Skip to main content
NCBI home page
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2024 Aug 5;12(8):e2500. doi: 10.1002/mgg3.2500

Developmental epileptic encephalopathy caused by homozygosity of a c.172+1G>C variant in the WWOX gene

Yang You 1, Wenjuan Wu 2, Yakun Du 2, Jintong Hu 2, Baoguang Li 2,3,✉
PMCID: PMC11298992  PMID: 39101447

Abstract

Background

Variations in the WWOX gene have been identified as the leading cause of several central nervous system disorders. However, most previous reports have focused on the description of clinical phenotype, neglecting functional verification. Herein, we presented a case of a patient with developmental epileptic encephalopathy (DEE) caused by WWOX gene variation.

Case Presentation

Our patient was a 13‐month‐old girl with abnormal facial features, including facial hypotonia, arched eyebrows, a broad nose, and a depressed nasal bridge. She also had sparse and yellow hair, a low anterior hairline, and a short neck. Before the age of 8 months, she was suffering from mild seizures. Her developmental delay gradually worsened, and she suffered infantile spasms. After treatment with vigabatrin, seizures subsided. WWOX gene homozygous variation c.172+1G>C was identified using whole exome sequencing. Further minigene assay confirmed that the variation site affected splicing, causing protein truncation and affecting its function.

Conclusion

Clinical phenotype and minigene results suggest that WWOX gene homozygous variation c.172+1G>C can cause severe DEE. We also concluded that vigabatrin can effectively treat seizures.

Keywords: developmental epileptic encephalopathy, epilepsy, WWOX

WWOX gene homozygous variation c.172+1G>C/p.? can cause asevere developmental epileptic encephalopathy, vigabatrin may be effective in treating seizures; according to minigene results, WWOX gene variation c.172+1G>C/p.? can cause WWOX protein truncation; WWOX gene variation can cause not only central nervous system injury but also peripheral nerve injury.

graphic file with name MGG3-12-e2500-g005.jpg

1. INTRODUCTION

Developmental epileptic encephalopathy (DEE) often affects infants and young children. The condition has various etiologies, and genetic factors are believed to have an important role (Specchio & Curatolo, 2021). Previous studies have found that WWOX (OMIM: 605131, GeneBank: NG_011698.1) gene mutations or indels result in DEE type 28. WWOX gene is involved in cellular processes, including growth, differentiation, bone steroid metabolism, and tumor suppression. It is also highly expressed in various parts of the central nervous system, including the brain, cerebellum, brainstem, and spinal cord (Aldaz & Hussain, 2020). WWOX is essential for developing neurons and neurogliocytes in the cerebral cortex. The cerebral cortex of WWOX mutant mice is characterized by a decreased number of neuronal cells, severely reduced myelination, and decreased cell populations of mature oligodendrocytes, astrocytes, and microglia (Hussain et al., 2019). Nevertheless, DEE is not the only neurological condition that can result from variations in this gene; other neurological conditions include spinocerebellar ataxia, uncontrollable seizures, developmental delay, early fatal microcephaly syndrome, and others (Serin et al., 2018).

Herein, we reported a case of DEE caused by a homozygous variant of the WWOX gene in uniparental disomy. The variation site was c.172+1G>C. We described the clinical characteristics of the affected individual, the position of the gene variation site in the domain, the pathogenicity, and the results of the minigene assay.

2. CASE PRESENTATION

2.1. Clinical data: Clinical information of the patient

A 13‐month‐old girl was diagnosed with DEE due to intermittent seizures and developmental delay. She underwent a detailed physical examination, cranial imaging (MRI, AchievA‐1.5T, Netherlands), video electroencephalogram (VEEG, EEG‐9200K, Japan), cardiac ultrasound (high‐grade heart color Doppler ultrasound instrument, APLI0ARTIDASSH‐880CV, Toshiba, Japan), electromyography (EMG‐induced potentiometer, MEB‐2306C, Japan), and urine tandem GC/MS (KingMed Diagnostics, China).

