Skip to main content
NCBI home page
Skin Research and Technology logoLink to Skin Research and Technology
. 2024 Aug 5;30(8):e13888. doi: 10.1111/srt.13888

Silicone dressing combined with topical oxygen therapy alleviates incontinence‐associated dermatitis via NF‐κB p65/STAT1 signaling pathway

Guiyu an Chen 1, Yingxun Chen 2, Yan Zhang 1, Shufeng Zheng 3, Louying Zhu 4, Mingxing Ding 5,✉
PMCID: PMC11298708  PMID: 39099447

Abstract

Background

Incontinence‐associated dermatitis (IAD) is a tough problem in clinical settings, not only increasing the risk of complications like catheter‐related urinary tract infections and pressure ulcers in elderly and critically ill patients, but also prolonging hospital stays, raising hospital costs, and possibly leading to medical disputes. This study is aimed to evaluate the therapeutic effect of silicone dressing combined with topical oxygen therapy on IAD in a rat model.

Methods

An IAD rat model induced by synthetic urine with trypsin was established. Hematoxylin & eosin staining was carried out to examine skin histology. Using immunofluorescence, the microvessel density in the affected skin tissues was determined. ELISA was performed to measure the concentrations of inflammatory cytokines and angiogenic factors in serum. The mRNA expression of EGF, PDGF, and VEGF was detected via qRT‐PCR. Western blotting was employed to determine NF‐κB p65/STAT1 pathway‐related protein levels.

Results

Compared to single therapy, silicone dressing combined with topical oxygen therapy could significantly reduce the severity of IAD, improve skin histology, inhibit inflammation, and promote angiogenesis in IAD rat models. Additionally, the results showed that relatively speaking, the combined therapy suppressed the NF‐κB p65/STAT1 signaling pathway more effectively.

Conclusion

These findings indicated that silicone dressing combined with topical oxygen therapy can alleviate IAD through promoting wound healing and inhibiting inflammation via NF‐κB p65/STAT1 signaling pathway in a rat model, which provided a theoretical basis for the prevention and treatment of IAD in clinic.

Keywords: angiogenesis, incontinence‐associated dermatitis, inflammation, nf‐κb p65/stat1 pathway, silicone dressing combined with topical oxygen therapy

Abbreviations

(TNF‐α)

tumor necrosis factor‐alpha

EGF

epidermal growth factor

ELISA

enzyme‐linked immunosorbent assay

HE

hematoxylin & eosin

IAD

incontinence‐associated dermatitis

IFN‐γ

Interferon‐gamma

IL‐1β

Interleukin‐1beta

MVD

microvessel density

NF‐κB

noncanonical nuclear factor‐kappaB

PDGF

platelet‐derived growth factor

STAT1

signal transducer and activator of transcription 1

VEGF

vascular endothelial growth factor

1. SUMMARY STATEMENT

1.1. What is already known about this topic?

(1) Among three novel skin care regimens (zinc oxide, painless skin protective film, and silicone dressing), silicone dressing possessed the best therapeutic effect on an incontinence‐associated dermatitis (IAD) rat model.

(2) The effect of silicone dressing on wound healing is still not satisfactory.

2. OXYGEN PLAYS A MAJOR ROLE IN ANTI‐INFLAMMATION, ANGIOGENESIS, COLLAGEN SYNTHESIS, AND PROTECTING AGAINST INFECTION IN WOUND HEALING PROCESSES

2.1. What this paper adds?

Compared to single therapy, silicone dressing combined with topical oxygen therapy could significantly decrease IAD scores and pH values, improve skin histology, inhibit inflammation, and promote angiogenesis in IAD rat models.

2.2. The implications of this paper

These results provided a theoretical basis for the prevention and treatment of IAD in clinic that nurses and other healthcare professionals may apply silicone dressing combined with topical oxygen therapy in patients with IAD.

3. INTRODUCTION

Incontinence‐associated dermatitis (IAD) is a challenging clinical problem that is common in elderly and critically ill patients during hospitalization. It is generally manifested as inflammation of the skin surface, skin loss, erythema, and superficial erosion. 1 The survey results of hospitals and long‐term care institutions indicated that the incidence of IAD varies widely from 19% to 58.7%, ranking second among the four major skin problems in the elderly. 2 A large number of the elderly and critically ill patients is incontinent due to disorders of consciousness, relaxation of urethra, and anal sphincter and gastrointestinal dysfunction. 3 This makes the perianal and perineal skin moist for a long time, while long‐term moist skin environment can weaken the barrier protection function of the stratum corneum, facilitate the penetration of harmful substances and bacterial reproduction, and reduce the protection ability against mechanical damage. 4 IAD not only increases the risk of complications such as catheter‐related urinary tract infections and pressure ulcers in elderly and critically ill patients, but also prolongs the hospitalization of patients, increases hospitalization costs, and may even lead to medical disputes. 5 Therefore, how to prevent and treat IAD is a hot issue that needs to solve urgently.

