Astragaloside IV relieves passive heymann nephritis and podocyte injury by suppressing the TRAF6/NF-κb axis

Abstract

The pathogenesis of membranous nephropathy (MN) involves podocyte injury that is attributed to inflammatory responses induced by local immune deposits. Astragaloside IV (AS-IV) is known for its robust anti-inflammatory properties. Here, we investigated the effects of AS-IV on passive Heymann nephritis (PHN) rats and TNF-α-induced podocytes to determine the underlying molecular mechanisms of MN. Serum biochemical parameters, 24-h urine protein excretion and renal histopathology were evaluated in PHN and control rats. The expression of tumor necrosis factor receptor associated factor 6 (TRAF6), the phosphorylation of nuclear factor kappa B (p-NF-κB), the expression of associated proinflammatory cytokines (TNF-α, IL-6 and IL-1β) and the ubiquitination of TRAF6 were measured in PHN rats and TNF-α-induced podocytes. We detected a marked increase in mRNA expression of TNF-α, IL-6 and IL-1β and in the protein abundance of p-NF-κB and TRAF6 within the renal tissues of PHN rats and TNF-α-induced podocytes. Conversely, there was a reduction in the K48-linked ubiquitination of TRAF6. Additionally, AS-IV was effective in ameliorating serum creatinine, proteinuria, and renal histopathology in PHN rats. This effect was concomitant with the suppression of NF-κB pathway activation and decreased expression of TNF-α, IL-6, IL-1β and TRAF6. AS-IV decreased TRAF6 levels by promoting K48-linked ubiquitin conjugation to TRAF6, which triggered ubiquitin-mediated degradation. In summary, AS-IV averted renal impairment in PHN rats and TNF-α-induced podocytes, likely by modulating the inflammatory response through the TRAF6/NF-κB axis. Targeting TRAF6 holds therapeutic promise for managing MN.

Introduction

Membranous nephropathy (MN) is the prevailing etiology of nephrotic syndrome in adults. In recent years, the incidence of MN in our nation has increased [1], especially among younger individuals [2]. Heterogeneity characterizes the treatment response and disease outcome in patients with MN. While approximately one-third of patients will experience spontaneous remission, nearly 50% of those who fail to achieve remission will eventually progress to end-stage renal disease (ESRD) [3], which imposes a substantial societal and familial burden.

MN is an autoimmune glomerular disease, and its pathogenesis is primarily attributed to podocyte injury resulting from immune complex deposition on the glomerular basement membrane (GBM) [4]. The deposition of immune complexes and subsequent activation of the complement system can precipitate the increased generation of reactive oxygen species and the activation of nuclear factor kappa B (NF-κB), which lead to inflammatory responses. Recent studies have highlighted that the NF-κB signaling pathway is involved in MN [5–7]. The genomic and transcriptomic involvement of the NF-κB pathway has been demonstrated in MN pathogenesis [8,9]. Patients with MN exhibit increased protein expression of NF-κB p65 [10], and phosphorylation of NF-κB p65 and IκBα was shown to increase in the MN model rats, demonstrating that activated NF-κB is linked with MN [5]. Additionally, the suppression of NF-κB leads to a reduction in proteinuria, amelioration of renal damage and inflammation, and restoration of podocyte injury in experimental MN rat models [7,11]. The tumor necrosis factor receptor-associated factor (TRAF) family, characterized by K63-ubiquitin chain modification, acts as a scaffold for upstream complexes to activate downstream signals such as the NF-κB signaling pathway[12]. TRAF6, a member of this family, plays a role in the pathogenesis of various renal diseases by regulating the activation of NF-κB [13–15]. In adenine-induced mice, elevated renal levels of TRAF6, NF-κB p65 and p-NF-κB p65 were observed [16]., TRAF6 silencing can protect against inflammation in LPS-induced HK-2 cells, while TRAF6 overexpression mitigates the inhibition of p-NF-κB p65 and inflammation [15,17]. These findings underscore the importance of the TRAF6-mediated NF-κB pathway in regulating inflammation in renal disease. Consequently, we hypothesized that TRAF6/NF-κB axis-mediated inflammation was associated with podocyte injury and MN progression.

Current treatments for MN include steroids and immunosuppressive agents, which have side effects [18]. The exploration of alternative adjunctive therapeutic modalities is of great importance. Traditional Chinese medicine (TCM) has substantial therapeutic effects on various chronic diseases, including renal disease. Nevertheless, due to the complex composition of traditional Chinese medicinal agents, the precise mechanisms by which these interventions ameliorate pathological conditions remain to be elucidated. Previous reports have shown that Astragalus membranaceus (Huang-Qi) is commonly used in the treatment of membranous nephropathy, which can reduce proteinuria and promote diuresis and detumorment by regulating immunity, anti-inflammation, antioxidation and other mechanisms, is commonly used to treat MN [19]. Adjunctive use of A. membranaceus combined with supportive care or immunosuppressive therapy has shown to improve the response rate and serum albumin (ALB) concentration and reduce proteinuria and serum creatinine levels compared to immunosuppressive therapy alone in MN patients [20]. In addition, MN patients resistant to cyclosporine and mycophenolate achieved complete remission after taking TCM containing A. membranaceus [21,22]. Astragaloside IV (AS-IV) is a key active constituent of A. membranaceus. Its effects include reducing the serum creatinine concentration, mitigating proteinuria, and attenuating complications such as anemia and malnutrition [23]. Studies have shown that AS-IV possesses anti-inflammatory, antioxidant, antiapoptotic, and immunomodulatory properties. It exerts kidney-protective effects by mitigating podocyte apoptosis, abating oxidative stress, and inhibiting the NF-κB-mediated inflammatory pathway, all of which contribute to renal injury [24]. However, there is currently an absence of direct evidence showing the impact of AS-IV on the function of TRAF6.