2.2. Genetic testing

The child's peripheral venous blood (2 mL) was collected (EDTA anticoagulation), and genomic DNA was extracted according to the instructions of the DNA extraction kit (Simgen, China). All human exon genes were analyzed using a seizure‐specific targeted next‐generation sequencing (NGS) technologies detection kit. The coding regions of all exon genes, including exons and the transition between exons and introns, were sequenced using the gene sequencing package (MyGenostics, China).

The WWOX splice site variant was confirmed using Sanger sequencing. Primers were designed and amplified by polymerase chain reaction (PCR). PCR reaction conditions were pre‐denaturation at 95°C for 5 min; denaturation at 95°C for the 30 s, annealing at 64°C for 30 s, chain extension at 72°C for 40 s, and amplification for 30 cycles. Finally, the extension was supplemented at 72°C for 10 min.

2.3. Minigene splicing assay

The Minigene plasmid was designed to insert the genome sequence region of exon 1 to exon 3 of the WWOX gene (NG_011698.1). Exons 1 through 3 of the WWOX gene were amplified from the genomic DNA of an unaffected individual using the primers shown in Table 1.

TABLE 1.

Primers for minigene splicing assay.

WWOX‐AF AAGCTTGGTACCGAGCTCGGATCCGCAGTGCGCAGGCGTGAGCGGTCGGG
WWOX‐AR GTGAGCCGAGGCAACCCAGAGCCTGCAGGAGGGAGC
WWOX‐BF TCTGGGTTGCCTCGGCTCACTGCAACTTCTGCTTCCCT
WWOX‐BR TTAAACGGGCCCTCTAGACTCGAGTCAACAAAAAACACTTGTCCGTTCTCATC
Open in a new tab

A shortened version of intron 1 was assembled consisting of the first 348 bp from the 5′ end of the intron in the first PCR product merged with the last 428 bp from the 3′ end of the intron in the second PCR product. The amplified products were cloned using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China) and cloned into a pMini‐CopGFP vector (Beijing Hitrobio Biotechnology Co., Ltd.) digested with restriction enzymes 5′ BamHI/3′ XhoI. The wild‐type plasmid was verified by Sanger sequencing. The variant plasmid was obtained by site‐directed mutagenesis of wild‐type plasmids using the following primers, WWOX‐ T F: GGCAGGAGcTTTGTATGTTGTTGTCTAAGGATCTTGG and WWOX‐MT‐R: CATACAAAgCTCCTGCCACTCGTTTTCTTTTT; the mutant plasmid was verified by Sanger sequencing. Wild‐type and variant minigene plasmids were transiently transfected into human embryonic kidney 293T cells (HEK293T) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States). After 48 h, total RNA was extracted from cells using TRIzol reagent (Cowin Biotech Co., Jiangsu, China). Next, the primers were designed (MiniRT‐F: GGCTAACTAGAGAACCCACTGCTTA and WWOX‐RT‐R: TCAACAAAAAACACTTGTCCGTTCTC), reverse transcription‐PCR (RT‐PCR) amplification was performed. Sanger sequencing was conducted, and minigene transcription of WWOX mRNA sequence was determined. Finally, Snapgene software was used to translate nucleotide sequences into protein sequences, and the influence of variation on the protein translation process was analyzed.

3. RESULTS

3.1. Clinical manifestations

The patient was the third child of her parents, i.e., the third delivery that occurred naturally at 40+6 weeks gestation. She weighed 3300 g at birth. Physical examination revealed the following: malnutrition, a short neck, facial hypotonia, sparse and yellow hair, arched eyebrows, low anterior hairline, broad nose, and depressed nasal bridge. The skin and muscles of the limbs were relaxed, and there was diffuse hypotonia, weakness (Figure 1a–c), and hyporeflexia. The Babinski sign was negative. The child failed to develop gross motor skills and could not raise her head. Before the age of 8 months, her body skills slightly developed, and she had a good appetite. After 8 months, she did not reach the developmental milestones expected for her age, and her face was aging. The child had no fixation and could not find the sound source. She was slowly gaining weight, and her food intake gradually decreased after 8 months of age. Before the last follow‐up, at 13 months old, she weighed 4000 g.