The main pathophysiology basis of IAD is the chemical and physical stimulation on the skin barrier, which leads to inflammation and subsequent skin damage. The risk factors for IAD mainly include incontinence chemical irritants, the growth of harmful microorganisms on the skin surface, changes in pH value, occluded perineum environment, and mechanical factors. 6 , 7 Exposure to moisture from liquid stool or urine can overhydrate the skin, which makes it more susceptible to microorganism invasion, leading to erosion for the stratum corneum during perineal cleansing. 8 Therefore, inflammation, blister, and erythema occurred in the skin of the perineal area. Currently, there are multiple nursing opinions for the prevention and treatment of IAD, such as regularly observing and evaluating, reducing urinary and fecal irritation, correctly cleaning, moisturizing, and skincare, and maintaining suitable pH value in skin. 9 , 10 , 11 Some skin barrier products such as creams, films, and sprays have been used to create a physical barrier between the skin and the moisture source. 12 , 13 However, product selection remains a challenge for nursing staff in preventing and managing IAD due to the differences in the performance and clinical efficacy of skin barrier products. 14 Previous research has compared the effectiveness of three skin care regimens (zinc oxide, painless skin protective film, and silicone dressing) on an IAD rat model and demonstrated that silicone dressing possessed the best therapeutic effect. 15 However, the effect of silicone dressing on wound healing is still not satisfactory.

In this groundbreaking work, we ascertained the effect of silicone dressing combined with topical oxygen therapy in an IAD rat model. These findings may be conducive to provide theoretical and experimental evidence for clinical IAD nursing and treatment.

4. MATERIALS AND METHODS

4.1. Chemicals, materials, and reagents

From Sigma Aldrich (San Luis, Missouri, USA), creatinine (purity > 99%), urea (purity > 99%), ammonium chloride (purity > 99.9%), sodium sulfite (purity > 98%), and sodium chloride (purity > 99%) were obtained. Aladdin (Shanghai, China) provided anhydrous disodium hydrogen orthophosphate (purity > 99%), ammonium hydroxide, sodium hydroxide (purity > 99.9%), and trypsin solution. From EMD Millipore (Billerica, Massachusetts, USA), ultrapure water was available. Medical adhesive tapes were purchased from 3 M company (Saint Paul, Minnesota, USA). Unitrump Biotechnology (Qidong, China) provided the silicone dressing. We acquired rat epidermal growth factor (EGF) ELISA Kit, rat platelet derived growth factor (PDGF) ELISA Kit, and rat vascular endothelial growth factor (VEGF) ELISA Kit from Lun Chang Shuo Biotech (Xiamen, China). Triton X‐100, hematoxylin & eosin (HE) Staining Kit, rat IFN‐γ ELISA Kit, rat IL‐1β ELISA Kit, rat IL‐2 ELISA Kit, rat TNF‐α ELISA Kit, RIPA lysis buffer, ECL Kit, and BCA Kit were obtained from Beyotime (Shanghai, China). CD31 primary antibody and fluorescent secondary antibody for immunofluorescence tests were obtained from BD Pharmingen (San Diego, California, USA). For western blotting, primary antibodies NF‐κB p65, STAT1, and GAPDH were from Proteintech (Manchester, UK); p‐NF‐κB p65 was from Abcam (Cambridge, UK); p‐STAT1 was from Cell Signaling Technology (Boston, Massachusetts, USA). HRP‐conjugated secondary antibodies were obtained from Sanying (Wuhan, China). From Promega (Madison, Wisconsin, USA), total RNA Extraction Kit was purchased, and from Yeasen Biotechnology (Shanghai, China), Hifair II 1st Strand cDNA Synthesis SuperMix and Hieff qPCR SYBR Green Master Mix were available.

4.2. Synthesis of artificial urine

A total of 2 g creatinine, 25 g urea, 3 g ammonium chloride, 3 g sodium sulfite, 9 g sodium chloride, and 2.5 g anhydrous disodium hydrogen orthophosphate was dissolved in 1000 mL ultrapure water. Subsequently, 25% ammonium hydroxide solution was added into 25 mL of the mixture, thus synthetic urine solution with 1% ammonium hydroxide was obtained. Sodium hydroxide was added into the solution of synthetic urine combined with trypsin and adjusted pH to 7.5–8.5.

4.3. IAD model establishment and treatment

Male Sprague‑Dawley rats weighing 150–220 g (8‐week‐old) were obtained from SLAC Laboratory Animal (Shanghai, China). They were separated into five groups at random: the control, model, silicone + model, oxygen + model, and silicone + oxygen + model, with five rats in each group. IAD model was established as follows: a cotton ball containing the synthetic urine with trypsin was used to cover the selected area on the back of the rat. The cotton ball was fixed with adhesive tape and then enwound with an elastic bandage. Once a day in the morning and afternoon, 5 mL synthetic urine with trypsin solution was added to the cotton ball to keep the cotton ball moist and covered the back of the rat continuously. Cotton balls containing normal saline were applied to the rats in the control group. For rats in the silicone + model group, the silicone dressing was applied twice a day to the affected skin. For the oxygen + model group, rats received topical oxygen therapy (100% oxygen) twice a day (30 min for each time). The detailed procedures were as follows: each rat was placed in a sealed bag, exposing its front paws and head. An oxygen tube was inserted from the sealing port and placed on the back of the rat. The oxygen tube was precut with —four to six side holes to increase the blowing range. The sealing strips of the bag were squeezed tightly to increase sealing performance. Rats in the silicone + oxygen + model first received silicone dressing therapy and then topical oxygen therapy. The experiments lasted 4 days. The images of the affected skin were photographed each day. At the same time, IAD severity was assessed and skin pH value was measured with a pH test paper.