In this study, we investigated the influence of AS-IV on TRAF6 using a passive Heymann nephritis (PHN) rat model and explored the underlying molecular mechanisms that drive podocyte inflammatory damage through the TRAF6/NF-κB pathway.

Materials and methods

Materials

AS-IV (A928102, with a purity of ≥ 98%) was purchased from Macklin.

Animal models and treatment

Forty-five male Sprague–Dawley (SD) rats (5 weeks of age, weighing 150 ± 10 g) were purchased from Sibeifu Biotechnology Co., Ltd., Beijing (Licence: SCXK (Beijing) 2019-0010). All rats were raised at a temperature of 20–25 °C, humidity of 30–40% and a 12-h light/12-h dark cycle. The rats were provided unrestricted access to clean food and water for one week prior to the experiments. All experiments were approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine (application no. 202307A045) and adhered to the guidelines stipulated by the National Animal Welfare Law of China. The handling of animals was in accordance with internationally relevant laboratory animal regulations.

We established a PHN model in 36 male SD rats by injecting sheep anti-rat FX1A serum (0.8 mL/100 g body weight, PTX-002S; Probetex, San Antonio, TX), which shares a similar pathogenic mechanism and clinical manifestation of MN in humans [25]. The nine rats in the control group received an equivalent volume of saline via intraperitoneal injection. One week after anti-Fx1 injection, the PHN rats were randomly divided into four groups (n = 9 per group): a model group, a low-dose AS-IV group, a high-dose AS-IV group, and a prednisone group. Rats in the low-dose AS-IV group, high-dose AS-IV group and prednisone group were administered double distilled water (1 mL/100 g/d) containing AS-IV at doses of 20 mg/kg/d, 40 mg/kg/d, or prednisone at a dose of 2 mg/kg/d, respectively. The control group and PHN model group rats received the same volume of double distilled water. All fluids and medications were administered through oral gavage one week after administration of sheep anti-rat Fx1A serum to establish the PHN model.

Following a four-week treatment regimen, blood and 24-h urine samples were collected and centrifuged (3500 rpm, 4 °C). The collected urine samples were used to evaluate the 24-h urine protein excretion (24 h-UPE) levels, while the blood samples were used to measure serum creatine (SCr), blood urea nitrogen (BUN), ALB, IL-6, IL-1β and TNF-α levels. Thereafter, all rats were intraperitoneally administered 1% pentobarbital sodium (50 mg/kg). Kidney tissues from six rats per group were isolated and stored at −80 °C for subsequent enzyme-linked immunosorbent assay (ELISA), RT–qPCR, Western blot and coimmunoprecipitation (co-IP) analyses. The remaining three rats were perfused with saline and fixed with 4% paraformaldehyde for histopathological assessment.

Cell culture

The MPC5 cell line, a conditionally immortalized mouse podocyte line, was obtained from iCell Bioscience, Inc. (iCell-m081) and cultured in RPMI 1640 medium (Solarbio, 10491). The medium was supplemented with 10% fetal bovine serum (FBS, Gibco, 10270-106), 100 U/ml penicillin/streptomycin (Solarbio, P1400) and 10 U/ml recombinant mouse interferon-γ (IFN-γ; Solarbio, P00215). The cells were cultured at 33 °C in a humidified atmosphere containing 5% CO₂ to maintain a proliferative state. After they were transferred to a 37 °C incubator without IFN-γ, the MPC5 cells ceased proliferating, initiated differentiation, and matured into podocytes in 14 days. Following this, further studies were conducted using mature MPC5 cells kept in a 37 °C incubator. MPC5 cells were stimulated for 24 h with TNF-α (40 ng/mL; Sigma, T7539), both with and without AS-IV (at concentrations of 25, 50 and 100 μM).

TRAF6 overexpression

MPC5 cells in the logarithmic growth phase were converted into single-cell suspensions, and the cell density was adjusted to 2 × 10⁵ cells/mL. Subsequently, these cells were seeded in 60 mm dishes at 4 mL/well and cultured in a 37 °C incubator with 5% CO₂ overnight. The TRAF6 overexpression (TRAF6-OE) lentivirus (provided by Shanghai Genechem Co., Ltd.) was transiently transfected (MOI = 30) for 12–24 h (the specific time was determined according to the state of the cells). After that, the transfection reagent was removed, and the regular complete medium was replaced for continued culture. Forty-eight hours after transfection, the cells were digested and replated, ensuring that the cell samples were appropriately prepared for the desired Western blot experiments.

