positions 807 and 1739 of the positive strand, encoding 310 amino acids starting with a standard ATG codon. The second ORF (ORF2), also with a standard ATG codon, started at nucleotide 771 and extended to position 76 in the opposite direction, potentially coding for 231 amino acids. Besides ORF1 and 2, one additional ORF of smaller sizes, ORF3 (99 aa, 300 bases, from nucleotides 583 to 882), was identified in the genome (Fig. 5D). A sequence that would allow the formation of a stem-loop structure characteristic of circoviruses was predicted by Mfold (Zuker, 2003) and was located within the 5′ intergenic region. Sequence comparisons revealed that the conserved nonanucleotide sequence (5′-TAGTATTAC-3′) of the TurCV stem-loop was identical to that of several members of the genus Circovirus, including BaCV (Lőrincz et al., 2011), porcine circovirus type I, and some avian circoviruses.

Fig. 5.

Characterization of the TurCV genome. (A) The schematic diagram of inverse polymerase chain reaction (PCR). (B) Lane M: Marker III; Lane 1–2: negative control (N); Lane 3–4: the products of amplication by Out-ap-F/R primers; Lane 5–6: the products of amplication by Cap-F/R primers. (C) The nucleotides composition of turbot circovirus (TurCV). (D) The genome map of TurCV10LN-18/2021. (E) The genome organization of turbot circovirus. The capsid and replication-associated proteins, the alternative open reading frames (ORFs) 3 are showed in different colors.

According to the Basic Local Alignment Search Tool (BLAST) search (Altschul et al., 1997), the two major ORF-encoded amino acid sequences were both similar to proteins of accepted members of the family Circoviridae and to those of the related viruses like cycloviruses (Li et al., 2010) and circular genomes from environmental samples (Rosario et al., 2009a). Blast analysis of ORF1 indicated homology with circovirus replication-associated protein (Rep) sequences at both the nucleotide and the amino acid level, and the putative protein is a member of the circovirus Rep family according to the Pfam database search. The amino-terminal part of the potential capsid (Cap) protein, coded by ORF2, carries a 31-aa-long arginine-rich stretch (RRRTFRRPIRRRMHRRTRGRRMIRRRSRRSR) starting at residue 4, homologous to the circovirus Cap nuclear localization signal. Besides the major ORFs, an additional potential coding regions, ORF3, which codes for 99 amino acids, was identified. BLASTP revealed no significant matches with other viral proteins for ORF3 (Fig. 5E).

3.6. Phylogenetic analysis and classification

Phylogenetic analysis has revealed that TurCV belongs to the Circoviridae family, warranting its own distinct branch among the genomes of other characterized circoviruses. As depicted in Fig. 6, we conducted a comparative phylogenetic analysis of 35 representative viruses of the family Circoviridae. The complete genomic sequences of established avian and porcine circoviruses, in addition to the genomes of TurCV from the current study, were all found to be situated on a branch that corresponds to the genus Circovirus. This positioning confirmed the inclusion of turbot circoviruses within this genus. Conversely, the newly characterized circovirus-like genomes, including those of cycloviruses, were observed to be positioned outside the genus Circovirus. This finding suggests that our study may have identified a novel strain of TurCV, which, upon further analysis, could be classified within the family Circoviridae and potentially warrants a reevaluation of its genus classification. Notably, the highest degree of sequence similarity observed among the turbot virus genomes and the known circular genomes was 35 %, specifically between TurCV and Porcine circovirus I. Collectively, the phylogenetic analyses suggest that TurCV is a novel Circovirus and likely represents the founding member of a separate branch within the proposed genus Circovirus of the family Circoviridae (Fig. 6).

Fig. 6.

Evolutionary analysis by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method and Tamura-Nei model (Tamura and Nei, 1993). The tree with the highest log likelihood (-79118.18) is shown. The percentage of trees in which the associated taxa clustered together is shown above the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura-Nei model, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The proportion of sites where at least 1 unambiguous base is present in at least 1 sequence for each descendent clade is shown next to each internal node in the tree. This analysis involved 35 nucleotide sequences. There were a total of 2318 positions in the final dataset. Evolutionary analyses were conducted in MEGA11 (Tamura et al., 2021).

