Bruton’s tyrosine kinase inhibition ameliorated neuroinflammation during chronic white matter ischemia

Abstract

Chronic cerebral hypoperfusion (CCH), a disease afflicting numerous individuals worldwide, is a primary cause of cognitive deficits, the pathogenesis of which remains poorly understood. Bruton’s tyrosine kinase inhibition (BTKi) is considered a promising strategy to regulate inflammatory responses within the brain, a crucial process that is assumed to drive ischemic demyelination progression. However, the potential role of BTKi in CCH has not been investigated so far. In the present study, we elucidated potential therapeutic roles of BTK in both in vitro hypoxia and in vivo ischemic demyelination model. We found that cerebral hypoperfusion induced white matter injury, cognitive impairments, microglial BTK activation, along with a series of microglia responses associated with inflammation, oxidative stress, mitochondrial dysfunction, and ferroptosis. Tolebrutinib treatment suppressed both the activation of microglia and microglial BTK expression. Meanwhile, microglia-related inflammation and ferroptosis processes were attenuated evidently, contributing to lower levels of disease severity. Taken together, BTKi ameliorated white matter injury and cognitive impairments induced by CCH, possibly via skewing microglia polarization towards anti-inflammatory and homeostatic phenotypes, as well as decreasing microglial oxidative stress damage and ferroptosis, which exhibits promising therapeutic potential in chronic cerebral hypoperfusion-induced demyelination.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12974-024-03187-4.

Introduction

The cerebral white matter is prone to ischemic injury when cerebral blood flow sustains inadequate perfusion, particularly due to lower blood supply from distal parts of long deep white matter arteries [1, 2]. Accumulating evidence suggests that chronic cerebral hypoperfusion (CCH) serves as a primary driver of vascular pathology and clinical manifestations of vascular cognitive impairment (VCI) [3, 4]. As the second most common type of dementia worldwide, VCI delivers a great burden to society for its high mortality and disability rate [5, 6]. Accordingly, attempts to investigate the pathological mechanisms and seek new therapeutic targets of CCH are of critical importance for both preventing the occurrence and mitigating the development of VCI.

A cascade of molecular and cellular events such as ionic imbalance, oxidative stress, mitochondrial dysfunction, and inflammation, are involved in the pathogenesis of CCH [7–9]. These cascades subsequently trigger blood-brain barrier (BBB) breakdown, endothelial dysfunction, and glial activation, creating an ongoing inflammatory microenvironment [10–12]. In general, as the major resident immune cells in the central nervous system (CNS), microglia are documented to play an essential role in both the acute and chronic phase of neuroinflammation [13]. Activated microglia are responsible for combating harmful external stimuli, which contribute to homeostasis in the CNS microenvironment. However, dysfunctional and sustained microglial activation often leads to chronic inflammation in the CNS, accompanied by release of a large amount of pro-inflammatory cytokines and chemokines, leading to cell death and myelin injury, which eventually exacerbates ischemic demyelination [14, 15]. Thus, interventions that suppress chronic inflammation mediated by microglia dysfunctions may be appropriate strategies against CCH.

Bruton’s tyrosine kinase (BTK), a member of the cytoplasmic non-receptor tyrosine kinase Btk/Tec family, is involved in the activation and function of B cells and myeloid cells, and is currently regarded as a drug target to lighten both dysregulated innate and adaptive immunity [16]. BTK inhibitors (BTKi), which could penetrate the blood-brain barrier (BBB), may act on brain-infiltrated B cells or brain resident microglia to affect inflammation and neurodegeneration within the CNS, respectively. However, little is known about the effects of BTKi on microglia status and functions in CCH, and the related mechanisms remain to be further elucidated.

Tolebrutinib is an irreversible, selective, effective, and orally active small-molecule inhibitor of BTK, which can breach the BBB [17]. In this study, utilizing a model of bilateral carotid artery stenosis (BCAS), we explored the potential regulative role of tolebrutinib in microglia inflammation, oxidative stress, and ferroptosis. We found that BTK was remarkably activated, which was responsible for microglia activation and a series of subsequent inflammatory reactions following hypoxic-ischemic injury. The treatment of tolebrutinib restored myelination and ameliorated cognitive impairment in chronic cerebral ischemia, indicating a new therapeutic strategy.

Experimental animals and subject details

Animals and study designs

Wild-type (WT) C57BL/6J mice (20–25 g, 8–12 weeks) were purchased from Vital River Laboratory Animal Technology Co. Ltd., Beijing, China. Male and female animals were assigned into different groups randomly and housed in a specific pathogen-free (SPF) environment, at generally 25 °C and 55–60% relative humidity with a 12-hour cycle of light alternating with darkness, fed with free access to food and water. Emphatically, all experiments involving animals were consented by the Animal Care Committee of Tongji Medical College, Huazhong University of Science. Technology, China.