Serum, urine, and kidney biochemical Analysis of PHN rats

Blood and urine samples were centrifuged at 3500 rpm for 10 min at 4 °C, and the supernatants were collected for subsequent measurements. 24 h-UPE was assessed by the biuret method with an automatic biochemical instrument. The BUN, SCr and ALB were detected using commercial kits (BUN: ZC-S0480, SCr: ZC-A1191, and ALB: ZC-36315).

Histopathological Analysis of PHN rats

Kidney samples were removed and fixed in 4% paraformaldehyde, dehydrated in graded alcohol and dimethylbenzene and embedded in paraffin. The paraffin-embedded tissues were sectioned into 4 μm-thick slices for various staining techniques. The renal tissue slices were subjected to hematoxylin-eosin (HE) staining according to the manufacturer’s protocol and scored as previously described to evaluate renal structural injury [26]. Renal tubular atrophy and interstitial fibrosis were evaluated by Masson’s trichrome staining using a Masson staining kit, and semiquantitative analysis was performed according to the percentage of collagen area stained in the visual field [26]. For periodic acid-Schiff (PAS) staining, renal tissue slices were incubated with a periodic acid solution for 5 min and sequentially with Schiff reagent for 30 min at 37 °C in the dark after being washed with ddH₂O and then counterstained with hematoxylin [27]. We used PAS staining to observe the mesangial matrix and basement membrane and evaluate glomerular sclerosis. Periodic acid-silver methenamine (PASM) staining was used to identify the GBM in kidney tissue. Kidney sections were preheated, treated with silver staining fluid and washed with distilled water. Then, the sections were incubated in 2% gold chloride solution, washed, treated in 2% sodium thiosulfate solution, washed, double stained with hematoxylin or eosin, dehydrated in graded ethanol, cleared in xylene, and sealed with neutral gum [28].

Immunofluorescence staining

For tissue immunofluorescence analysis, 4 μm-thick sections of paraffin-embedded kidney tissues were subjected to sequential deparaffinization and rehydration using xylene and an ethanol gradient. Antigen retrieval was conducted using sodium citrate antigen repair solution for 10 min, followed by incubation with 3% hydrogen peroxide for 10 min at room temperature. Subsequently, the sections were blocked with a goat serum blocking solution for 30 min. Afterwards, the sections were incubated overnight at 4 °C with goat anti-rat IgG H&L (Alexa Fluor^® 594) (Abcam, ab150160, 1:1000 dilution) and primary antibodies targeting TRAF6 (Abcam, ab33915, 1:200). The secondary antibodies conjugated to Alexa Fluor-488 (Abcam, ab150077, 1:1000) were added to the sections previously treated with the primary TRAF6 antibodies. After a 1-h incubation at 37 °C, the slides were washed with PBS and sealed with neutral balsam. Images were collected and analyzed using a fluorescence microscope.

For a subset of cultured cells, the MPC5 cells were fixed with 4% paraformaldehyde for 15 min, blotted to dryness, and rinsed three times with 1× PBS for 5 min each. The cells were permeabilized with 0.3% Triton X-100 in PBS for 10–15 min, after which the permeabilization solution was discarded, and the cells were subsequently washed three times with PBS for 5 min each. Blocks were incubated with 5% BSA in PBS for 1 h at room temperature. Next, the cells were incubated with primary antibodies against NF-κB (1:100, Abcam, ab16502) and TRAF6 (1:200, Abcam, ab137452). After washing with 1× PBS, the cells were incubated with secondary antibodies at room temperature in the dark for 1–2 h. Each sample was stained with propidium iodide (PI, Solarbio, C0080) for 10 min while kept in the dark. The slides were sealed with an anti-quench sealant. Fluorescence microscopy was used for observation and analysis.

RT–qPCR

Total RNA was extracted from rat kidney tissues and treated MPC5 cells using a total RNA extraction kit (Solarbio, R1200), and qPCR was conducted with a TaqMan One Step RT–qPCR kit (Solarbio, T2210) according to the manufacturer’s instructions. The following primers were used (5′→3′) for the PHN rats: TNF-α (F): CGTGTTCATCCGTTCTCTACC, TNF-α (R): GCAATCCAGGCCACTACTT, IL-1β (F): TGATGTTCCCATTAGACAGC, IL-1β (R): GAGGTGCTGATGTACCAGTT, IL-6 (F): CCGTTTCTACCTGGAGTTTGT, and IL-6 (R): GTTTGCCGAGTAGACCTCATAG. The following primers were used for the MPC5 cells: TNF-α (F): AGGCACTCCCCCAAAAGATG, TNF-α (R): CCACTTGGTGGTTTGTGAGTG, IL-1β (F): GAAATGCCACCTTTTGACAGTGA, IL-1β (R): GTCCTCATCCTGGAAGGTCC, IL-6 (F): ACGATGATGCACTTGCAGAAA, IL-6 (R): CTGTGACTCCAGCTTATCTCTTG, GAPDH (F): GCCTCCTCCAATTCAACCCT, and GAPDH (R): CTCGTGGTTCACACCCATCA.