FIGURE 1.

FIGURE 1

Open in a new tab

The photos of the patient. (a and b) Facial photo of the child at 11 months of age. (c) Upper body photo of the child at 9 months. Head MRI of the 4‐month‐old patient. (d) Bilateral ventricles were irregular; left ventricles widened, and bilateral paraventricular microcystic changes. (e) The double frontotemporal extracerebral space was widened, and the corpus callosum was thinned. (f) The c.172+1G>C mutation sequence of the proband. (g) The c.172 + 1G > C mutation sequence of proband's mother. (h) The c.172+1G>C mutation sequence of proband's father. (I) c.172+1G>C's location in the gene and protein domain of WWOX.

The patient had focal seizures that started at 19 days of age. They occurred 6–9 times daily, each lasting for a few seconds. VEEG indicated a background activity of 4–7 Hz medium and clinical focal seizures; a simultaneous electroencephalogram revealed a low‐amplitude spike in the right lead gradually evolving in a slow‐amplitude spike in the bilateral lead, with slowing frequency and increasing amplitude. The duration was about 20 seconds. Levetiracetam (25 mg × kg × d−1) and phenobarbital (5 mg × kg × d−1) were administered as antiepileptic medication. There was no recurrence for about 3 months. At 5 months, she had a tonic episode when the electroencephalogram showed 3–4 Hz low‐medium amplitude mixed wave and wave activity of the bilateral posterior head when fully awake and quiet (Figure 2). She was treated with topiramate (4 mg × kg × d−1) and did not experience a recurrence for about 3 months. The spasm onset occurred at 8 months of age, and the VEEG indicated the 4–5 Hz low‐medium amplitude θ activity in the bilateral occipital regions when awake and quiet. Also, frequent spasms and tonic and myoclonic attacks were observed during sleep (Figure 3). With vigabatrin (200 mg × kg × d−1) added to the treatment, epileptic seizures gradually decreased. At the age of 11 months, she had no apparent seizures. VEEG showed diffuse 1–2 Hzδ slow waves with 5–7 Hzθ waves emitted continuously in each waking and sleeping period, while focal electrical attacks and focal spasm attacks were detected in the bilateral posterior head (VEEG showed clinical seizures, but these were not noticed at home by her parents) (Figure 4). Up to the last follow‐up, when the child was 13 months old, she had no visible seizures.

FIGURE 2.

FIGURE 2

Open in a new tab

The electroencephalogram of the child at 5 months. The electroencephalogram showed 3–4 Hz low‐medium amplitude mixed wave and wave activity of the bilateral posterior head when awake and quiet.

FIGURE 3.

FIGURE 3

Open in a new tab

The electroencephalogram of the child at 8 months old. (a) The VEEG indicated that the 4–5 Hz low‐medium amplitude θ activity was present in the bilateral occipital regions when awake and quiet. (b) Isolated spasm attacks were detected during the awake period. (c) General tonic attacks during the awake period. (d) Myoclonic attacks during the sleep period.

FIGURE 4.

FIGURE 4

Open in a new tab

The electroencephalogram of the child at 8 months old. (a) VEEG showed that diffuse 1–2 Hzδ slow waves with 5–7 Hzθ waves were emitted continuously in each waking and sleeping period. (b) Several focal electrical attacks. (c) Spasm attacks were detected in the bilateral posterior head.

Results of other examinations were as follows: cranial MRI showed that the corpus callosum was thin, the bilateral frontotemporal extracerebral space was widened, and the bilateral ventricles were irregular (Figure 1d,e). Cardiac ultrasound showed an atrial septal defect (3.9 mm) (Figure 5). Brainstem auditory evoked potentials revealed a delayed right auditory conduction pathway (Figure 6), and EMG of the upper and lower limbs suggested peripheral nerve damage (Figure 7). Blood and urine tandem mass spectrometry showed no abnormalities.

FIGURE 5.

FIGURE 5

Open in a new tab

Cardiac ultrasound. Atrial septal defect (3.9 mm).

FIGURE 6.