A total of 57 mice were consumed in our study. Animals were randomized using random numbers generated by GraphPad Prism. In principle, the sample size for each experimental group was used according to existed studies [18]. Meanwhile, the sample size estimation for comparison of means of multiple samples in completely randomized designs with a statistical power of 0.8 and statistical significance of 0.05 was performed via PASS software, which the mean and standard deviation were referred to previous literature on BCAS models [2]. Consequently, for most animal experiments, n = 6 per group was sufficient. For several experiments such as the eight-arm maze experiment and the new object recognition experiment, n = 9 mice per group was otherwise used to maximally meet statistical requirements. All analyses were executed by experienced and blinded researchers who abide by the guidelines of ARRIVE completely.

Bilateral carotid artery stenosis (BCAS) surgery

The BCAS model was established comply with previous methods [19]. Briefly, mice were anesthetized with 5% isoflurane and kept with 2% isoflurane in oxygen supplied from RWD inhalation anesthesia machine. Then, the middle cervical line was made to separate bilateral common carotid arteries (CCAs) carefully. One side CCA was twined around a delicate miniature spring with an internal diameter of 0.18 mm (Sawane Spring Co, Shizuoka, Japan) gently, and the same procedure was repeated on the other side. The sham-operated group received a middle cervical line incision only without twisting coils around common CCAs. All animals were housed in an SPF environment and provided with abundant food and water after operations.

Brain simple preparation

At 3, 30, and 90 days after BCAS surgery, mice were anesthetized with 5% isoflurane, then phosphate buffer (PBS) (0.1%, 30mL, 4 °C) were transcardially perfused, followed by PFA (4%, 30mL, 4 °C). Dissecting brain tissues, soaking in cold 4% PFA all night and dehydrating in 30% sucrose for 3 days. The dehydrated brain tissues were embedded in Tissue-Tek O.C.T compound (Sakura Finetek, USA) to freeze, sliced into 20 μm-thick serial sections and stored at -80 °C subsequently.

Luxol fast blue staining

White matter Luxol fast blue staining (LFB) staining was carried out as previously described to evaluate the degree of myelin damage [20, 21]. The 20 μm frozen slices were incubated with 0.1% LFB dye (G1030, Servicebio) at 60 °C for 8 h, then differentiated in 0.05% lithium carbonate solution and 70% ethanol by turn, dehydrated with gradient ethanol (70%, 95%, 100%) eventually. The staining position of brain sections were same in each group and the site was 1.0 mm lateral, 0.8 mm anterior, and 2.2 mm deep to the bregma [22]. The demyelinated corpus callosum images were captured by a microscope (BX51, Olympus, Japan) and sorted into 0–3 grades: normal (grade 0), disarranged myelin fiber (grade 1), marked vacuoles (grade 2), and disappearance of nerve fibers (grade 3) [23, 24].

Flow cytometry

Mice were anesthetized with 5% isoflurane and transcardially perfused with pr-cold PBS, then taken out brain samples. The brain dissociation kit (Miltenyi Biotec, Germany) was utilized to make single cell suspensions. Briefly, the cerebral hemisphere was cut into pieces and incubated with enzyme A and enzyme P and digested for 30 min at 37 °C. The 10 ml PBS was added to the above mixed suspension. The enzyme mixture was filtered with a 70 mm cell strainer into a 15 ml centrifuge tube and centrifuged at 300xg, 4 C for 5 min. Subsequently, myelin debris was removed by debris removal solution. Afterward, cell pellets were re-suspended by 100uL PBS containing 2% FBS (FACS), then added 1ul Fvs-700 (1:100000, 546996, BD Biosciences) and incubated for 10 min at 4 °C. The suspensions were further washed by PBS and re-suspended with 100ul FACS again. 2ul Fc block (1:50, 553142, BD Biosciences) was added to cell pellets, and incubated for 10 min at 4 °C. Then, 1ul each of CD45-PERCP-Cy5.5 (1:100, 103131, Biolegend), CD11b-FITC (1:100,101206, Biolegend), CD4-APC (1:100, 553051, BD Biosciences), Ly6G-PE (1:100, 551461, BD Biosciences), CD3-PE-Cy7(1:100, 552774, BD Biosciences), CD19-BV650(1:100, 563148, BD Biosciences) and CD8-BV510 (1:100, 563068, BD Biosciences) were added to the suspension and incubated for 30 min at 4 °C. The mixture was washed with PBS twice. Finally, the live cells were performed through a flow cytometer (CytoFLEX, Beckman) and analyzed by Flowjo.

Tolebrutinib administration

Tolebrutinb was orally administered to wild-type mice with a gastric needle at the dosage of 5 mg/kg per day for 30 consecutive days after BCAS surgery two hours. The vehicle group was treated with 200ul excipient containing 10% DMSO per day for 30 consecutive days after BCAS surgery two hours, which was a therapeutic strategy for ischemic white matter injury. The sham group also received oral vehicle. The method and dosage of administration followed the manufacturer’s instructions for tolebrutinb (SAR442168, MCE).