Western blot Analysis

The supernatants obtained from renal tissues and MPC5 cells were collected after lysis with prepared RIPA lysis buffer (containing 1% PMSF and 2% phosphatase inhibitors). To determine the protein concentration in the supernatant, a bicinchoninic acid (BCA) protein assay kit (Biyuntian, P0012S) was used according to the manufacturer’s instructions. Equivalent quantities of proteins from each sample were separated by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were incubated with primary antibodies against nephrin (1:1000, Abcam, ab216341), desmin (1:100000, Abcam, ab32362), TRAF6 (1:2000, Abcam, ab137452), NF-κB (1:1000, Abcam, ab16502), phosphorylated NF-κB (p-NF-κB) (1:1000, Abcam, ab76302), K48 (1:1000, Abcam, ab140601), and GAPDH (1:1000, Cell Signaling Technology, 5174) at 4 °C overnight. Following incubation with primary and secondary antibodies and washing, the protein bands were visualized using a Tanon gel imaging system. Further analysis of the grey values associated with the protein bands was conducted using ImageJ software.

ELISA Analysis

The levels of IL-6 and IL-1β in the MPC5 cells were detected by commercial kits, including a mouse IL-6 ELISA kit (IC50325-1, mlbio, Shanghai, China) and a mouse IL-1β ELISA kit (mIC50300-1, mlbio, Shanghai, China), following the manufacturer’s protocol. IL-6 and IL-1β levels are expressed in pg/mL.

Co-IP Analysis

Co-IP cell lysate was added to the tissue fragments or cells for lysis. These lysates were centrifuged at 12000 rpm for 10 min at 4 °C. After centrifugation, the supernatant was used for protein quantification. Lysates were incubated with an anti-TRAF6 antibody (Abcam, ab137452) or an anti-IgG antibody overnight at 4 °C. This mixture was then precipitated with 50% Protien A/G agarose bead solution and lightly shaken overnight at 4 °C. The resulting bound precipitate was separated by centrifugation. The precipitate was denatured with 1× loading buffer for 10 min at 100 °C. Western blots were subsequently performed.

Cycloheximide (CHX) and MG132 assays

MPC5 cells in the logarithmic growth phase were seeded in 60 mm dishes at a density of 2.5 × 10⁶ cells/well and allowed to adhere for 24 h. For the CHX assays, all experimental groups were treated with TNF-α + CHX (10 μg/mL; Sigma, 239765), with or without a high concentration of AS-IV. This treatment was carried out for intervals of 0, 0.5, 1, and 2 h. Then, cells were harvested for Western blot experiments. For the MG132 assays, all experimental groups were treated with TNF-α + MG-132 (5 μM; Sigma, 474791) with or without a high concentration of AS-IV for 24 h. After the designated treatment period, cells were collected for Western blot and co-IP experiments.

Statistical Analysis

The data were processed and analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.). Comparisons between two groups were made using t tests. Multiple comparisons were performed using one-way ANOVA. The homogeneous data were analyzed using the least significant difference (LSD) test, and the heterogeneous data were analyzed with Dunnett’s test. p < 0.05 indicated a significant difference.

Results

Effects of as-IV on kidney injury in PHN rats

To determine the effect of AS-IV on kidney injury, we treated PHN rats with AS-IV. As depicted in Figure 1(A–D), a marked increase in the serum BUN, SCr and 24 h-UPE levels occurred in the PHN rats compared with those in the control group (BUN: PHN vs. control, 56.82 ± 4.98 vs. 13.47 ± 2.51, p < 0.0001; SCr: PHN vs. control, 112.04 ± 7.71 vs. 50.40 ± 5.90, p < 0.0001; 24 h-UPE: PHN vs. control, 25.34 ± 5.04 vs. 4.22 ± 1.55, p < 0.0001). Correspondingly, there was a marked decrease in the serum ALB level (PHN vs. control, 20.30 ± 2.57 vs. 28.80 ± 1.35, p = 0.0034). In contrast, the rats in the low-dose AS-IV and high-dose AS-IV groups all exhibited decreased serum BUN, SCr, 24 h-UPE levels (BUN: PHN vs. low-dose AS-IV, 56.82 ± 4.98 vs. 45.19 ± 5.34, p = 0.0369, PHN vs. high-dose AS-IV, 56.82 ± 4.98 vs. 30.44 ± 4.83, p = 0.0002; SCr: PHN vs. low-dose AS-IV, 112.04 ± 7.71 vs. 88.57 ± 10.54, p = 0.0278, PHN vs. high-dose AS-IV, 112.04 ± 7.71 vs. 73.19 ± 7.28, p = 0.0011; 24 h-UPE: PHN vs. low-dose AS-IV, 25.34 ± 5.04 vs. 17.26 ± 3.75, p = 0.0001, PHN vs. high-dose AS-IV, 25.34 ± 5.04 vs. 13.49 ± 3.24, p < 0.0001), coupled with elevated serum ALB levels (PHN vs. low-dose AS-IV, 20.30 ± 2.57 vs. 23.65 ± 2.59, p = 0.2735, PHN vs. high-dose AS-IV, 20.30 ± 2.57 vs. 25.70 ± 2.48, p = 0.0484). In addition, immunofluorescence staining revealed that the deposition of IgG in the glomerulus was more pronounced in the PHN model group than in the control group and was substantially reduced after AS-IV treatment in a dose-dependent manner (Figure 1(E)). Together, these results confirmed that AS-IV mitigated renal injury and immune disorders in PHN rats.

Figure 1.