FIGURE 6

Open in a new tab

Brainstem auditory evoked potential: delayed right auditory conduction pathway.

FIGURE 7.

FIGURE 7

Open in a new tab

Electromyography: Indicates neurogenic impairment of the extremities. (a) Common peroneal nerve motor branch injury. (b) Injury of the sensory branch of the common peroneal nerve.

3.2. Gene testing

A homozygous variant WWOX gene significantly associated with clinical phenotype was detected: c.172+1G>C (Figure 1f–h). After analysis of LOH and CNV, the subject had about 14.9 Mbp copy number neutral heterozygosity loss in the 16q23.1q24.3 zone and about 10.2 Mbp copy number neutral heterozygosity loss in the 16P13.2p1.3 zone (these have not yet been reported in the existing literature), which were thought to be caused by the maternal uniparental disomy (UPD) of chromosome 16.

The patient was diagnosed with epilepsy (focal seizures), WWOX variation‐associated epilepsy, DEE type 28, and a septal defect of the heart. At the age of 7 months, she still suffered developmental regression, could not keep eye contact, could not raise her head, and could not sit independently.

The location of c.172+1G>C in the WWOX gene and protein domain is shown in Figure 1i. A variation was found in intron 2 located in the first WW domain. In the 16q23.1q24.3 region, a loss of about 14.9 Mbp copy number neutral heterozygosity was observed, as well as a loss of about 10.2 Mbp copy number neutral heterozygosity in the 16p13.2p12.3 region. The copy number neutral heterozygosity loss in the above region has not yet been reported, and no loss of chromosome 16 was found, suggesting chromosome 16 parent UPD.

According to the ACMG guide (Richards et al., 2015), c.172+1G>C site pathogenicity analysis was performed. Pathogenicity criteria applied for this variant were as follows: (1) this variant was previously identified in the compound heterozygous state with a pathogenic stop‐gain variant in a patient with epileptic encephalopathy (PM3) (He et al., 2020); (2) this variation occurred in intron 2 of transcript NM_016373.2, which destroyed the classical donor splice site. This variation may lead to protein truncation, thus affecting the function of the protein product this gene encodes. HGMD database includes several pathogenic reports of loss‐of‐function variants downstream of this variation site (PVS1); and (3) the frequency of the variation included in the GnomAD database was 0.000032 (PM2_supporting), and it was determined as a pathogenic variant based on the available evidence and ACMG guidelines.

Minigene assay for WWOX c.172+1G>C variant and schematic diagram of the splicing pattern for mutant‐type are shown in Figure 8. Figure 8a illustrates the minigene trapping vector construct. The gel‐electrophoresis of RT‐PCR revealed a band for wild‐type and another for mutant‐type, as shown in Figure 8b. Minigene product sequencing demonstrated that the wild‐type minigene formed normal mRNA ern (Figure 8ci), but the c.172+1G>C substitution of WWOX caused a splicing abnormality, which abrogated the intron 2 canonical splice site and led to a loss of exon 2 (Figure 8cii). Figure 8d illustrates the schematic diagram of the splicing pattern of WT and MT.

FIGURE 8.

FIGURE 8

Open in a new tab

Minigene assay for WWOX c.172+1G>C variant and schematic diagram of the splicing pattern. (a) Minigene trapping vector construct. (b) RT‐PCR revealed a band for wild‐type and the other band for mutant‐type. (c) Minigene product sequencing demonstrated that the wild‐type minigene formed normal mRNA (i), but the c.172+1G>C substitution of WWOX caused a splicing abnormality, which abrogated the intron 2 canonical splice site and led to a loss of exon2 (ii). (d) The schematic diagram of the splicing pattern of WT, MT.