Immunofluorescence staining

For immunofluorescent staining, the brain slices were washed with 0.1% PBS thrice. Immediately, these sections were permeabilized with 0.25% Triton-X100 for 10 min at room temperature, followed by blocking with QuickBlock for 15 min. After that, brain sections were incubated with primary antibodies at 4 °C overnight and subsequently incubated with secondary antibodies at room temperature for 1 h under darkness. At last, the slices were stained with a 4,6-diamidino-2-phenylindole (DAPI) medium. Primary antibodies including MBP (1:200, ab7349, abcam), Iba1(1:300,17198, CST), MAP2(1:200,ab254143, Abcam), GFAP (1:500, ab4648, Abcam), OLIG2(1:200, 13999-1-AP, Proteintech), 4HNE (1:100,bs-6313R, Bioss), 8-OHDG (1:100,bs-1278R, Bioss), BTK (1:200, 8647, CST), pBTK (1:200, NBP178295, NOVUS), CD16/32(1:50, 553142, BD Biosciences), CD68 (1:200, MCA1957, Bio-rad), Clec7a (1:50, mabg-mdect-2, InvivoGen). Secondary antibodies including Secondary antibodies include AlexaFluor488 Donkey anti Goat-IgG (Yeasen), AlexaFluor488 Donkey anti Rat-IgG (Yeasen) and Cy3 Donkey anti Rabbit IgG (Jackson).

Images were captured by confocal microscope (FV1200, OLYMPUS,) and uploaded to Image J for analysis. The microglial morphology analysis and the skeletonized images were performed as previous study [25].

Behavioral tests

The working and reference memory in mice were accessed with the eight-arm maze experiment as previous described [18]. Mice to be trained were deprived of food and water for eight hours. For spatial working memory test, mice were placed in the central starting platform and allowed to consume food pellets that placed in the distal end of eight arms for 15 min or until food in each arm were disappeared. The working memory error was recorded when a mouse reentered an arm. All animals completed a trial per day, lasting for 7 days. In reference memory task, only four of the eight arms had food pellets and the trial ceased immediately after pellets in four food wells were consumed. All animals completed three trials per day, lasting for 3 days.

The new object recognition experiment (NOR) was performed to evaluate novelty preference. Briefly, mice were habituated in a square box and familiar with two square objects the day before the test. After 24 h, the exploring functions were evaluated by replacing one of the familiar square objects with a novel rounded object. All exploring time were 5 min [26, 27].

Primary microglia culture

As previous methods, primary brain microglia were separated from 0 to 3 days neonate WT mice [18]. Basically, the P1-2 postnatal mouse pup skull was stripped and the brain was removed. Then, the brain was cut into pieces and digested with 0.125% trypsin for 15 min at 37 °C. The mixed glial cells were cultured with DMEM/F12 medium containing 10%FBS for 3 days at 37 °C with 5% CO2 and 95%O2. For remaining 9 days, the cell mixture was cultured in high glucose DMEM containing 10% FBS and the medium was renewed every three days. Finally, the microglia were separated from by shuddering at 200 rpm at 37 ◦C for 1 h [28, 29].

Cell treatment

For tolebrutinib treatment group, the dense microglia adhered to the 6-well plates for 24 h. Then, the primary microglia that previous cell culture medium was replaced with low glucose DMEM containing 1 μm Tolebrutinb was placed in an incubator for 4 h at 37 °C with 5% CO₂ and 1% O₂ concentration for oxygen-glucose deprivation (OGD) without reoxygenation. As for vehicle group, the primary microglia were performed with OGD with low glucose DMEM containing 0.1% DMSO.

Cell staining

For cell staining, the treated microglia were added fluorochromes including Bodipy C11(1:2000,D3861, Invitrogen), Mitosox (1:10000, 40742ES50, Yeasen), Mitotracker (1:2000,40742ES50, Yeasen), JC-1(1:500,40705ES03, Yeasen), FerroOrange (1:1000, F374, Dojindo) and ROS (1:2000,HY-D0940) severally and incubated at 37 °C for 30 min before the study time point. The washed cell slice was observed under a confocal microscope. Moreover, the flow cytometer was used to analyze the stained microglia suspensions.

RNA extraction and real-time PCR

Total RNA from primary microglia cultures were extracted by Trizol (9109, Takara). The cDNA was reversely transcribed from isolated RNA via PrimeScript™ RT Master Mix (RR036A, Takara) following manufacturer’s protocol. Subsequently, the mixed reaction system for quantitative RT-PCR was performed using Hieff qPCR SYBR Green Master Mix (11201ES03, Yeasen). The RT-PCR related primers were listed in Table 1. The expression levels of the relevant genes were referred to 𝛽-actin and calculated utilizing 2ΔΔ^CT method.

Table 1.