Astragaloside IV alleviated renal clinical and pathological injuries in PHN rats. The levels of (A) 24-h urine protein, (B) serum BUN, (C) SCr, and (D) serum ALB among the following groups: saline-treated rats, PHN rats, and PHN rats treated with AS-IV (AS-IV (L): 20 mg/kg/d, as-IV (H): 40 mg/kg/d), and prednisone: 2 mg/kg/d). (E) Immunofluorescence staining of IgG in the glomerulus in the five groups. In A–D, the data are presented as the mean ± standard deviation; **p < 0.01 vs. the saline group; #p < 0.05 vs. the model group; ##p < 0.01 vs. the model group. PHN: passive heymann nephritis; BUN: blood urea nitrogen; SCr: serum creatine; ALB: albumin; AS-IV: astragaloside IV; and PRE: prednisone.

Effects of as-IV on renal pathology in PHN rats

To detect the effect of AS-IV on renal pathology in PHN rats, we assessed glomerular lesions using HE, Masson, PAS and PASM staining. As shown in Figure 2, renal pathology, including inflammatory cell infiltration (Figure 2(A)), renal fibrosis (Figure 2(B)), GBM thickening (Figure 2(C)) and GBM atrophy (Figure 2(D)), was more severe in the PHN model group than in the control group. However, AS-IV treatment significantly alleviated the above changes (Figure 2(A–D)). Notably, AS-IV improved the histopathology of kidney lesions in MN rats.

Figure 2.

AS-IV ameliorates renal pathological injuries in PHN rats. Images of glomerular tissues obtained under a light microscope after (A) HE staining, (B) Masson staining, (C) PASM staining, and (D) PAS staining.

Effects of as-IV on podocytes in PHN rats

To detect the effect of AS-IV on podocytes in PHN rats, we examined the expression of nephrin (the major component of podocytes) and desmin (a cytoskeletal protein in podocytes) in rat kidney tissue and observed the ultrastructure of the podocytes by electron microscopy. Compared with the control group, the fusion of podocyte foot processes was increased and the GBM was thickened in the PHN group. Compared with the PHN group, the AS-IV group exhibited some remission in foot process fusion and GBM thickening (Figure 3A). In addition, the expression of nephrin in the kidney tissue of the PHN group was reduced compared with that in the control group. In contrast, desmin expression was much greater in the PHN group than in the control group. We observed that AS-IV treatment facilitated the restoration of nephrin but decreased desmin expression (Figure 3(B–D)). The above results indicated that AS-IV successfully protected against podocyte injury.

Figure 3.

AS-IV protected against podocyte injury in PHN rats. (A) Images of podocytes obtained using an electron microscope. (B–D) Protein expression levels of related indices in kidney tissues were assessed by Western blot. In C–D, the data are presented as the mean ± standard deviation; **p < 0.01 vs. the saline group; #p < 0.05 vs. the model group; ##p < 0.01 vs. the model group.

Impact of AS-IV on the mRNA levels of inflammatory cytokines in PHN rat kidneys

As illustrated in Figure 4, the mRNA levels of TNF-α, IL-6 and IL-1β in the kidneys of the model group were greater than those in the control group (p < 0.05). In contrast, treatment with a low-dose or a high-dose of AS-IV significantly reduced the mRNA levels of TNF-α, IL-6 and IL-1β (Figure 4). These findings suggested that AS-IV effectively suppressed the expression of inflammatory cytokines in the kidneys of PHN rats.

Figure 4.

Astragaloside IV inhibited the production of inflammatory cytokines in the kidneys of PHN rats. RT–qPCR results showing the mRNA levels of (A) TNF-α, (B) IL-6 and (C) IL-1β in the following groups: saline-treated rats, PHN rats, and PHN rats treated with AS-IV (AS-IV (L): 20 mg/kg/d, as-IV (H): 40 mg/kg/d), and prednisone: 2 mg/kg/d). The data are presented as the mean ± standard deviation; **p < 0.01 vs. the saline group; #p < 0.05 vs. the model group; ##p < 0.01 vs. the model group. PHN: passive heymann nephritis; AS-IV: astragaloside IV.

Effects of AS-IV on TRAF6/NF-κB and TRAF6 ubiquitination in the kidney tissue of PHN rats

To understand the anti-inflammatory effects of AS-IV, immunofluorescence and Western blot were used to evaluate the expression profiles of targets of the TRAF6/NF-κB pathway. In parallel, the polyubiquitination status of TRAF6 was probed using co-IP. In the model group, the levels of TRAF6 and p-NF-κB were increased in the kidney tissues of PHN rats (Figure 5). Intriguingly, a concomitant decrease in K48-ubiquitination of TRAF6 occurred relative to the control group. Overall, AS-IV intervention alleviated the levels of TRAF6 and p-NF-κB and the ubiquitination of TRAF6 in PHN rats.

Figure 5.

Astragaloside IV Inhibited the TRAF6/NF-κB pathway in PHN rats. (A) Immunofluorescence staining showing TRAF6 in renal tissues from saline-treated rats, PHN rats and PHN rats treated with AS-IV (AS-IV (L): 20 mg/kg/d, AS-IV (H): 40 mg/kg/d). (B–E) Western blot results illustrating the expression levels of TRAF6, NF-κB and p-NF-κB in kidney samples from the four rat groups. (F–G) Co-IP results indicating the K48 ubiquitination levels in kidney samples from the four ratgroups. The data are presented as the mean ± standard deviation; **p < 0.01 vs. the saline group; #p < 0.05 vs. the model group; ##p < 0.01 vs. the model group. PHN: passive heymann nephritis; AS-IV: astragaloside IV.