Four days later, rats in the different groups were sacrificed by intraperitoneal injection with an overdose of pentobarbital sodium (200 mg/kg) to collect eyeball blood samples and skin tissue samples. All experimental procedures were conducted in compliance with the Guidelines for Care and Use of Laboratory Animals of the National Institutes of Health, and approved by the Ethical Committee of our institute.

4.4. IAD severity assessment

As previously described, 16 IAD severity assessment was performed. In brief, the severity of skin damage was evaluated based on the degree of skin redness in the back, skin loss and rash. The grading standards were as follows: (i) none, 0 point; (ii) erythema, 1 point; (iii) edema, 2 points; (iv) papule, 3 points; and (v) erosion and superficial ulcer, 4 points.

4.5. HE staining

The skin tissues were fixed, dehydrated, and embedded in paraffin. After cutting into 4 µm thickness slices, dewaxing and rehydration, the slices were executed for HE staining. The histology of skin tissues was examined using a light microscope (OLYMPUS, Tokyo, Japan), with a magnification of × 100 or × 400.

4.6. Immunofluorescence tests

The skin slices were deparaffinized, hydrated, and then underwent antigen retrieval in 10 mM citrate buffer. Following washing by PBS for three times, the sections were permeabilized with 0.1% TritonX‐100 in PBS and then blocked with 5% BSA at room temperature for 1 h. Subsequently, the samples were incubated with primary antibody CD31 and then with the fluorescent secondary antibody. After staining with DAPI, the images were photographed using a fluorescence microscope from OLYMPUS (magnification of × 20 or × 400).

To quantify the microvessel density (MVD), the number of CD31‐positive microvessels was counted. Briefly, the areas of × 20 magnification were the hot spots that showed the most intensive vascularization. In these hot spots, all microvessels (manifested as CD31‐positive microvessels) were counted at × 400 magnification. MVD was defined as the number of microvessels per mm2.

4.7. ELISA

According to manufacturers’ instructions, the concentrations of EGF, PDGF, VEGF, IFN‐γ, IL‐1β, IL‐2, and TNF‐α in the serum of rats were determined via the corresponding commercial kits.

4.8. Total RNA isolation and qRT‐PCR

Total RNA Extraction Kit was used to isolate total RNA from skin tissue samples. With the aid of Hifair II 1st Strand cDNA Synthesis SuperMix and Hieff qPCR SYBR Green Master Mix, qRT‐PCR analysis was carried out. Gene expression levels were calculated with the 2−ΔΔCt approach, with GAPDH for normalization. Primers utilized in this work are shown in Table 1.

TABLE 1.

Real‐time PCR Primer synthesis list.

Gene Sequences
EGF
Forward 5, ‐ GTCCACCCATTGGCAAAACC −3,
Reverse 5, ‐ CACGAATCCTTCCCGACACA −3,
PDGF
Forward 5, ‐ AGGACAGGACGCGTAGAACA −3,
Reverse 5, ‐ GGAGATTCACCGGATGGCTT −3,
VEGF
Forward 5, ‐ GGGAGCAGAAAGCCCATGAA −3,
Reverse 5, ‐ GCTGGCTTTGGTGAGGTTTG −3,
GAPDH
Forward 5, ‐ TCAAGAAGGTGGTGAAGCAGG −3,
Reverse 5, ‐ TCAAAGGTGGAGGAGTGGGT −3,
Open in a new tab

4.9. Western blotting analysis

Total proteins were extracted from skin tissues using RIPA lysis buffer and then measured the concentration with a BCA Kit. Proteins were then separated by SDS polyacrylamide gel electrophoresis and transferred onto a PVDF membrane. The membrane was blocked by nonfat milk (5%), on which primary antibodies NF‐κB p65 (1:1000), p‐NF‐κB p65 (1:1000), STAT1 (1:5000), p‐STAT1 (1:1000), and GAPDH (1:50 000), and the corresponding secondary antibodies (1:1000) were incubated, respectively. GAPDH was the normalization for proteins. Protein signals were ascertained with an ECL Kit and immunoblots were quantified with Alpha Innotech software (Alpha Innotech, San Leandro, California, USA).

4.10. Statistical analysis

Data analysis was performed in SPSS software v22.0 (IBM, Armonk, New York, USA). The test of normal distribution and homogeneity of variance was carried out. The measurement data in normal distribution were indicated as the mean ± standard deviation (SD). One‐way analysis of variance (ANOVA) was used for comparisons among multiple groups, followed by Tukey's post hoc test. p < 0.05 was counted as statistically significant.