3.7. Animal experiments

In the challenge experiment, healthy turbot were exposed to a suspension of kidney tissue from infected fish. The exposed fish subsequently developed ocular lethargy and hemorrhagic symptoms, closely resembled those observed in naturally infected individuals, with the onset typically occurring between 4 and 6 days post-infection (dpi), as illustrated in Fig. 7A and B. Kidney tissue from artificially infected, deceased fish was subjected to PCR analysis. The outcome was a positive detection for TurCV, as shown in Fig. 7C, which is consistent with Koch's postulates. Following the challenge with the TurCV10LN-18/2021 strain, the cumulative mortality rate among the turbot reached 95 % by the end of the 21-day observation period, as depicted in Fig. 7D. The deceased fish presented pathological signs consistent with those seen in naturally affected individuals. In contrast, the control group, which was not exposed to the virus, showed no clinical signs of infection. Additionally, TurCV was consistently detected in tissues from the infected fish, while no virus was detected in the control group.

Fig. 7.

Clinical symptoms of turbot infected with TurCV. (A, B) Gross pathological signs of infected turbot (black arrows), including hemorrhages on the lower jaw, anterior abdominal and the fin bases. (C) Polymerase chain reaction (PCR) detection of turbot circovirus (TurCV) from dead fish (a mixture of their spleen and kidney tissues) at 5 days post infection (dpi). Lanes 1–4 represented negative control, DNA marker I, fish sample 1, fish sample 2. (D) Cumulative mortality rate of TurCV in turbot. Cumulative mortality of turbot after challenge with TurCV10LN-18/2021 were recorded up 95 % to 21 dpi.

Additionally, we conducted a histopathological examination of spleen, kidney, and heart tissues from the challenged fish using hematoxylin and eosin (H & E) staining. The findings revealed that basophilic hypertrophied cells were notably present in the spleen and kidney as early as 5 dpi, with a smaller number also observed in the heart. By 7 dpi, there was a marked increase in the prevalence of these basophilic hypertrophied cells across all examined tissues—spleen, kidney, and heart. In contrast, the control group, which was not subjected to the challenged, showed no such cellular changes of this sort (data not shown).

4. Discussion

The turbot, a species of significant economic importance within the global aquaculture industry, has experienced rapid growth in recent years. The intensification of farming practices, coupled with the regular translocation of turbot, has led to an increased incidence of emerging diseases within this species (Gao et al., 2023; Ke et al., 2011; Shi et al., 2004; Sun et al., 2022). An emerging disease among farmed turbot populations has recently gained momentum in China, presenting a highly contagious and potentially devastating threat to the sustainability and expansion of the aquaculture industry. This study presents the detection and comprehensive characterization of a novel Circovirus, provisionally named as turbot circovirus (TurCV), identified as the etiological agent responsible for ‘novel acute hemorrhage syndrome’ (NAHS) observed in turbot. The identification and characterization of this novel pathogen were conducted through a multifaceted approach, which included the examination of virus morphology, phylogenetic analysis, clinical symptomatology, histopathological assessment, viral genomic sequencing, and pathogenicity challenge experiments. Collective findings indicate that TurCV is a distinct Circovirus, tentatively classified within the proposed species of Circovirus, with the capacity to induce significant mortality in turbot populations. The disease characterized by NAHS has been observed in an outbreak affecting farmed turbot in northern China from 2019 to 2023.

In our study, TurCV has been confirmed to be a causative agent. This represents the third instance of a fish species, following Barbel (Barbus barbus) (Lőrincz et al., 2011) and European catfish (Silurus glanis) (Lőrincz et al., 2012), where a Circovirus has been reported in relation to fish diseases. The global dissemination of circoviruses is a matter of significant concern, posing a substantial threat to economically vital aquaculture species. It is imperative to conduct further research into the pathogenesis, prevention and control strategies for these diseases. Pathological studies represent the foundational step in elucidating the mechanisms underlying TurCV infection in this novel host. Subsequent research endeavors should extend to the establishment of sensitive cell lines and the exploration of potential broad-spectrum vaccines. This paper contributes a detailed characterization of the infected tissues, optimal temperature, temporal patterns, and molecular signatures associated with TurCV in the turbot (Scophthalmus maximus L.).