Effects of AS-IV on inflammatory cytokines in MPC5 cells

MPC5 cells were seeded in 96-well plates and 6-well plates. Following pretreatment with different concentrations of AS-IV (low concentration: 25 μM, moderate concentration: 50 μM, high concentration: 100 μM), the cells were subsequently stimulated with TNF-α (40 ng/mL) for 24 h. The results underscore the substantial role of AS-IV in revitalizing cells (Figure 6(A)) while concurrently influencing the concentration-dependent decrease in the mRNA levels of key proinflammatory cytokines, such as TNF-α, IL-6 and IL-1β, elicited by TNF-α stimulation (Figure 6(B–D)).

Figure 6.

Inhibitory effect of astragaloside IV on the production of inflammatory cytokines in TNF-α-treated MPC5 cells. (A) Cell viability and RT–qPCR results of (B) TNF-α, (C) IL-6 and (D) IL-1β in TNF-α (40 ng/mL)-stimulated MPC5 cells treated with AS-IV at different concentrations (25, 50, or 100 µM) for 24 h. The data are presented as the mean ± standard deviation; **p < 0.01 vs. the control group; #p < 0.05 vs. the TNF-α group; ##p < 0.01 vs. the TNF-α group. AS-IV: astragaloside IV.

Effects of AS-IV on TRAF6/NF-κB and TRAF6 ubiquitination in MPC5 cells

We found that in normal MPC5 cells, NF-κB predominantly localized in the cytoplasm. Conversely, in TNF-α-activated MPC5 cells, an increase in nuclear NF-κB expression was detected. Interestingly, AS-IV attenuated the translocation of NF-κB into the nucleus in a concentration-dependent manner (Figure 7(A,B)). Furthermore, TNF-α-activated MPC5 cells also expressed significantly more p-NF-κB, and AS-IV suppressed the production of p-NF-κB (Figure 7(C,D)). In addition, AS-IV significantly downregulated TRAF6 expression (Figure 7(C, E–G)) while concurrently enhancing the K48-linked ubiquitination of TRAF6 in comparison to that in MPC5 cells stimulated with TNF-α alone (Figure 7(H,I)).

Figure 7.

Astragaloside IV egulated NF-κB phosphorylation, TRAF6 protein expression and K48 ubiquitination in TNF-α-stimulated MPC5 cells. (A) PI and immunofluorescence staining of NF-κB and (B) quantification of intranuclear/cytoplasmic NF-κB localization in control, TNF-α-stimulated MPC5 cells and TNF-α-stimulated MPC5 cells treated with different concentrations of as-IV (25, 50, or 100 µM) for 24 h. (C–F) Western blot results illustrating the expression levels of TRAF6, NF-κB and p-NF-κB in the five groups of MPC5 cells. (G) Immunofluorescence staining showing TRAF6 expression patterns in the five groups of MPC5 cells. (H–I) Co-IP results showing K48 ubiquitination in the control, TNF-α-stimulated MPC5 cells and TNF-α-stimulated MPC5 cells treated with AS-IV (100 µM) for 24 h. The data are presented as the mean ± standard deviation; **p < 0.01 vs. the control group; #p < 0.05 vs. the TNF-α group; ##p < 0.01 vs. the TNF-α group. AS-IV: astragaloside IV; PI: propidium iodide.

To elucidate the mechanism by which AS-IV decreased the protein level of TRAF6, we investigated TRAF6 protein stability by evaluating the effects of AS-IV in the presence of CHX. As demonstrated in Figure 8(A,B), AS-IV treatment reduced TRAF6 protein stability. Notably, TRAF6 is degraded through proteasomal pathways that often involve K48-linked ubiquitination [29,30]. Building upon previous findings that indicated that AS-IV induced upregulation of TRAF6 K48 ubiquitination, we incubated MPC5 cells with the proteasome inhibitor MG132 to determine whether AS-IV-mediated TRAF6 degradation was intricately linked to K48 ubiquitination and subsequent proteasome-dependent processes. As shown in Figure 8(C,D), the addition of AS-IV substantially increased the number of K48-linked ubiquitin chains compared with the addition of MG132 alone. This observation indicated that AS-IV promoted TRAF6 degradation by enhancing K48 ubiquitination, thus enhancing the proteasomal pathway involved in TRAF6 turnover.

Figure 8.

Astragaloside IV promoted TRAF6 ubiquitination and degradation. (A–B) Treatment with CHX (10 μg/mL) enhanced the degradation of TRAF6 upon exposure to AS-IV (100 μM). (C–D) following a 24-h incubation with MG132 (5 μM), cell lysates were immunoprecipitated with an anti-TRAF6 antibody, followed by immunoblotting to detect K48-ubiquitin. The accumulation of K48-ubiquitinated TRAF6 induced by MG132 showed that AS-IV treatment promoted K48-ubiquitination of TRAF6. The data are presented as the mean ± standard deviation; **p < 0.01: CHX + AS-IV group vs. CHX group (B); MG132 + AS-IV group vs. MG132 group (D). CHX: cycloheximide; AS-IV: astragaloside IV.