5. RESULTS

5.1. Silicone dressing combined with topical oxygen therapy alleviates IAD significantly in a rat model

The images of the affected skin in the different groups were photographed each day. As shown in Figure 1A, it was visually observed that the back skin of the control rat was almost not damaged, while skin damage was severe in that of model rat in a time‐dependent manner. In those IAD rats treated by silicone dressing only, topical oxygen therapy only, or silicone dressing combined with topical oxygen therapy, skin damage was alleviated and wound healing was promoted, to a certain extent. IAD score was used to assess the severity of skin damage. A higher IAD score indicates more severe skin damage. It was shown that the IAD score of model group was dramatically higher than that of control group from first day to fourth day (Figure 1B, p < 0.001). Silicone dressing combined with topical oxygen therapy reduced IAD score significantly starting from the second day (Figure 1B, p < 0.05). Similar results were observed in skin pH value tests. As illustrated in Figure 1C, the skin pH value of model group was distinctly higher relative to that of control group (p < 0.001). Treatment with silicone dressing only, topical oxygen therapy only, or silicone dressing combined with topical oxygen therapy all reduced pH value at the fourth day (p < 0.05). However, silicone dressing combined with topical oxygen therapy had a more significant effect on reducing pH value (p < 0.001).

FIGURE 1.

FIGURE 1

Open in a new tab

Silicone dressing combined with topical oxygen therapy alleviates IAD significantly in a rat model. (A) Photographs of different groups on day 1, 2, 3, and 4 after treatment. (B) Assessment of IAD scores in each group. (C) Determination of pH values in each group. *** P < 0.001 vs. control. # P < 0.05, ## P < 0.01, ### P < 0.001 vs. model. ns, no significance.

5.2. Silicone dressing combined with topical oxygen therapy improves histology and represses inflammation in an IAD rat model

HE staining was then carried out to assess the effects of different therapies on skin histology. As illustrated in Figure 2A, the skin structure of the control group rats was complete and clear. In the model group, the skin structure was unclear, and the arrangement was irregular. A large number of inflammatory cells were infiltrated, and at the same time, epidermal atrophy and hair follicle atrophy were observed. Compared with the model group, the skin damage was significantly improved in silicone + model, oxygen + model, and silicone + oxygen + model groups, but each group still had varying degrees of hair follicle damage and edema. The combined treatment group had the best recovery effect, which was close to the control group. The concentrations of inflammatory cytokines (IL‐1β, IL‐2, IFN‐γ, and TNF‐α) in serum of rats were also examined. It was shown that the concentrations of IL‐1β, IL‐2, IFN‐γ, and TNF‐α were dramatically increased in model group compared to those in the control group (Figure 2B, p < 0.001). Treatment of silicone dressing only, topical oxygen therapy only, or silicone dressing combined with topical oxygen therapy all suppressed inflammation significantly (p < 0.05). Similar to the results observed in HE staining, the combined treatment group had a more significant effect on inhibiting the secretion of inflammatory cytokines (p < 0.001).

FIGURE 2.

FIGURE 2

Open in a new tab

Silicone dressing combined with topical oxygen therapy improves histology and represses inflammation in an IAD rat model. (A) The histology of the affected skin tissues was assessed by HE staining. Magnification × 100 or × 400. (B) The concentrations of IL‐1β, IL‐2, IFN‐γ, and TNF‐α in serum samples of IAD rats were determined via ELISA. *** P < 0.001 vs. control. # P < 0.05, ## P < 0.01, ### P < 0.001 vs. model.

5.3. Silicone dressing combined with topical oxygen therapy promotes angiogenesis in an IAD rat model

Immunofluorescence tests were used to calculate the MVD in different groups. We found that compared to the control group, MVD in the model group was significantly reduced (Figure 3A, p < 0.001). All the three therapies increased MVD to varying degrees, with the combination therapy being the most significant (Figure 3A, p < 0.001). Next, we ascertained the concentrations of angiogenic factors in serum samples of IAD rats. As shown in Figure 3B, the concentrations of EGF, PDGF, and VEGF in the model groups were dramatically decreased in contrast to those of control groups (p < 0.001). We further demonstrated that treatment with silicone dressing only, topical oxygen therapy only, or silicone dressing combined with topical oxygen therapy all increased the concentrations of EGF, PDGF, and VEGF significantly in IAD rat models (p < 0.05) and that the combined therapy possessed the best promoting effect on angiogenesis (p < 0.001). Similar patterns were observed in the results of the mRNA expression of EGF, PDGF, and VEGF in skin tissues (Figure 3C, p < 0.05).

FIGURE 3.