4. DISCUSSION

In 2000, it was first reported that WWOX is related to breast cancer and other malignant tumors, and its gene exons and introns were identified (Bednarek et al., 2000). In Drosophila, humans, and mice, the WWOX gene produces a short‐chain dehydrogenase/reductase family member protein that is highly conserved and homologous to 93.3% of other proteins (Kośla et al., 2020). WWOX gene has two WW domains: one nuclear localization signal phantom and one c‐terminal SDR region. This protein has two WW binding domains that can bind proline‐rich mods of other proteins. The first WW domain can recognize and bind PPxY mods; the second can enhance this binding (Chang et al., 2005). WWOX is a molecular chaperone, translational regulatory protein, or ubiquitin ligand found in many signaling pathways (Chang et al., 2005). In the preservation of cell metabolism, genetic homeostasis, and cytoskeleton structure, WWOX has a consistent role (Repudi, Steinberg, et al., 2021).

Congenital loss of WWOX function can cause severe neurological deficits (Johannsen et al., 2018). The mechanism of neurological impairment caused by WWOX gene variation was initially thought to be associated with malmyelination (Aldaz & Hussain, 2020; Tochigi et al., 2019) and later to be related to GABAergic neuron damage (Hussain et al., 2019). In their animal studies, Breton et al. (2021) verified that the primary electrophysiological mechanism of WWOX‐induced epilepsy included: (1) decreased spontaneous inhibition, (2) increased gap junction and NMDAR receptor‐mediated electrical activity, (3) increased cell membrane depolarization of pyramidal neurons, and (4) increased rebound excitation after inhibition. Aldaz and Hussain (2020) reported that the cerebellar cortex was the most expressed part of the WWOX gene in the nervous system, followed by the internal olfactory cortex, basolateral amygdala, and frontal cortex. At the cellular level, the granulosa cells of GABAergic neurons showed the highest expression levels.

It has been reported that spinocerebellar ataxia type 12 and DEE, as well as autism spectrum disorders, intellectual disabilities, ADHD (attention deficit and hyperactivity syndrome), Alzheimer's disease, and multiple sclerosis, can all be induced by WWOX gene variations (Steinberg & Aqeilan, 2021). In 2014, Mallaret et al. (2014) first reported that WWOX gene variation could cause generalized tonic–clonic seizures and mental retardation. Since then, several reports have suggested that WWOX gene variations can lead to DEE (Davids et al., 2019; Ehaideb et al., 2018; Johannsen et al., 2018; Serin et al., 2018; Shaukat et al., 2018). Piard et al. (2019) summarized the clinical characteristics of WWOX‐induced DEE, reporting that all children had seizures and delayed neural development, while other symptoms included less spontaneous movement, increased distal muscle tone, and decreased axial muscle tone. The median age of the seizures onset was 1.6 months, ranging from 1 day to 7 months after birth. There were numerous varieties of seizures and accompanying syndromes. Cranial MRI abnormalities included corpus callosum dysplasia, progressive cerebral atrophy, increased white matter signal, and delayed myelination. It has been reported that 80% of the children had no to minimal eye contact. The patient's clinical symptoms and imaging results in this study matched those described in the previous literature.

According to Piard et al. (2019), three categories can be made from the phenotypes and genotypes of neurological diseases brought on by WWOX, that is, the loss of function of two alleles can lead to severe DEE, two missense variations can lead to spinocerebellar ataxia, and one nonsense variation and one missense variation may cause symptoms in between.

The patient in the present study had abnormal facial features, which have been previously described (Mori et al., 2019) (Oliver et al., 2023); however, her symptoms were more severe and progressed more quickly. Before the age of 8 months old, her survival skills and body weight developed slowly, while after 8 months, her development completely stagnated and regressed. The voluntary movement decreased, the skin relaxed, and the face began to age. The background rhythm of the electroencephalogram at 5 months showed higher frequency and more remarkable development than at 2 months, suggesting that her brain was gradually developing. After 11 months of age, the background rhythm of the electroencephalogram gradually slowed down, suggesting the regression of brain development at this time. This was consistent with the physical development of the child and could be caused by the deficiency of the WWOX gene or by epileptic encephalopathy as the child suffered from various malignant epileptic seizures, including spasms and myoclonic, since she was 8 months old, and VEEG could still detect spasms at 11 months of age. This variant was previously reported as a compound heterozygote (He et al., 2020) in a child patient with a heavier phenotype. However, this case report did not further study the mutation site. According to our minigene results, the WWOX gene variation, in our case, was a splicing variation that caused protein truncation. The phenotype was severe DEE, indicative of a severe type. Notably, the homozygous variation in this child was caused by maternal uniparental diploidy, which is rarely reported.