TRAF6-OE impedes the anti-inflammatory potential of AS-IV by activating the NF-kB signalling pathway

First, the efficacy of TRAF6-OE was assessed using qPCR, and a significant increase in TRAF6 mRNA levels occurred (Figure 9(A,B)), suggesting successful transfection of the TRAF6-OE lentivirus. As depicted in Figure 9(C,D), TRAF6-OE led to an increase in p-NF-κB, IL-6 and IL-1β levels. In addition, AS-IV treatment of TRAF6-OE cells failed to attenuate the NF-κB pathway, whereas it effectively reduced p-NF-κB, IL-6 and IL-1β levels in the control group. Taken together, these findings suggested that TRAF6-OE inhibits the anti-inflammatory potential of AS-IV in MPC5 cells by activating the NF-κB signaling pathway.

Figure 9.

TRAF6 overexpression reversed the suppressive effects of Astragaloside IV on NF-κB and downstream inflammatory factors. Western blot results showing (A–B) TRAF6 expression levels in MPC5 cells transfected with control-OE or TRAF6-OE lentivirus or without lentivirus. (C–D) NF-κB and p-NF-κB expression levels in MPC5 cells after treatment with the indicated chemicals and lentivirus. ELISA analysis showing (E) IL-6 and (F) IL-1β levels in MPC5 cells after treatment with the indicated chemicals and lentivirus. The data are presented as the mean ± standard deviation; **p < 0.01: TRAF6-OE group vs. control-OE group (B); TRAF6-OE + AS-IV group vs. AS-IV group (D–F). ##p < 0.01 AS-IV vs. control group (D–F). AS-IV: astragaloside IV; OE: overexpression.

Discussion

Inflammation and the NF-κB pathway have been shown to play an integral role in podocyte injury in the pathogenesis of MN [31,32]. Notably, TCM interventions using animal MN models showed promise in ameliorating this condition by regulating the NF-κB signaling pathway [33]. This led to an exploration of the impact of TCM on renal inflammation and podocyte injury in MN patients. In the present study, we focused on elucidating the protective effects of AS-IV on podocyte injury, with a specific emphasis on the regulation of the TRAF6 and NF-κB signaling pathways in PHN rats and MPC5 cells. In our initial in vivo experiments using PHN rats, we observed that AS-IV administration led to reductions in proteinuria and serum creatinine levels that were coupled with increases in serum ALB in both the low- and high-dose AS-IV groups. Notably, the amelioration of clinical manifestations was dose-dependent. Furthermore, AS-IV administration mitigated pathological manifestations, including the fusion of podocyte foot processes, IgG deposition, GBM thickening and collagen fibrosis in renal tissues. The increase in the mRNA expression of proinflammatory cytokines such as TNF-α, IL-6 and IL-1β in the kidneys of PHN rats was effectively reversed by AS-IV treatment. In vitro experiments involving MPC5 cells further revealed that AS-IV could enhance cell viability while concurrently reducing the mRNA levels of TNF-α, IL-6 and IL-1β in response to TNF-α stimulation. Based on these results, we determined the key molecules and pathways by which AS-IV acted on MN. Our investigation revealed upregulated expression of TRAF6 and p-NF-κB, accompanied by increased translocation of NF-κB into the nucleus and decreased K48-mediated ubiquitination of TRAF6 in both the kidney tissues of PHN rats and TNF-α-activated MPC5 cells. Remarkably, AS-IV treatment counteracted these effects, leading to an attenuation of the observed changes. Furthermore, insights gained from experiments involving MG132 and CHX treatments suggested that the degradation of TRAF6 was predominantly governed by K48 ubiquitination and the proteasome-associated pathway. Finally, we discovered that TRAF6 overexpression inhibited the anti-inflammatory potential of AS-IV by activating the NF-κB pathway. These novel findings illuminate the therapeutic potential of AS-IV in ameliorating renal dysfunction and podocyte injury in MN patients. These effects are closely intertwined with the capacity of AS-IV to modulate inflammation mediated by TRAF6 ubiquitination and the NF-κB signaling pathway.

The traditional Chinese herb A. membranaceus is a widely recognized for its therapeutic effects and low toxicity and is commonly used for treating infections, inflammation and cancer [34]. Among its major bioactive ingredients, AS-IV possesses antioxidant, anti-inflammatory, antiapoptotic and immune-promoting properties that safeguard multiple organs, such as the heart, lung, kidney and brain [24]. Previous studies revealed that AS-IV has a wide range of renoprotective effects. For example, AS-IV can ameliorate renal tubular epithelial–mesenchymal transition (EMT) induced by high glucose through the CX3CL1-RAF/MEK/ERK signaling pathway[35]. In addition, during the early stage of renal ischaemia–reperfusion injury (IRI), AS-IV can reduce proinflammatory responses and macrophage infiltration by inhibiting the NF-κB (p65)/Hif-1α pathway and enhancing Smad7 expression [36]. The protective effects of AS-IV on podocytes have also been documented, with studies indicating its ability to inhibit podocyte apoptosis by attenuating oxidative stress via PPARγ-Klotho-FoxO1 axis activation in diabetic nephropathy [37]. Moreover, AS-IV can alleviate cytoskeletal injury through the Wnt/PCP pathway in puromycin aminonucleoside-stimulated podocytes [38]. In this study, we found that AS-IV increased the K48-linked ubiquitination of TRAF6, consequently suppressing the overexpression of p-NF-κB, a proinflammatory cytokine, and the translocation of NF-κB into the nucleus in both PHN rats and TNF-α-stimulated MPC5 cells. Consistent findings from in vivo and in vitro studies indicate that the protective effect of AS-IV on MN is due to its anti-inflammatory effects on podocytes.