Related primers of target genes in quantitative RT PCR

Gene	Forward-Primer	Reverse Primer	AmpliconSize(bp)
β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT	154
Nos2	GTTCTCAGCCCAACAATACAAGA	GTGGACGGGTCGATGTCAC	127
Tnf-α	CCCTCACACTCAGATCATCTTCT	GCTACGACGTGGGCTACAG	61
Il6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC	76
Il1b	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT	89
Cd86	TGTTTCCGTGGAGACGCAAG	TTGAGCCTTTGTAAATGGGCA	70
Nlrp3	ATTACCCGCCCGAGAAAGG	TCGCAGCAAAGATCCACACAG	141
Tgfb	CTCCCGTGGCTTCTAGTGC	GCCTTAGTTTGGACAGGATCTG	133
Il10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG	105
Arg1	CTCCAAGCCAAAGTCCTTAGAG	AGGAGCTGTCATTAGGGACATC	185
Spp1	AGCAAGAAACTCTTCCAAGCAA	GTGAGATTCGTCAGATTCATCCG	134
Il4	GGTCTCAACCCCCAGCTAGT	GCCGATGATCTCTCTCAAGTGAT	102
Cd68	TGTCTGATCTTGCTAGGACCG	GAGAGTAACGGCCTTTTTGTGA	75
Lgals3	AGACAGCTTTTCGCTTAACGA	GGGTAGGCACTAGGAGGAGC	210
Clec7a	GACTTCAGCACTCAAGACATCC	TTGTGTCGCCAAAATGCTAGG	164
Acsl4	CTCACCATTATATTGCTGCCTGT	TCTCTTTGCCATAGCGTTTTTCT	114
Ncoa4	GAACCATCAGGACACATGGAAA	AGGAGCCATAGCCTTGGGT	265
Ptgs2	TTCAACACACTCTATCACTGGC	AGAAGCGTTTGCGGTACTCAT	271
Fth1	CAAGTGCGCCAGAACTACCA	GCCACATCATCTCGGTCAAAA	122
Alox12	TCCCTCAACCTAGTGCGTTTG	GTTGCAGCTCCAGTTTCGC	64
Gpx4	GATGGAGCCCATTCCTGAACC	CCCTGTACTTATCCAGGCAGA	185
Fsp1	TCCACAAATACTCAGGCAAAGAG	GCAGCTCCCTGGTCAGTAG	81
Hspb1	ATCCCCTGAGGGCACACTTA	GGAATGGTGATCTCCGCTGAC	75

Table 1Related primers of target genes in quantitative RT PCR. All base sequences can be acquired from on Genbank: (http://www.ncbi.nlm.nih.gov/GenBank/index.html) and PrimerBank (https://pga.mgh.harvard.edu/primerbank/).

Western blot

Samples from harvested primary microglia were digested with RIPA lysis buffer (P0013K, Beyotime) supplemented with phosphatase inhibitors (HYK0031, MCE). Briefly, the concentration of extracted protein was quantified using BCA Protein Assay Kit (Promoter), then transferred to Nitrocellulose (NC, Satrorius) membranes and blocked with 5% BSA for 1 h, followed by incubated with primary antibodies including BTK (1:1000, 8647, CST) and pBTK (1:1000, NBP178295, NOVUS) overnight at 4 °C. After incubation with anti-rabbit (H + L) secondary antibody (GB23303, Servicebio), the special protein signals were captured by GelView 6000 Pro (BLT PHOTON TECHNOLOGY).

Cell viability

The cell viability was conducted using Cell Counting Kit-8 (HY-K0301, MCE) and Cytotoxicity LDH Assay Kit (CK12, Dojindo) according to manufacturer’s instructions. Briefly, for CCK8, the suspended microglia were planted in 96-well plates with a density of 10,000/well and added 10ul CCK8 solutions to incubate for 1–4 h at 37 °C. The absorbance of the mixed solution at 450 nm was measured by an enzyme-labeled instrument (Thermo Scientific). For LDH release test, the 96-well plates were incorporated in 100ul working solution and incubated under darkness at room temperature for 30 min. Finally, the above mixtures were added 50ul stop solution and detected at 490 nm immediately.

Statistics analysis

All data were analyzed by GraphPad Prism software version 9. Comparisons were analyzed using Unpaired two-sided t’s t-test, One-way ANOVA followed by Tukey post hoc test and Two-way ANOVA followed by Tukey post hoc test. The results were statistically significant when p < 0.05.

Results

Chronic hypoperfusion induced white matter injury, microglia, and BTK activation

The corpus callosum (CC) containing myelinated axons is susceptible to demyelination after hypoperfusion [30]. Accordingly, we analyzed the time-course changes in myelin damage in the corpus callosum (CC) at 3, 30, and 90 days after BCAS surgery. After 1 m (1 month) post BCAS, luxol fast blue (LFB) staining revealed a significant myelin loss compared with sham, 3and 90 days groups, in which the white matter damage score ascended to nearly 2.5 points (Fig. 1A-B). Additionally, the relative intensity of myelin basic protein (MBP) decreased since BCAS 3d and came to the lowest level at 1 m (Fig. 1A-B). The results of LFB and MBP staining both confirmed white matter damage reached its peak at 1 m after BCAS.

Fig. 1.