The EMG of the upper and lower limbs suggested peripheral nerve damage. Considering the child's low muscle volume and difficulty eliciting deep tendon reflexes, WWOX gene variation could cause central nervous system and peripheral nerve injury. This may be because WWOX affects lipid metabolism and damages the integrity of the myelin sheath (Baryła et al., 2022). In their study, Piard et al. (2019) reported that 95% of children with WWOX epilepsy had refractory epilepsy, and Riva et al. (20) reported that WWOX gene variation caused DEE in children, while the effects of sodium valproate, vigabatrin, clonazepam, clobacan, levetiracetam, lufamide, ACTH, and ketogenic diet were poor. In the present case, levetiracetam, phenobarbital, and topiramate effectively controlled early seizures, while vigabatrin treatment decreased epileptic seizures, suggesting that vigabatrin may be an effective management option.

Repudi, Kustanovich, et al. (2021) confirmed that the knockdown of the WWOX gene in rodents could lead to intractable epilepsy in mice, and restoration of WWOX expression could reduce brain excitability and seizures. WWOX‐depleted brain tissue exhibited high excitability and epileptiform discharge, which may be related to the disruption of cell pathways and activation of Wnt signals (Steinberg et al., 2021). The reintroduction of WWOX prevented these changes to a certain extent. Gene therapy is still undergoing animal testing and has not been used in clinical settings.

5. CONCLUSION

We reported a rare case of epileptic encephalopathy due to a homozygous variation of the WWOX gene caused by uniparental diploidy. A minigene assay used to confirm the variation site revealed that the variation resulted in protein truncation, further demonstrating the pathogenicity of the variation. We summarized and analyzed the particular appearance, physical development, electroencephalogram, and epileptic evolution of the child. This study provides a basis for studying the relationship between the epilepsy phenotype and the genotype of WWOX gene variations.

AUTHOR CONTRIBUTIONS

You Yang and Hu Jin Tong carried out the studies, participated in collecting data, and drafted the manuscript. Wu Wen Juan and Du Yakun participated in the acquisition, analysis, or interpretation of data and drafted the manuscript. BG L participated in project guidance. All authors read and approved the final manuscript.

FUNDING INFORMATION

None.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no competing interests.

ETHICS STATEMENT

All procedures were performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. The study was approved by Hebei Children's Hospital Ethics Committee. The Hebei Children's Hospital's Institutional Review Board also approved the study after consulting with its ethics committee (approval number 2021[152]).

CONSENT FOR PUBLICATION

Patient's guardians have consented to the submission of their case.

ACKNOWLEDGMENTS

I would like to express my deepest gratitude to the patient and her parents, who provided the photos and significantly contributed to human health development.

You, Y. , Wu, W. , Du, Y. , Hu, J. , & Li, B. (2024). Developmental epileptic encephalopathy caused by homozygosity of a c.172+1G>C variant in the WWOX gene. Molecular Genetics & Genomic Medicine, 12, e2500. 10.1002/mgg3.2500

DATA AVAILABILITY STATEMENT

This article contains all of the data created or analyzed during this study.