FIGURE 3

Open in a new tab

Silicone dressing combined with topical oxygen therapy promotes angiogenesis in an IAD rat model. (A) The microvessel density was evaluated through immunofluorescence tests. magnification of × 20 or × 400. (B) The concentrations of EGF, PDGF, and VEGF in the serum of rats were measured by ELISA. (C) The mRNA expression of EGF, PDGF, and VEGF in skin tissues was measured by qRT‐PCR. *** P < 0.001 vs. control. # P < 0.05, ## P < 0.01, ### P < 0.001 vs. model.

5.4. Effects of different therapies on the protein levels of NF‐κB p65/STAT1 signaling pathway

Levels of NF‐κB p65/STAT1 pathway‐related proteins were also determined, as presented in Figure 4A. By contrast to the control group, pronounced upregulation of NF‐κB p65, p‐NF‐κB p65, STAT1, and p‐STAT1 proteins was observed in the model group (Figure 4B, p < 0.01). Compared with the model group, the protein level of NF‐κB p65 in the silicone + model and oxygen + model groups had no significant differences, whereas it was distinctly decreased in the silicone + oxygen + model group (Figure 4B, p < 0.01). It was found that the level of STAT1 protein in the silicone + model, oxygen + model, or silicone + oxygen + model groups had no significant differences compared to that in the model group. Interestingly, we demonstrated that all of these three different therapies decreased the protein levels of p‐NF‐κB p65 and p‐STAT1 (Figure 4B, p < 0.001). Additionally, the p‑NF‑κB p65/NF‑κB p65 ratio or p‑STAT1/STAT1 ratio was also assessed. As shown in Figure 4C, it was indicated that treatment with silicone dressing only, topical oxygen therapy only or silicone dressing combined with topical oxygen therapy decreased the ratio of p‑NF‑κB p65/NF‑κB p65 or p‑STAT1/STAT1, among which the combined therapy had the most significant inhibitory effect on NF‐κB p65/STAT1 signaling pathway, with relatively speaking (p < 0.001).

FIGURE 4.

FIGURE 4

Open in a new tab

Effects of different therapies on the protein levels of NF‐κB p65/STAT1 signaling pathway. (A) Representative images of western blots of each group. (B) The protein levels of NF‐κB p65, p‐NF‐κB p65, STAT1, and p‐STAT1 in different groups were determined by western blotting. (C) The ratio of p‑NF‑κB p65/NF‑κB p65 or p‑STAT1/STAT1 was calculated. ** P < 0.01, *** P < 0.001 vs. control. ## P < 0.01, ### P < 0.001 vs. model. ns, no significance.

6. DISCUSSION

The incidence rate of IAD is increasing every year, especially for the elderly population in long‑term care institutions, nursing homes and intensive care units. 17 , 18 Currently, the prevention and treatment of IAD consists of skin conditioning, promoting wound healing, and eradicating skin infections. 19 However, some design weaknesses seem to be common in different types of skin regimens. In the current study, the therapeutic effect and mechanism of a novel combined therapy on IAD was determined, indicating that silicone dressing combined with topical oxygen therapy can alleviate IAD effectively through inhibiting inflammation and promoting wound healing via NF‐κB p65/STAT1 signaling pathway.

To date, there are not many reports on the establishment of IAD animal models, and the methods are also different. Previous study has reported an IAD rat model induced by synthetic urine combined with trypsin, and explored the effects of zinc oxide, painless skin protective film, and silicone dressing on IAD rats, indicating that silicone dressing possessed the best therapeutic effect. 15 However, the effect of silicone dressing on wound healing is still not satisfactory. Damme et al. demonstrated that there may be some correlations between reduced oxygen saturation and IAD development. 20 Copeland et al. reported that oxygen plays a major role in anti‐inflammation, angiogenesis, collagen synthesis, and protecting against infection in wound healing processes. 21 Hypoxia at the wound sites can reduce the antibacterial ability of the wound, slow down the rate of wound contraction, and inhibit the formation of epithelium and collagen synthesis, thereby limiting wound healing. 21 Therefore, we speculated that the reason for the unsatisfactory effect of silicone dressing on wound healing may be related to the hypoxia status in wound sites. Numerous studies have uncovered the stimulatory effect of topical oxygen therapy on wound healing. 22 , 23 , 24 However, its role in IAD treatment is rarely reported. In the current study, three therapies (silicone dressing only, topical oxygen therapy only, or silicone dressing combined with topical oxygen therapy) for IAD rat models were included. The images of the affected skin in the different groups demonstrated that skin damage was alleviated by these treatment methods. Meanwhile, the three treatment methods all increased MVD and the expression of angiogenic factors, among which silicone dressing combined with topical oxygen therapy had the best proangiogenic effect in IAD rats. Not only that, the combined therapy promoted wound healing obviously. We therefore believed that silicone dressing combined with topical oxygen therapy may accelerate wound healing through promoting angiogenesis during the progression of IAD.