Podocytes play a pivotal role in maintaining the integrity of the glomerular filtration barrier and regulating renal permeability to diverse molecules, making them primary targets for immune deposits that accumulate beneath the glomerular capillary wall and lead to the subsequent formation of the membrane attack complex (MAC) in MN [39]. Podocyte injuries caused by the MAC include protein kinases, reactive oxygen species, transcription factors, growth factors, proteinases, and stress pathways [40]. Among these factors, an accumulating body of evidence underscores the significance of the NF-κB signaling pathway in immune modulation and in the pathogenesis of MN [5–9]. In this study, we established a PHN rat model and utilized TNF-α-stimulated MPC5 cells to simulate MN-related renal lesions and podocyte injury. Consistent with previous observations, we detected increased p-NF-κB levels in the kidney tissues of PHN rats and TNF-α-stimulated MPC5 cells and increased NF-κB nuclear expression in TNF-α-activated MPC5 cells. A prior study showed that AS-IV reinstated podocyte morphology and cytoskeleton structure in MAC-stimulated podocytes [41]. In addition, AS-IV decreased NF-κB activity; suppressed TNF-α, MCP-1 and ICAM-1 expression in kidney tissue to protect against renal damage in streptozotocin-induced diabetic rats [42]; and inhibited podocyte EMT via the SIRT1-NF-κB pathway in glucose-stimulated podocytes [43]. This study revealed that AS-IV downregulated p-NF-κB, TNF-α, IL-6 and IL-1β expression in the kidneys of PHN rats and in TNF-α-stimulated podocytes. These findings demonstrate that the NF-κB pathway and related proinflammatory cytokines are involved in the pathogenesis of MN and that AS-IV has potential for kidney protection through the NF-κB pathway.

Recent studies have shed light on the role of TRAF6 polyubiquitination in the regulation of NF-κB signaling pathway activation. TRAF6 functions as an unconventional E3 ubiquitin ligase, with its K63-ubiquitin chain being capable of self-modification and consequent activation of NF-κB, thereby participating in the inflammatory process [44,45]. Conversely, the K48-ubiquitin chain tags substrates for proteasomal degradation [46,47]. The TRAF6-mediated suppression of ubiquitination impedes NF-κB signaling in podocytes, epithelial cells and vascular endothelial cells in the kidneys of IRI rats [44]. Studies have shown that TRAF6 is involved in various kidney diseases. Increased TRAF6 expression has been detected in renal tissues of MRL/Ipr mice (lupus nephritis model) [48], acute kidney IRI model mice [49] and LPS-induced podocytes [50]. However, changes in TRAF6 expression and function in MN have not been studied. We speculated that TRAF6 might also be involved in the pathogenesis of MN by regulating the NF-kB pathway. Our findings revealed elevated TRAF6 expression and reduced K48-mediated TRAF6 ubiquitination in the kidney tissues of PHN rats and TNF-α-stimulated MPC5 cells. Li et al. discovered that AS-IV treatment can reduce the expression of TRAF6 and subsequently inhibit NF-κB phosphorylation [51]. Our results are consistent with those of Li et al.; we observed that AS-IV reversed TRAF6 and p-NF-κB expression and promoted TRAF6 ubiquitination in PHN rats and TNF-α-induced MPC5 cells. Our results support the potential for AS-IV to regulate NF-κB through the modulation of TRAF6 expression and ubiquitination, indicating that AS-IV is a promising clinical target for treating MN patients. However, there are some limitations to our study. First, our investigations were limited to murine models and cultured cells, warranting further validation in MN patients to verify the clinical effect. Second, the impact of AS-IV on normal rats has not been explored and requires future examination.

Conclusions

Our results demonstrate a pivotal role of TRAF6 in governing NF-κB-mediated kidney injury in MN and the potential for AS-IV to mitigate pathogenesis through the TRAF6/NF-κB pathway. These findings provide a foundation for future therapeutic strategies for managing MN.

Funding Statement

This study was supported by Natural Science Foundation of Nanjing University of Chinese Medicine (No.XZR2020065), Science and Technology Program of Suzhou (SKJYD2021021) and Natural Science Research of Jiangsu Higher Education Institutions of China (No. 21KJB360004).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions

All authors contributed to the study conception and design. The study was designed by Guoyuan Lu and Manman Shi. Material preparation and data collection were performed by Yuhua Ma, Yuwen Hu, Yilin Ruan and Xiaocheng Jiang. The data were analyzed by Min Zhao, Yuxin Wang and Yanrong Ke. The first draft of the manuscript was written by Yuhua Ma, Yuwen Hu and Xiaocheng Jiang. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.