Ischemic demyelination and activation of BTK in microglia induced by BCAS. Ischemic demyelination and activation of BTK in microglia induced by BCAS. (A) The degree of white matter damage and the relative intensity of MBP in the CC at different time points after BCAS. Scale bar = 200 μm. (B) Summarized data display the severity of CC myelin damage. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group (biological replicates). (C) Proportions of various immune cells in BCAS 1 m brains. (D) Representative images of microglia immunofluorescence, skeletonized microglia, and the expression of BTK and p-BTK in microglia at several time points post BCAS. Scale bar = 10 μm. (E) Quantification analysis of the number, soma area, solidity, round of microglia and the percentage of BTK⁺microglia and p-BTK⁺microglia. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group (biological replicates)

To figure out the alterations in the proportions of various immune cells in the brain, we investigated the immune cell type composition using flow cytometry in BCAS 1 m brains. CD3⁺T, CD4⁺T, B, Nature killer cells (NK), NKT, and neutrophils were rarely found in the white matter of BCAS brains, while microglia take up high proportion in the live cells (Fig. 1C). Apparently, microglia occupied a dominant position in the immune cells of the BCAS brains.

We then performed various approaches based on immunofluorescence to characterize microglia activities at different time points after BCAS (3d, 1 m,3 m). The number of microglia gradually rise from 3d to 1 m post BCAS (Fig. 1D-E). Consistently, although no significant changes in microglia branches, branch length, and end-point voxels were found (Figure S1A), soma area, roundness, and solidity of microglia were also increased, suggesting microglia activation during hypoperfusion (Fig. 1D-E). We then probed the expression of BTK and phosphorylated BTK (pBTK) post BCAS, which was reported to be involved in microglia activation [16, 17]. The ratio of BTK⁺Iba1⁺ and pBTK⁺Iba1⁺ cells increased gradually at 3 days, peaked at 30 days, and remained relatively high up to 90 days after BCAS (Fig. 1D-E). Furthermore, we found BTK or pBTK were rarely presented in neurons, oligodendrocytes or astrocytes (Figure S1B). These results illustrated that BTK is activated significantly in microglia, along with relatively high level of microglial activation at BCAS 1 m.

Tolebrutinib suppressed the activation of BTK and microglia and reduced oxidative stress and neuroinflammation

Given its promising prospect as a drug target, realizing the potential role of BTKi in microglia functions holds great interest [31]. Then, we asked about the impacts of tolebrutinib treatment on microglia changes in ischemic demyelination. The wild BCAS mice were intragastrically administrated 5 mg/kg tolebrutinib per day for 1 m (Fig. 2A). We found the percentage of BTK⁺Iba1⁺ and pBTK⁺Iba1⁺ cells were decreased obviously following tolebrutinb treatment, proving that tolebrutinb can penetrate the BBB to exert effects (Fig. 2B-C). Besides, microglia activation was inhibited in tolebrutinb treatment group, characterized by reduced microglia cell density, smaller soma area, and decreased solidity and roundness (Fig. 2B-C).

Fig. 2.

Tolebrutinib therapy attenuated the myelin damage via reducing neuroinflammation. Tolebrutinib therapy attenuated the myelin damage and cognitive deficits via reducing neuroinflammation. (A) Experimental flow chart. (B) The representative images of microglia immunofluorescence, skeletonized microglia, and the expression of BTK and p-BTK in microglia of Sham, BCAS + Vehicle and BCAS + Tolebrutinb mice. Scale bar = 10 μm. (C) Quantifications of microglial density, soma area, solidity, round, and the percentage of BTK⁺microglia and p-BTK⁺microglia. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group (biological replicates). (D-E) The representative immunofluorescent images and quantitative analysis of microglia and pro-inflammatory marker or phagocytosis related markers co-localization in the CC. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group (biological replicates). Scale bar = 10 μm. (F-G-H) Representative LFB and MBP staining and quantifications of Sham, Vehicle and Tolebrutinb group. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group (biological replicates). Scale bar = 200 μm

The oxidative stress damage occurred in BCAS with increased intensity of 4HNE and 8-OHDG in Iba1⁺ cells. After tolebrutinb treatment, the oxidative stress injury was significantly mitigated (Figure S1C). Furthermore, we examined the microglia-mediated inflammatory response by coimmunostaining pro-inflammatory marker Fc RII/III receptor (CD16/32), phagocytosis related makers CD68 antigen (CD68) and C-type lectin domain family 7 (Clec7a) with Iba-1 (biomarkers of microglia). Compared with BCAS vehicle group, the proportion of CD16/32 was markedly decreased in tolebrutinb treatment group (Fig. 2D-E). Additionally, CD68 and Clec7a positive microglia also exhibit significantly lower proportions after tolebrutinb treatment (Fig. 2D-E). Taken together, the interference of tolebrutinib effectively inhibited the activation of BTK in microglia and mitigated neuroinflammation mediated by microglia during cerebral hypoperfusion.

Myelin injury and cognitive deficits were attenuated after tolebrutinib treatment

Neuroinflammation induced by CCH is also a crucial mechanism of myelin injury and cognitive impairments. To further validate whether tolebrutinib was associated with white matter integrity and cognitive function post BCAS, LFB and MBP staining were firstly used to evaluate degree of myelin injury. We observed that tolebrutinb taken group exhibited improved white matter integrity compared with vehicle treatment group (Fig. 2F-H). Then, eight-arm maze experiment and new object recognition experiment were carried out to assess cognitive functions of mice. For revisiting errors, the total number of times was calculated for the mice entered different arms until food pellets were consumed in eight arms. The different arms that mice entered in the first eight entries were also counted. Furthermore, for reference memory errors, the total number of times was calculated for the mice entered different arms until food pellets were consumed in four of eight arms. Mice treated with tolebrutinib showed decreased revisiting errors and more different arm choice in the first eight entries, which indicating an improved working memory (Fig. 3A). Moreover, the mice exhibited increased interest of exploring new objects after tolebrutinib treatment (Fig. 3B-C). Conclusively, tolebrutinib can ameliorate ischemic myelin damage and cognitive impairments distinctly after BCAS.