IAD score is used to characterize the severity of skin damage, with higher scores indicating more severe skin damage. 16 Additionally, it is well‐known that the pH value of normal skin is around 5.5, manifesting as mildly acidic. Ammonia acts as the main chemical irritant within the moisture during the case of incontinence, which can cause the skin pH shift from mildly acidic to alkaline level (≥ 7), leading to an increase in skin permeability, skin susceptibility, and colonization with micro‐organisms. 25 , 26 Therefore, some researchers recommended using barrier creams with a similar pH to skin to help maintain the permeability and integrity of skin. 27 As expected, we found that IAD score was significantly decreased following silicone dressing combined with topical oxygen therapy, and at the same time, the combined therapy could maximize the recovery of skin pH value. Additionally, inflammation responses are inevitable in the development of IAD. A large number of inflammatory cell infiltration and inflammatory cytokine secretion is throughout the whole process of IAD. 28 , 29 The present study showed that the infiltrated inflammatory cells and inflammatory cytokine concentrations in model rats were reduced effectively after treatment of silicone dressing combined with topical oxygen therapy. All these results implied that silicone dressing combined with topical oxygen therapy may be used as a kind of excellent skin protection cream to maintain skin integrity and suppress inflammation.

NF‐κB and STAT1 are two crucial transcription factors associated with inflammatory responses, especially in some skin inflammation‐related diseases such as atopic dermatitis and psoriasis. 30 , 31 , 32 , 33 After being stimulated, NF‐κB and STAT1 are transferred from cytoplasm to the nucleus and then participate in the expression of inflammatory cytokines. 30 These data implied that inhibition of NF‐κB/STAT1 pathway is helpful for decrease secretion of inflammatory mediators. We therefore speculated that NF‐κB/STAT1 pathway may be also involved in IAD progression. In this study, the ratio of p‑NF‑κB p65/NF‑κB p65 or p‑STAT1/STAT1 was increased in IAD rats, which was significantly suppressed by the combined therapy. These results indicated that silicone dressing combined with topical oxygen therapy inhibited the activation of NF‐κB/STAT1 pathway, suggesting that the anti‐inflammatory activity of the combined therapy may rely on its inhibition on NF‐κB/STAT1 activation.

Some limitations existed in this study that should not be ignored. First, some in vitro experiments may be needed to confirm these data in IAD rats. Second, the interaction of the combined therapy with NF‐κB/STAT1 pathway needs to be further elucidated. Third, a sterile, single‐use, disposable, gas‐impermeable chamber with adhesive edges such as wearing boot form of topical oxygen device has been developed in some developed countries. 34 In clinical application, pure oxygen is locally administered to an affected region of the body at 1.03 atmospheres of pressure, and this can be done in the patient's own home due to the advantages of topical oxygen therapy such as low cost and the lack of systemic oxygen toxicity. 34 As for silicone dressing, the clinical application of silicone dressing in Australia has been well accepted and developed, compared with many other countries worldwide. 35 However, modern wound management practice including the clinical application of a wide range of dressings still develops relatively slow in developing countries. We hope the application of silicone dressing combined with topical oxygen therapy will be validated in IAD patients in the near future.

7. CONCLUSION

Taken together, silicone dressing combined with topical oxygen therapy shows the obviously promoting effect on wound healing and inflammation inhibition in IAD rats, at least partly through inhibiting NF‐κB/STAT1 signals. These data may contribute information and insights on the clinical treatment of IAD.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ETHICS STATEMENT

All experimental procedures were conducted in compliance with the Guidelines for Care and Use of Laboratory Animals of the National Institutes of Health, and approved by the Ethical Committee of Jinhua Municipal Food and Drug Inspection Institute (approval number: AL‐JSYJ202215).

ACKNOWLEDGMENTS

This work was supported by Zhejiang Province Basic Public Welfare Research Program Project in 2020 (Project No: LGD20C040002), Jinhua Public Welfare Technology Application Research Project in 2022 (Project No: 2022‐4‐021) and Research project of the second batch of national vocational education teachers' teaching innovation team by the Ministry of Education (Project No: ZH2021070301).

Chen G, Chen Y, Zhang Y, Zheng S, Zhu L, Ding M. Silicone dressing combined with topical oxygen therapy alleviates incontinence‐associated dermatitis via NF‐κB p65/STAT1 signaling pathway. Skin Res Technol. 2024;30:e13888. 10.1111/srt.13888

DATA AVAILABILITY STATEMENT

The data analyzed during the current study are available from the corresponding author on reasonable request.