Viruses belonging to the family Circoviridae are recognized as some of the smallest viruses identified to date, characterized by their single-stranded circular DNA genomes that typically range from 1.7 to 2.3 kilobases in size. These viruses have a broad host range and are commonly found in various avian species and pigs. Moreover, recent advancements in virological research have led to the detection of circoviruses in fish populations, expanding the known host spectrum for this virus family (Lőrincz et al., 2011, 2012). Members of the genus Circovirus within the family Circoviridae exhibit several defining characteristics: 1) A stem-loop structure integral to the rolling-circle replication mechanism, which is a common mode of replication for these viruses; 2) The presence of two principal open reading frames (ORFs), strategically located on the positive and complementary strands of the viral genome. The first ORF encodes a replication-associated protein (Rep), pivotal role in viral replication, while the second ORF encodes the capsid protein (Cap), forming the virus particle's protective shell (Meehan et al., 1997).

To the best of our knowledge, the cultivation temperature in the aquaculture setting is a critical factor influencing the infection and replication dynamics of TurCV. Deviation from the optimal temperature range can adversely affect the replication and long-term persistence of the virus. In our controlled pathogenicity assays conducted under laboratory conditions, TurCV has induced a mortality rate of approximately 90 % in juvenile turbot weighing 50 g when maintained at a temperature of 14.5 ± 1 °C. Unfortunately, TurCV has not been successfully isolated using cell culture methods to date. The pathogenicity studies of TurCV are generally conducted within a temperature range of 13 to 18 °C. Clinical signs observed in infected fish encompass pale gills with localized hemorrhages, petechial hemorrhages in the fins and at the fin bases, and particularly hemorrhages around the circumfin and gill cover. These symptoms are frequently observed in both farmed and experimentally infected turbot populations. Furthermore, histopathological examination of the affected tissues revealed a significant increase in both intranuclear and cytoplasmic viral particle numbers, with a particularly high concentration observed in the spleen and kidney of infected fish. In our attempts to culture the TurCV with cell lines including epithelioma papulosum of carp (EPC), chinook salmon embryo (CHSE-214), and bluegill fry (BF-2), no distinct cytopathic effects (CPE) were observed (data not shown). This lack of CPE suggests that further research is necessary to elucidate the mechanisms underlying TurCV infection in novel fish hosts. The development of sensitive cell lines and the exploration of a broad-spectrum vaccine are anticipated to be instrumental in advancing our understanding of TurCV pathogenesis and in preventing disease outbreaks across a wide range of potential aquaculture-destined fish species.

Literature reviews indicate that circovirus infections are associated with the suppression of the host's immune-related genes, compromising the immune response and subsequently reducing the host's overall immunocompetence. Additionally, fluctuations in environmental parameters, such as temperature, pH, and osmotic pressure, are known to exacerbate the impact of the infection and may precipitate host mortality. At the same time, literature reports have shown that turbot can die on a large scale due to infection with common pathogens such as Edwardsiella piscicida (Yin et al., 2020), Vibrio anguillarum (Yang et al., 2018), Vibrio alginolyticus (Cai et al. 2022), and Aeromonas salmonicida (Sun et al., 2022) in water bodies. In this study, we detected positive results for TurCV in almost all affected turbots, suggesting that the cause may be the less developed immune system of bony fish in comparison to that of poultry and mammals, along with a lack of effective countermeasures. As a result, changes in water temperature, osmotic pressure, salinity, and breeding environment worsened symptoms in turbot infected with TurCV, ultimately leading to widespread mortality.

In summary, this study has identified a novel Circovirus as the etiological agent of this emerging disease, characterized by significant mortality in farmed turbot populations in China. This newly characterized virus has been provisionally designated as turbot circovirus (TurCV), based on a comprehensive analysis that included morphological examination, whole genome sequencing, phylogenetic studies, clinical symptomatology, histopathological assessment, and pathogenicity challenge experiments. The emergence of TurCV poses broad implications for the aquaculture industry, not only in China but also in other regions where turbot farming is practiced. Further research is essential to confirm the host range of TurCV, expand diagnostic screening efforts, and develop effective strategies for its prevention and control.

CRediT authorship contribution statement

Xiao Wu: Writing – original draft, Visualization, Data curation, Conceptualization. Boyin Jiang: Data curation. Yuanxing Zhang: Supervision, Project administration. Qiyao Wang: Validation, Supervision, Funding acquisition, Conceptualization. Yue Ma: Writing – review & editing, Writing – original draft, Validation, Project administration, Investigation, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare no conflict of interest.

Data availability

• Data will be made available on request.