Fig. 3.

Tolebrutinib treatment improved cognitive deficits resulted from cerebral hypoperfusion. (A) The cognitive function was evaluated using the eight-arm maze test. Two-way ANOVA followed by Tukey post hoc test, n = 9 per group. (B) The representative images and quantification of the interest of exploring new object. (C) The quantitative analysis of frequency of mice exploring new objects. One-way ANOVA and Tukey post hoc test, n = 6 mice/ group

Inhibition of BTK activation alleviated microglial inflammation in vitro

To fully elucidate the role of tolebrutinib in microglia, we utilized oxygen-glucose deprivation (OGD, 4 h) to induce hypoxia in vitro (Fig. 4A). The viability of microglia remains unaffected until the concentration of tolebrutinib exceeds 25 μm (Fig. 4B). To address the effects of tolebrutinib on microglia in vitro, we conducted western blotting and demonstrated the BTK phosphorylation on Tyr223 in microglia is inhibited following treatment with 1 μm of tolebrutinb (Fig. 4C-D, S2).

Fig. 4.

Tolebrutinib treatment alleviates inflammatory response and ferroptosis in microglia. Tolebrutinib treatment alleviates inflammatory response and ferroptosis in microglia. (A) Experimental flow chart. (B) Primary microglia were treated with tolebrutiinb at different concentrations for 4 h, and CCK8 were performed. One-way ANOVA and Tukey post hoc test. n = 6 per group. (C-D) Representative image and quantification of pBTK protein levels in primary microglia. One-way ANOVA and Tukey post hoc test, n = 6 per group. (E) Normalized mRNA levels of genes related to inflammatory response, phagocytosis and ferroptosis were measured. One-way ANOVA and Tukey post hoc test. n = 6 per group

Afterward, we employed quantitative RT-PCR to evaluate the expression levels of various classic pro-inflammatory and anti-inflammatory genes in microglia. Tolebrutinib-OGD treatment decreased the mRNA levels of pro-inflammatory markers, including Nos2, Tnf-a, IL-1b, Cd86, and Nlrp3 in vitro (Fig. 4E). Conversely, the mRNA levels of anti-inflammatory genes, such as Tgfb, Il-10, Arg1, Spp1, and Il-4, were increased significantly (Fig. 4E). Meanwhile, the expression levels of markers related to microglial phagocytosis (Cd68, Lgal3 and Clec7a) were pronouncedly downregulated in tolebrutinib treatment group (Fig. 4E). Consistent with the results in vivo, these observations verified that tolebrutinb skews microglia towards an anti-inflammatory and homeostatic phenotype in in vitro hypoxia.

Tolebrutinib suppressed microglial oxidative stress, mitochondrial dysfunction and ferroptosis

Recently, emerging studies pointed out that ferroptosis, characterized by an imbalance of redox function was powerfully associated with the pathologic physiology of CCH [32, 33]. To further understand the neuroprotective mechanisms of tolebrutinib in CCH mice, oxidative stress, mitochondrial function, ferroptosis-related markers, and cell viability by qPCR, immunofluorescence staining, flow cytometry, and lactic dehydrogenase (LDH) release test in vitro. The expression of pro-ferroptosis markers Acsl4, Noca4, Ptgs2 and Fth1 were notably upregulated and the mRNA level of anti-ferroptosis indicators Alox12, Gpx4, Fsp1 and Hspb1 were downregulated in vehicle + OGD group microglia compared to the control group (Fig. 4E). However, these effects were significantly reversed with the addition of tolebrutinib, suggesting that tolebrutinib suppressed ferroptosis in microglia under hypoxic circumstances.

To further confirm the effects of suppressing ferroptosis by microglia, we detected the intensity of Mitosox, C11 Bodipy, ROS, FerroOrange, and JC1. Compared with the control group, the intensity of Mitosox, ROS, and FerroOrange were significantly increased in OGD-Vehicle group, while tolebrutinb treatment decreased the intensity of Mitosox, ROS and FerroOrange (Fig. 5A-B). In addition, the proportion of oxidation state BODIPY and JC1 monomer presented a lower level after tolebrutinib treated in vitro (Fig. 5A-B).

Fig. 5.

Tolebrutinib therapy attenuated oxidative stress, mitochondrial dysfunction and ferroptosis in microglia. Tolebrutinib therapy attenuated oxidative stress, mitochondrial dysfunction and ferroptosis in microglia. (A-B) Immunofluorescence staining and quantitative analysis of oxidative stress, mitochondrial dysfunction and ferroptosis related markers. One-way ANOVA and Tukey post hoc test, n = 6 per group. Scale bar = 10 μm. (C-D-E) Representative images of flow cytometry and quantitative analysis of oxidative stress, mitochondrial dysfunction and ferroptosis related markers. One-way ANOVA and Tukey post hoc test, n = 4 per group. (D) The cell viability was detected by Cytotoxicity LDH Assay. One-way ANOVA and Tukey post hoc test, n = 6 per group

Correspondingly, by flowcytometry, we found that the Mitosox⁺ cells account for nearly 87% in Vehicle-OGD group, yet the ratio of the Mitosox⁺ cells was reduced to about 65% after tolebrutinb treatment (Fig. 5C-D). Similarly, the ratio of JC-1 monomer⁺ cells decreased from approximately 60% to about 40% (Fig. 5E). Concurrently, the mean fluorescence intensity of oxidized BODIPY, ROS and FerroOrange had a decrease in Tolebrutinib-OGD group compared with Vehicle-OGD group (Fig. 5C-D). As expected, LDH release was released in the Tolebrutinib-OGD group (Fig. 5F), implying that tolebrutinib may be an important inhibition of cell death in the duration of ischemic injury. Collectively, these findings delineated that tolebrutinb may rescue white matter microglia damage by restraining microglial oxidative stress, mitochondrial dysfunction and ferroptosis during hypoperfusion.

Discussion

At present, the importance of BTKi therapy in the field of CNS diseases has not been fully elucidated [17]. Here, we extended insights into chronic white matter ischemia and identified a role of BTKi in regulating neuroinflammation. Along with sustained myelin damage, microglia and its expressions of BTK were remarkably activated during CCH (Figs. 1 and 2). Consistently, the tolebrutinib therapy led to alleviated microglia-related oxidative stress and inflammation, ameliorated myelin injury and improved cognitive impairments during ischemic demyelination (Figs. 2 and 3 and Figure S1). Furthermore, it has also been confirmed that tolebrutinib could alleviate microglial pro-inflammatory responses in vitro (Fig. 4). Impressively, oxidative stress, mitochondrial dysfunction, and ferroptosis occurred in microglia in in vitro hypoxia, which was rescued by tolebrutinib effectively (Figs. 4 and 5). Our results exhibit promising prospective of tolebrutinib in the treatment of CCH, possibly via regulation of microglia activities and functions in the CNS in CCH.

Microglia are the first responders to active demyelinated lesions even lesions get inactive or lightened, which are responsible for immune surveillance, host defense, and brain tissue repair [34, 35]. Previous studies from white matter ischemic lesions have already shown the reactive microglia exist in the core and surrounding areas of myelin injury, along with up-regulated biomarkers of oxidative stress and inflammation [36–38]. On the other hand, these reactive microglia is also involved in the pathophysiology of CCH through several mechanisms, including recruiting infiltrating immune cells [39, 40] and releasing numerous proinflammatory cytokines and chemokines that cause BBB dysfunctions and hinder remyelination [41–45]. Additionally, our previous studies have revealed that inhibition of microglial inflammatory response alleviated ischemic demyelination injury and cognitive dysfunction effectively [18, 46, 47]. In line with these previous results, we first showed that microglia were activated in chronic white matter ischemia, as has been shown by significant alterations in microglia density and morphology, along with activation of BTK.

We then tried to further elucidate therapeutic potentials of targeting BTK in CCH. It has been reported that BTKi possesses the ability to penetrate the BBB and accumulate in the CNS against possible pathophysiological processes in CNS diseases by directly affecting resident or infiltrated immune cells, such as microglia and B cells [17, 48, 49]. The potential role of BTKi in microglia has been explored in several neurodegenerative and inflammatory demyelinating diseases. Keaney et al. stated that microglial activation, phagocytosis, and uptake of synapsis can be relieved by inhibiting microglial BTK, contributing to improved cognitive performance in Alzheimer’s disease (AD) [31]. Meanwhile, Martin et al. proved that BTKi had promising therapeutic potential in myelin repair in ex vivo and in vivo lysophosphatidylcholine (LPC)-induced demyelination models [50]. However, the effect of BTKi on microglial function has not been investigated during chronic white matter ischemia. By utilizing tolebrutinib, a second-generation BTKi with a stronger capacity to penetrate the BBB, lower off-target effects and fewer adverse events, including headaches, nasopharyngitis, and elevations in liver aminotransferase levels than the first generation BTKi [17, 51], we then demonstrated that the tolebrutinib therapy can inhibit BTK activation in microglia, which subsequently led to ameliorated microglia inflammatory response and mitigated myelin damage in mouse BCAS models, suggesting its therapeutic potentials in CCH. In our results, we observed that BCAS induced microglia activation, along with enhanced levels of phagocytosis, which was alleviated with tolebrutinib. We hypothesize that this is because microglial phagocytosis also serves as indicators of microglia-related neuroinflammation (e.g. alterations in microglial morphology, biomarkers including CD68, CD16/32 and others), which induces dysfunctions in the CNS microenvironment after BCAS. Taken together, phagocytosis of microglia may potentially serve as a double-edged sword in BCAS-induced white matter injury. Combining these previous findings and our results, we proposed that tolebrutinib exerts its neuroprotective roles during CCH via suppressing BTK activation and subsequently the release of proinflammatory cytokines from microglia, which thus contribute to ameliorated neuroinflammation and demyelination in CCH.