REFERENCES

  • 1. Bliss DZ, Savik K, Thorson MA, Ehman SJ, Lebak K, Beilman G. Incontinence‐associated dermatitis in critically ill adults: time to development, severity, and risk factors. J Wound Ostomy Continence Nurs. 2011;38(4):433‐445. doi: 10.1097/WON.0b013e318220b703 [DOI] [PubMed] [Google Scholar]
  • 2. Mugita Y, Minematsu T, Nakagami G, Sanada H. Influence of digestive enzymes on development of incontinence‐associated dermatitis: inner tissue damage and skin barrier impairment caused by lipidolytic enzymes and proteases in rat macerated skin. Int Wound J. 2018;15(4):623‐632. doi: 10.1111/iwj.12906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Zhang Y, Zhang P, Liu JE, Gao F. A qualitative study on the experience and training needs of ICU nurses for incontinence‐associated dermatitis. Adv Skin Wound Care. 2021;34(10):532‐537. doi: 10.1097/01.ASW.0000790484.36520.9a [DOI] [PubMed] [Google Scholar]
  • 4. Banharak S, Panpanit L, Subindee S, et al. Prevention and care for incontinence‐associated dermatitis among older adults: a systematic review. J Multidiscip Healthc. 2021;14:2983‐3004. doi: 10.2147/JMDH.S329672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Cunich M, Barakat‐Johnson M, Lai M, et al. The costs, health outcomes and cost‐effectiveness of interventions for the prevention and treatment of incontinence‐associated dermatitis: a systematic review. Int J Nurs Stud. 2022;129:104216. doi: 10.1016/j.ijnurstu.2022.104216 [DOI] [PubMed] [Google Scholar]
  • 6. Kottner J, Beeckman D. Incontinence‐associated dermatitis and pressure ulcers in geriatric patients. G Ital Dermatol Venereol. 2015;150(6):717‐729. [PubMed] [Google Scholar]
  • 7. Mugita Y, Minematsu T, Huang L, et al. Histopathology of incontinence‐associated skin lesions: inner tissue damage due to invasion of proteolytic enzymes and bacteria in macerated rat skin. PLoS One. 2015;10(9):e0138117. doi: 10.1371/journal.pone.0138117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Bliss DZ, Savik K, Harms S, Fan Q, Wyman JF. Prevalence and correlates of perineal dermatitis in nursing home residents. Nurs Res. 2006;55(4):243‐251. doi: 10.1097/00006199-200607000-00004 [DOI] [PubMed] [Google Scholar]
  • 9. Gates BP, Vess J, Long MA, Johnson E. Decreasing incontinence‐associated dermatitis in the surgical intensive care unit: a Quality Improvement Project. J Wound Ostomy Continence Nurs. 2019;46(4):327‐331. doi: 10.1097/WON.0000000000000540 [DOI] [PubMed] [Google Scholar]
  • 10. Kottner J, Hahnel E, El Genedy M, Neumann K, Balzer K. Enhancing SKIN health and safety in aged CARE (SKINCARE Trial): a study protocol for an exploratory cluster‐randomized pragmatic trial. Trials. 2019;20(1):302. doi: 10.1186/s13063-019-3375-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Phipps L, Gray M, Call E. Time of onset to changes in skin condition during exposure to synthetic urine: a prospective study. J Wound Ostomy Continence Nurs. 2019;46(4):315‐320. doi: 10.1097/WON.0000000000000549 [DOI] [PubMed] [Google Scholar]
  • 12. Voegeli D. Incontinence‐associated dermatitis: new insights into an old problem. Br J Nurs. 2016;25(5):256, 258, 256‐262. doi: 10.12968/bjon.2016.25.5.256 [DOI] [PubMed] [Google Scholar]
  • 13. Lumbers M. How to manage incontinence‐associated dermatitis in older adults. Br J Community Nurs. 2019;24(7):332‐337. doi: 10.12968/bjcn.2019.24.7.332 [DOI] [PubMed] [Google Scholar]
  • 14. Van den Bussche K, De Meyer D, Van Damme N, Kottner J, Beeckman D. CONSIDER—Core Outcome Set in IAD Research: study protocol for establishing a core set of outcomes and measurements in incontinence‐associated dermatitis research. J Adv Nurs. 2017;73(10):2473‐2483. doi: 10.1111/jan.13165 [DOI] [PubMed] [Google Scholar]
  • 15. Chen G, Huang L, Chen Y, Zheng S, Zhu L, Ding M. Establishment of incontinence‐associated dermatitis rat models and assessment of the therapeutic effects of zinc oxide, painless skin protective film and silicone dressing. Exp Ther Med. 2021;22(4):1058. doi: 10.3892/etm.2021.10492 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Borchert K, Bliss DZ, Savik K, Radosevich DM. The incontinence‐associated dermatitis and its severity instrument: development and validation. J Wound Ostomy Continence Nurs. 2010;37(5):527‐535. doi: 10.1097/WON.0b013e3181edac3e [DOI] [PubMed] [Google Scholar]
  • 17. Long MA, Reed LA, Dunning K, Ying J. Incontinence‐associated dermatitis in a long‐term acute care facility. J Wound Ostomy Continence Nurs. 2012;39(3):318‐327. doi: 10.1097/WON.0b013e3182486fd7 [DOI] [PubMed] [Google Scholar]
  • 18. Campbell J, Cook JL, Doubrovsky A, Vann A, McNamara G, Coyer F. Exploring incontinence‐associated dermatitis in a single center intensive care unit: a longitudinal point prevalence survey. J Wound Ostomy Continence Nurs. 2019;46(5):401‐407. doi: 10.1097/WON.0000000000000571 [DOI] [PubMed] [Google Scholar]
  • 19. Beeckman D, Van Damme N, Schoonhoven L, et al. Interventions for preventing and treating incontinence‐associated dermatitis in adults. Cochrane Database Syst Rev. 2016;11(11):CD011627. doi: 10.1002/14651858.CD011627.pub2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Van Damme N, Clays E, Verhaeghe S, Van Hecke A, Beeckman D. Independent risk factors for the development of incontinence‐associated dermatitis (category 2) in critically ill patients with fecal incontinence: a cross‐sectional observational study in 48 ICU units. Int J Nurs Stud. 2018;81:30‐39. doi: 10.1016/j.ijnurstu.2018.01.014 [DOI] [PubMed] [Google Scholar]
  • 21. Copeland K, Purvis AR. A retrospective chart review of chronic wound patients treated with topical oxygen therapy. Adv Wound Care (New Rochelle). 2017;6(5):143‐152. doi: 10.1089/wound.2017.0729 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Dissemond J, Kroger K, Storck M, Risse A, Engels P. Topical oxygen wound therapies for chronic wounds: a review. J Wound Care. 2015;24(2):53‐4, 56–60, 53‐63. doi: 10.12968/jowc.2015.24.2.53 [DOI] [PubMed] [Google Scholar]
  • 23. Woo KY, Coutts PM, Sibbald RG. Continuous topical oxygen for the treatment of chronic wounds: a pilot study. Adv Skin Wound Care. 2012;25(12):543‐547. doi: 10.1097/01.ASW.0000423439.62789.90 [DOI] [PubMed] [Google Scholar]
  • 24. Kaufman H, Gurevich M, Tamir E, Keren E, Alexander L, Hayes P. Topical oxygen therapy stimulates healing in difficult, chronic wounds: a tertiary centre experience. J Wound Care. 2018;27(7):426‐433. doi: 10.12968/jowc.2018.27.7.426 [DOI] [PubMed] [Google Scholar]
  • 25. Fluhr JW, Elias PM. Stratum corneum pH: formation and function of the ‘Acid Mantle’. Exogenous Dermatol. 2002;1(4):163‐175. [Google Scholar]
  • 26. Adam R. Skin care of the diaper area. Pediatr Dermatol. 2010;25(4):427‐433. [DOI] [PubMed] [Google Scholar]
  • 27. Beeckman D, Schoonhoven L, Verhaeghe S, Heyneman A, Defloor T. Prevention and treatment of incontinence‐associated dermatitis: literature review. J Adv Nurs. 2009;65(6):1141‐1154. doi: 10.1111/j.1365-2648.2009.04986.x [DOI] [PubMed] [Google Scholar]
  • 28. Koudounas S, Bader DL, Voegeli D. Investigating the release of inflammatory cytokines in a human model of incontinence‐associated dermatitis. J Tissue Viability. 2021;30(3):427‐433. doi: 10.1016/j.jtv.2021.06.005 [DOI] [PubMed] [Google Scholar]
  • 29. Koudounas S, Minematsu T, Mugita Y, et al. Bacterial invasion into the epidermis of rats with sodium lauryl sulphate‐irritated skin increases damage and induces incontinence‐associated dermatitis. Int Wound J. 2023;20(1):191‐200. doi: 10.1111/iwj.13864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Yang IJ, Lee DU, Shin HM. Inhibitory effect of valencene on the development of atopic dermatitis‐like skin lesions in NC/Nga mice. Evid Based Complement Alternat Med. 2016;2016:1. 10.1155/2016/9370893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Gil TY, Kang YM, Eom YJ, Hong CH, An HJ. Anti‐atopic dermatitis effect of seaweed fulvescens extract via inhibiting the STAT1 pathway. Mediators Inflamm. 2019;2019:1. doi: 10.1155/2019/3760934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Irrera N, Vaccaro M, Bitto A, et al. BAY 11–7082 inhibits the NF‐kappaB and NLRP3 inflammasome pathways and protects against IMQ‐induced psoriasis. Clin Sci (Lond). 2017;131(6):487‐498. doi: 10.1042/CS20160645 [DOI] [PubMed] [Google Scholar]
  • 33. Yang BY, Cheng YG, Liu Y, et al. Datura Metel L. ameliorates imiquimod‐induced psoriasis‐like dermatitis and inhibits inflammatory cytokines production through TLR7/8‐MyD88‐NF‐kappaB‐NLRP3 inflammasome pathway. Molecules.2157, 2019;24(11). doi: 10.3390/molecules24112157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kalliainen LK, Gordillo GM, Schlanger R, Sen CK. Topical oxygen as an adjunct to wound healing: a clinical case series. Pathophysiology. 2003;9(2):81‐87. doi: 10.1016/s0928-4680(02)00079-2 [DOI] [PubMed] [Google Scholar]
  • 35. Queen D, Orsted H, Sanada H, Sussman G. A dressing history. Int Wound J. 2004;1(1):59‐77. doi: 10.1111/j.1742-4801.2004.0009.x [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Skin Research and Technology are provided here courtesy of International Society of Biophysics and Imaging of the Skin, International Society for Digital Imaging of the Skin, and John Wiley & Sons Ltd

RESOURCES