REFERENCES

  1. Aldaz, C. M. , & Hussain, T. (2020). WWOX loss of function in neurodevelopmental and neurodegenerative disorders. International Journal of Molecular Sciences, 21, 8922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baryła, I. , Kośla, K. , & Bednarek, A. K. (2022). WWOX and metabolic regulation in normal and pathological conditions. Journal of Molecular Medicine (Berlin, Germany), 100, 1691–1702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bednarek, A. K. , Laflin, K. J. , Daniel, R. L. , Liao, Q. , Hawkins, K. A. , & Aldaz, C. M. (2000). WWOX, a novel WW domain‐containing protein mapping to human chromosome 16q23.3‐24.1, a region frequently affected in breast cancer. Cancer Research, 60, 2140–2145. [PubMed] [Google Scholar]
  4. Breton, V. L. , Aquilino, M. S. , Repudi, S. , Saleem, A. , Mylvaganam, S. , Abu‐Swai, S. , Bardakjian, B. L. , Aqeilan, R. I. , & Carlen, P. L. (2021). Altered neocortical oscillations and cellular excitability in an in vitro Wwox knockout mouse model of epileptic encephalopathy. Neurobiology of Disease, 160, 105529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang, N. S. , Doherty, J. , Ensign, A. , Schultz, L. , Hsu, L. J. , & Hong, Q. (2005). WOX1 is essential for tumor necrosis factor‐, UV light‐, staurosporine‐, and p53‐mediated cell death, and its tyrosine 33‐phosphorylated form binds and stabilizes serine 46‐phosphorylated p53. The Journal of Biological Chemistry, 280, 43100–43108. [DOI] [PubMed] [Google Scholar]
  6. Davids, M. , Markello, T. , Wolfe, L. A. , Chepa‐Lotrea, X. , Tifft, C. J. , Gahl, W. A. , & Malicdan, M. C. V. (2019). Early infantile‐onset epileptic encephalopathy 28 due to a homozygous microdeletion involving the WWOX gene in a region of uniparental disomy. Human Mutation, 40, 42–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ehaideb, S. N. , Al‐Bu Ali, M. J. , Al‐Obaid, J. J. , Aljassim, K. M. , & Alfadhel, M. (2018). Novel homozygous mutation in the WWOX gene causes seizures and global developmental delay: Report and review. Translational Neuroscience, 9, 203–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. He, J. , Zhou, W. , Shi, J. , Zhang, B. , & Wang, H. (2020). A Chinese patient with epilepsy and WWOX compound heterozygous mutations. Epileptic Disorders, 22, 120–124. [DOI] [PubMed] [Google Scholar]
  9. Hussain, T. , Kil, H. , Hattiangady, B. , Lee, J. , Kodali, M. , Shuai, B. , Attaluri, S. , Takata, Y. , Shen, J. , Abba, M. C. , Shetty, A. K. , & Aldaz, C. M. (2019). Wwox deletion leads to reduced GABA‐ergic inhibitory interneuron numbers and activation of microglia and astrocytes in mouse hippocampus. Neurobiology of Disease, 121, 163–176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Johannsen, J. , Kortüm, F. , Rosenberger, G. , Bokelmann, K. , Schirmer, M. A. , Denecke, J. , & Santer, R. (2018). A novel missense variant in the SDR domain of the WWOX gene leads to complete loss of WWOX protein with early‐onset epileptic encephalopathy and severe developmental delay. Neurogenetics, 19, 151–156. [DOI] [PubMed] [Google Scholar]
  11. Kośla, K. , Kałuzińska, Ż. , & Bednarek, A. K. (2020). The WWOX gene in brain development and pathology. Experimental Biology and Medicine (Maywood, N.J.), 245, 1122–1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Mallaret, M. , Synofzik, M. , Lee, J. , Sagum, C. A. , Mahajnah, M. , Sharkia, R. , Drouot, N. , Renaud, M. , Klein, F. A. , Anheim, M. , Tranchant, C. , Mignot, C. , Mandel, J. L. , Bedford, M. , Bauer, P. , Salih, M. A. , Schüle, R. , Schöls, L. , Aldaz, C. M. , & Koenig, M. (2014). The tumour suppressor gene WWOX is mutated in autosomal recessive cerebellar ataxia with epilepsy and mental retardation. Brain, 137, 411–419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Mori, T. , Goji, A. , Toda, Y. , Ito, H. , Mori, K. , Kohmoto, T. , Imoto, I. , & Kagami, S. (2019). A 16q22.2‐q23.1 deletion identified in a male infant with west syndrome. Brain & Development, 41, 888–893. [DOI] [PubMed] [Google Scholar]