Previous studies emphasized solely on BTKi restricting microglia inflammation, however, the role of BTKi in microglia ferroptosis has not been elucidated until now. Of note, we first identified that the tolebrutinib treatment significantly ameliorated microglia ferroptosis induced by in vitro hypoxia. Recent studies have shed light on ferroptosis in CCH pathogenesis, for it is recognized that oxidative stress and ferroptosis were induced in CCH brains and brains of subcortical ischemic vascular dementia patients exhibited iron deposits [33, 52, 53]. Ferroptosis serves as a form of cell death, with characteristics including accumulated Fe²⁺, peroxidized lipids and increased ROS, which are also closely associated with enhanced levels of oxidative stress. Our results suggest that BCAS-induced white matter injury contribute to enhanced levels of microglial ferroptosis-related oxidative stress, which was, on the other hand, alleviated via tolebrutinib. From this aspect, the white matter injury induced by BCAS more possibly contribute to a pro-ferroptosis state in microglia, which is also related with exacerbated levels of neuroinflammation, mitochondrial dysfunction and oxidative stress.

In our present study, we found microglial ferroptosis was significantly enhanced, which is characterized by peroxidized lipids, increased ROS, mitochondrial superoxide, disrupted mitochondrial membrane potential, accumulated Fe²⁺, and obvious cell death in hypoxia. Ferroptosis has been demonstrated to be potential therapeutic target against cognitive impairments induced by hypoperfusion, as emerging evidence suggests that, in degenerative microglia of aging population, abundant Fe²⁺ and myelin debris were enriched, the suppression of may reduce the effects of white matter damage and myelin loss on the progression of cognitive deficits [54].

Therefore, we then further explored the effects of tolebrutinib on microglia ferroptosis under hypoxic circumstances. We identified that tolebrutinib treatment skewed microglia towards anti-inflammatory and homeostatic phenotype, along with relieving hypoxia-induced unbalanced redox function, mitochondria damage and ferroptosis effectively. Combining our results and the previous studies, it is convincing that the alleviation of myelin injury and cognitive dysfunction by suppressing microglial oxidative stress, mitochondrial dysfunction and ferroptosis is one of the mechanisms of neuroprotective effect of tolebrutinib.

There’ve already been several studies showing the mechanisms of BTK on demyelination injuries. Elkjaer et al. have found that enhanced BTK expression was associated with elevated levels of both complement and Fc gamma receptors, as well as higher number of microglia, B lymphocytes and other immune cells [55]. On the other hand, Steinmauer et al. have also shown that BTK + cells were significantly increased in both active and inactive demyelination lesions, along with iron⁺ and CD68⁺ microglia-like cells, showing that expression and activities of BTK are potentially associated with microglial iron accumulation in demyelination lesions [56]. In line with these previous studies, our results also showed that activation of BTK in microglia was accompanied by significant alterations in both microglia density and morphology in ischemic myelin injury, while inhibition of BTK not only alleviated microglial phagocytosis and pro-inflammatory phenotypic transitions, but also significantly inhibited ferroptosis and oxidative stress in microglia in demyelination injury.

In summary, we demonstrated that tolebrutinib ameliorates white matter lesions and cognitive dysfunction via relieving microglia inflammation, oxidative stress, mitochondrial dysfunction and ferroptosis during chronic white matter ischemia. Our study provides novel insights into the role of tolebrutinib in improving ischemic white matter injury, by weakening microglia inflammation and ferroptosis and facilitating its conversion from pro-inflammatory microglia towards anti-inflammatory and homeostatic phenotypes, which suggest the promising therapeutic potential of tolebrutinib in the treatment of CCH.

Limitations

The study still has some limitations. The staining pattern may depend on the degree of pathologic damage in different models. Therefore, the immunofluorescence of several indicators may not be pretty evident in BCAS model, in which pathologic damage was much slighter than NMO or MCAO model. This shortcoming is what we endeavor to overcome in future studies.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

QC and TD designed the project conception. LQ, CY, PX, YY, ZH, ZL, ZL and CL performed the literature search. XL conducted the experiment. XL and YS drafted the paper and analyzed the data. YS, SK, XJ, QC, TD and WW revised the manuscript. All authors read and approved the final version of the manuscript.

Funding

This study was funded by National Natural Science Foundation of China (Grants: 82271341, 82371404, 82071380, 81873743), Knowledge Innovation Program of Wuhan Shuguang Project (2022020801020454), Tongji Hospital (HUST) Foundation for Excellent Young Scientist (Grant No. 2020YQ06), Ministry of Science and Technology China Brain Initiative Grant (2022ZD0204704), National Natural Science Foundation of China 82301510, and Tongji Hospital (HUST) Foundation for Excellent Young Scientist 24-2KYC13057-12.

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Ethics approval and consent to participate

All experiments involving animals were consented by the Animal Care Committee of Tongji Medical College, Huazhong University of Science. Technology, China.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.