  14. Oliver, K. L. , Trivisano, M. , Mandelstam, S. A. , De Dominicis, A. , Francis, D. I. , Green, T. E. , Muir, A. M. , Chowdhary, A. , Hertzberg, C. , Goldhahn, K. , Metreau, J. , Prager, C. , Pinner, J. , Cardamone, M. , Myers, K. A. , Leventer, R. J. , Lesca, G. , Bahlo, M. , Hildebrand, M. S. , … Scheffer, I. E. (2023). WWOX developmental and epileptic encephalopathy: Understanding the epileptology and the mortality risk. Epilepsia, 64, 1351–1367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Piard, J. , Hawkes, L. , Milh, M. , Villard, L. , Borgatti, R. , Romaniello, R. , Fradin, M. , Capri, Y. , Héron, D. , Nougues, M. C. , Nava, C. , Arsene, O. T. , Shears, D. , Taylor, J. , Pagnamenta, A. , Taylor, J. C. , Sogawa, Y. , Johnson, D. , Firth, H. , … Philippe, C. (2019). The phenotypic spectrum of WWOX‐related disorders: 20 additional cases of WOREE syndrome and review of the literature. Genetics in Medicine, 21, 1308–1318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Repudi, S. , Kustanovich, I. , Abu‐Swai, S. , Stern, S. , & Aqeilan, R. I. (2021). Neonatal neuronal WWOX gene therapy rescues Wwox null phenotypes. EMBO Molecular Medicine, 13, e14599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Repudi, S. , Steinberg, D. J. , Elazar, N. , Breton, V. L. , Aquilino, M. S. , Saleem, A. , Abu‐Swai, S. , Vainshtein, A. , Eshed‐Eisenbach, Y. , Vijayaragavan, B. , Behar, O. , Hanna, J. J. , Peles, E. , Carlen, P. L. , & Aqeilan, R. I. (2021). Neuronal deletion of Wwox, associated with WOREE syndrome, causes epilepsy and myelin defects. Brain, 144, 3061–3077. [DOI] [PubMed] [Google Scholar]
  18. Richards, S. , Aziz, N. , Bale, S. , Bick, D. , Das, S. , Gastier‐Foster, J. , Grody, W. W. , Hegde, M. , Lyon, E. , Spector, E. , Voelkerding, K. , & Rehm, H. L. (2015). Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in Medicine, 17, 405–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Serin, H. M. , Simsek, E. , Isik, E. , & Gokben, S. (2018). WWOX‐associated encephalopathies: Identification of the phenotypic spectrum and the resulting genotype‐phenotype correlation. Neurological Sciences, 39, 1977–1980. [DOI] [PubMed] [Google Scholar]
  20. Shaukat, Q. , Hertecant, J. , El‐Hattab, A. W. , Ali, B. R. , & Suleiman, J. (2018). West syndrome, developmental and epileptic encephalopathy, and severe CNS disorder associated with WWOX mutations. Epileptic Disorders, 20, 401–412. [DOI] [PubMed] [Google Scholar]
  21. Specchio, N. , & Curatolo, P. (2021). Developmental and epileptic encephalopathies: What we do and do not know. Brain, 144, 32–43. [DOI] [PubMed] [Google Scholar]
  22. Steinberg, D. J. , & Aqeilan, R. I. (2021). WWOX‐related neurodevelopmental disorders: Models and future perspectives. Cells, 10, 3082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Steinberg, D. J. , Repudi, S. , Saleem, A. , Kustanovich, I. , Viukov, S. , Abudiab, B. , Banne, E. , Mahajnah, M. , Hanna, J. H. , Stern, S. , Carlen, P. L. , & Aqeilan, R. I. (2021). Modeling genetic epileptic encephalopathies using brain organoids. EMBO Molecular Medicine, 13, e13610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Tochigi, Y. , Takamatsu, Y. , Nakane, J. , Nakai, R. , Katayama, K. , & Suzuki, H. (2019). Loss of Wwox causes defective development of cerebral cortex with Hypomyelination in a rat model of lethal dwarfism with epilepsy. International Journal of Molecular Sciences, 20, 3596. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

This article contains all of the data created or analyzed during this study.

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES