Abstract
Background
Ginkgetin inhibits growth of tumor cells, reducing blood lipids, and improving atherosclerosis, but the protective effect of ginkgetin in donation after cardiac death (DCD) livers is still unknown. The aim of this study was to determine whether pretreatment of DCD donor livers with ginkgetin can reduce inflammatory response through the JAK2/STAT3 signaling pathway.
Material/Methods
Twenty male Sprague-Dawley rats (200–250 g) were randomly divided into 4 groups: Sham, DCD, Ginkgetin (0.6 mg/kg) pretreatment 1 h before surgery, and Ginkgetin (0.6 mg/kg) plus broussonin E (0.3 mg/kg) (JAK2/STAT3 signaling agonist) pretreatment 1 h before surgery. Rat livers were subjected to 30 min warm ischemia and 24 h cold storage to simulate the preservation process of DCD donor livers, followed by normothermic machine perfusion for 1 h to simulate liver reperfusion in vivo. Liver tissues and perfusate samples were collected for further studies.
Results
Ginkgetin pretreatment significantly decreased the values of ALT and AST (P<0.05), and improved histological alterations according to improved Suzuki’s Score (P<0.05). Ginkgetin also inhibited the protein expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 (P<0.05). Furthermore, ginkgetin pretreatment inhibited levels of interleukin-1β, interleukin-6 and tumor necrosis factor α (P<0.05) to suppress inflammatory response. In addition, broussonin E reversed the improvement of ginkgetin on DCD donor livers.
Conclusions
Ginkgetin can inhibit the inflammatory response through the JAK2/STAT3 signaling pathway to improve the quality of DCD donor livers.
Keywords: Ginkgetin; Jak2 Protein, Rat; Liver Transplantation; Stat3 Protein, Rat; Warm Ischemia
Introduction
Liver transplantation is an effective treatment for end-stage liver disease. With the increase in the number of patients waiting for liver transplantation, donation after brain death (DBD) livers can no longer meet the clinical demand, which makes DCD organs widely used [1]. However, compared with DBD organs, DCD organs often have longer warm ischemia times, are more sensitive to cold ischemia injury, and are at higher risk of severe intraoperative ischemia-reperfusion injury (IRI), which make their short-term and long-term efficacy worse [2]. IRI is an inevitable injury process in liver transplantation from DCD donors. One of the main pathophysiological mechanisms of liver IRI is sterile inflammation, which is an important reason for the poor prognosis of liver transplantation from DCD donors. Therefore, how to effectively reduce the IRI and improve the quality of DCD donor liver has become a major problem in the field of organ transplantation.
Ginkgo biloba is a traditional Chinese medicine for activating blood circulation and removing blood stasis. Ginkgetin (Figure 1), a biflavone, as an extract of Ginkgo biloba, has a variety of biological activities, including anti-cancer effects through p62/SQSTM1 [3], anti-inflammation in the skin [4], anti-bacterial action in vivo and in vitro [5], anti-atherosclerosis [6], and neuroprotection [7]. Recently, ginkgetin has also been found to regulate the JAK2/STAT3 signaling pathway in tumors [8]. Previous studies also have shown that ginkgetin can regulate the JAK2/STAT3/SIRT1 signaling pathway to reduce neuroinflammation and neuronal damage in rats with ischemic stroke [9].
Figure 1.
Chemical structure of ginkgetin.
JAK2 kinase is a tyrosine kinase, and cytokine binding and growth factors such as TGF-β1 induce phosphorylation and activation of this kinase. JAK2 then recruits and phosphorylates downstream STAT proteins and translocates STAT proteins to the nucleus, where they influence gene transcription. JAK2 is a downstream target of the pleiotropic cytokine IL6 that is produced by B cells, T cells, dendritic cells, and macrophages to produce an immune response or inflammation. It can be a receptor for interleukin, interferon, growth hormone, erythropoietin, and leptin. A nonsynonymous mutation in the pseudokinase domain of JAK2 disrupts the domain’s inhibitory effect and results in constitutive tyrosine phosphorylation activity and hypersensitivity to cytokine signaling [10,11]. Therefore, JAK2/STAT3 plays an important role in the inflammatory response. In this study we used ginkgetin to explore whether it can reduce the inflammatory reaction of DCD donor livers through the JAK2/STAT3 pathway to improve the quality of DCD donor livers.
Material and Methods
Establishment of DCD Animal Model
Male Sprague-Dawley (SD) rats (8–10 weeks old, 200–250 g) from the Laboratory Animal Research Center of Hubei Province. All animals were housed under standard conditions. The procedures followed in this study were approved by the Ethics Committee for Laboratory Animal Welfare of the First Affiliated Hospital of Nanchang University and followed the guidelines for the use of laboratory animals from the Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC).
Rats were fasted for 12 h before surgery and were anesthetized with intraperitoneal injection of 3% sodium pentobarbital 50 mg/kg. The diaphragm was cut after laparotomy, and cardiac arrest was induced by pneumothorax. Cardiac death was defined as circulatory arrest and absence of response, heartbeat, pulse, and respiration. Warm ischemia timing was initiated immediately after cardiac death. After 30 min of warm ischemia, the intestinal tube was removed and wrapped in saline gauze to expose the liver and surrounding tissues and vessels. The abdominal aorta and inferior vena cava were separated, the thoracic segment of inferior vena cava was cut, and the abdominal aorta was punctured by an intravenous infusion needle and fixed with a noninvasive vascular clip. Approximately 50 mL of heparin saline at 4°C was slowly perfused into the liver through the needle. After the first porta hepatis were dissected, a polyethylene catheter was inserted into the portal vein and fixed with silk suture. The hepatic artery was ligated and the common bile duct was dissected. The incision was made at the confluence of the right renal vein and inferior vena cava, a polyethylene catheter was inserted along the inferior vena cava and fixed with silk thread, the suprahepatic inferior vena cava was ligated, and the ligament was severed. After the liver was removed, about 5 mL of 4°C UW solution (Wisconsin, USA) was infused from the portal vein, and the liver was placed in 4°C UW solution.
Experimental Grouping
Twenty male SD rats were randomly divided into 4 groups, and each group had 5 rats. In the Sham group and DCD group, pretreatment with normal saline was injected into the tail vein 1 h before surgery. The expression of STAT3 protein was assessed after the rats were treated with different doses of ginkgetin, and it was found that the activation of STAT3 was the most obvious at the dose of 0.6 mg/kg (Supplementary Figure 1). The Ginkgetin+DCD group was pretreated with 0.6 mg/kg ginkgetin (MedChemExpress, New Jersey, USA) injected into the tail vein 1 h before surgery. Broussonin E is known to be a specific activator of the JAK2/STAT3 signaling pathway [12]. The Ginkgetin+Broussonin E+DCD group was pretreated with 0.6 mg/kg ginkgetin plus 0.3 mg/kg broussonin E (MedChemExpress, New Jersey, USA) injected into the tail vein 1 h before surgery. All groups were given 30 min of warm ischemia except for the Sham group.
Liver Preservation and Ex Vivo Liver Perfusion System
The livers were kept in UW solution at 4°C for 24 h, and then perfused for 1 h using an ex vivo rat liver normothermic machine perfusion system [13]. The system consisted of a peristaltic pump (BT300-2J, LONGER, Baoding, China), a water bath, a thermometer, a membrane lung in animals undergoing cardiopulmonary bypass (XIJIAN, Xi’an, China), an oxygen cylinder, a pressure sensor, and connected pipes. The pressure was monitored by a computer. The perfusate was 50 mL Krebs-Henseleit Bicarbonate buffer (M&C Gene Technology, Beijing, China), which consisted of NaCl, KCl, KH2PO4, MgSO4, CaCl2, NaHCO3, and glucose. The perfusion flow rate was 1 mL/g·min, the perfusion pressure was about 8±1 mmHg, the perfusion temperature was 37±0.5°C, the gas was a mixture of 95% O2 and 5% CO2, the gas flow rate was 1 L/min, and the gas was infused into the liver after oxygenation through the oxygenation membrane. The liver tissues and perfusate after 1 h of perfusion were collected and stored in a deep cryogenic refrigerator at −80°C.
Biochemical Analysis
The perfusate after normothermic reperfusion were stored at −80°C and the thawed at room temperature for 30 min before testing. ALT and AST levels in the perfusate were measured using the automatic biochemical analyzer BS-2000 (Mindray, Shenzhen, China) in Zhongnan Hospital of Wuhan University.
H&E Staining
Liver tissues were harvested, fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned. All paraffin sections were immersed in xylene twice for 20 min each. After the wax on the sample was dissolved, the sample was transferred into absolute ethanol and immersed twice for 5 min each time. Then, the samples were rinsed with absolute ethanol for 20 s and then transferred to the basin. The alcohol on the samples was rinsed off with running water. The sections were placed into a staining cylinder and first stained with hematoxylin for 3–5 min, washed with water, and then placed into a differentiation solution staining cylinder for 3–5 s. After rapid water washing, the sections were placed into a return blue solution for 3–5 s and quickly washed with water. Then, the sections were successively placed in 85% ethanol, 95% ethanol, eosin staining solution, absolute ethanol 3 times, n-butyl alcohol, xylene 2 times, and immersed in each solution for 3–5 min. After removing the slices and blowing them dry, the slices were sealed with neutral gum. After completion of H&E staining, histological observation was performed and blinded grading was performed according to Suzuki’s criteria [14]. Histological changes were scored according to the severity of peripheral detrital necrosis (PN) with or without bridging necrosis (BN) in the portal area (0–10 points), intralobular hepatocyte degeneration and focal necrosis (0–4 points), portal inflammation (0–4 points), and fibrosis (0–4 points).
Quantitative Real-Time PCR
Total RNA from frozen rat liver tissues was extracted with TRIzol reagent (Servicebio, Wuhan, China) and reverse-transcribed to cDNA (Yeasen Biotechnology, Shanghai, China). The expressions of the target genes were detected by SYBR Green quantitative real-time polymerase chain reaction, with β-actin as an internal control. The qRT-PCR program mainly consisted of 3 steps of denaturation, annealing, and extension, which was preceded by predenaturation at 95°C for 5 min. We performed a total of 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 20 s. The primer sequences used are listed in Table 1.
Table 1.
List of primer sequences.
| Primer names | Primer sequence (5′ to 3′) |
|---|---|
| R-IL-1β-F | AATCTCACAGCAGCATCTCGACAAG |
| R-IL-1β-R | TCCACGGGCAAGACATAGGTAGC |
| R-IL-6-F | ACTTCCAGCCAGTTGCCTTCTTG |
| R-IL-6-R | TGGTCTGTTGTGGGTGGTATCCTC |
| R-TNF-F | AAAGGACACCATGAGCACGGAAAG |
| R-TNF-R | CGCCACGAGCAGGAATGAGAAG |
| R-β actin-F | GCTGTGCTATGTTGCCCTAGACTTC |
| R-β actin-R | GGAACCGCTCATTGCCGATAGTG |
Western Blot Assay
Tissue was lysed with cell lysis buffer supplemented with protease inhibitor cocktail, 1% PMSF (Biosharp, Hefei, China), and 1% phosphatase inhibitor (Biosharp, Hefei, China). Proteins were quantified by the BCA method and then boiled with 4× loading buffer and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Following electrophoresis, the separated proteins were blotted onto polyvinylidene fluoride (PVDF) membranes. Then, the PVDF membranes were blocked with 5% bovine serum albumin and incubated with the primary antibodies of interest diluted in TBST overnight at 4°C. Antibodies used for immunoblotting were Phospho-JAK2 (Tyr1007/1008) (1: 1000, ZEN-BIOSCIENCE, 381556, Chengdu, China), JAK2 (1: 1000, Bioswamp, PAB30711, Wuhan, China), Phospho-STAT3 (Tyr705) (1: 1000, ZEN-BIOSCIENCE, 381552, Chengdu, China), and STAT3 (1: 1000, Bioswamp, PAB46077, Wuhan, China). β-actin (1: 1000, Abclonal, AC026, Wuhan, China) served as the control for total protein. Then, all membranes were incubated with the HRP-conjugated secondary antibody for 2 h at room temperature. Every experiment was repeated at least 3 times independently.
Statistical Analysis
All data are presented as the mean±SD of at least 3 independent experiments. All statistical analysis were performed using GraphPad Prism 8.0.1 software (San Diego, CA, USA). One-way ANOVA was used when comparing more than 2 groups of data. The non-parametric Kruskal-Wallis test was used to compare multiple independent groups. The t test was be used when comparing 2 groups. P<0.05 was considered to be statistically significant.
Results
Ginkgetin has Protective Effect on DCD Donor Liver
Compared with the Sham group, the DCD group had significant increases in ALT and AST (P<0.05) (Figure 2). Compared with the DCD group, ALT and AST were significantly lower after pretreatment with ginkgetin. Broussonin E, as a specific activator of JAK2/STAT3 [11], significantly inhibited the protective effect of ginkgetin on DCD donor livers. The same tendency was shown by H&E staining of liver tissue (Figure 3). Compared with the Sham group, the liver inflammation in the DCD group was obvious, with massive hepatocyte necrosis and edema. Compared with the DCD group, the liver inflammation in the Ginkgetin group was significantly decreased. After broussonin E administration, the liver inflammatory response was aggravated, and the protective effect of ginkgetin was reversed (P<0.001).
Figure 2.
Ginkgetin has protective effect on DCD donor livers. ALT (A) and AST (B) activities in the perfusate. Data are expressed as mean±SD, * P<0.05 and *** P<0.001. n=5 per group. All statistical analysis were performed using GraphPad Prism 8.0.1 software (San Diego, CA, USA).
Figure 3.
Histological damage in rat livers. (A) H&E staining was performed on paraffin-embedded sections of rat liver tissues. Scale bar=200 μm. (B) Histological scores were analyzed according to Suzuki’s criteria. Data are expressed as mean±SD, *** P<0.001. n=5 per group. All statistical analysis were performed using GraphPad Prism 8.0.1 software (San Diego, CA, USA).
Ginkgetin Alleviated DCD Donor Liver Damage Through the JAK2/STAT3 Signaling Pathway
The effect of ginkgetin on the JAK2/STAT3 signaling pathway was evaluated using western blot analysis (Figure 4). The expressions of p-JAK2/JAK2 and p-STAT3/STAT3 in the liver of the DCD group were significantly higher than those of the Sham group, while the expressions of p-JAK2/JAK2 and p-STAT3/STAT3 in the Ginkgetin group were significantly decreased. Following broussonin E administration, JAK2 and STAT3 were activated and phosphorylated expression increased (P<0.05). These results indicate that ginkgetin can reduce the inflammatory response of DCD donor livers by inhibiting the JAK2/STAT3 pathway.
Figure 4.
Ginkgetin alleviated DCD donor liver damage through the JAK2/STAT3 signaling pathway. (A) Protein levels of p-JAK2, JAK2, p-STAT3, and STAT3 in the livers of each group were evaluated by western blot. (B) Statistical analysis of p-JAK2/JAK2 and p-STAT3/STAT3 protein expression. Data are expressed as mean±SD, * P<0.05 and ** P<0.01. n=3 per group. All statistical analysis were performed using GraphPad Prism 8.0.1 software (San Diego, CA, USA). The grayscale values of the western blot bands were analyzed using Image J software (National Institutes of Health, Maryland, USA).
Ginkgetin Inhibited the Inflammatory Response of DCD Donor Livers Through the JAK2/STAT3 Signaling Pathway
Figure 5 showed the results of q-PCR performed on rat livers. The data showed that IL-1β, IL-6, and TNF-α in the DCD group were significantly higher than those in the Sham group. The expression of proinflammatory factors in the liver was significantly suppressed after ginkgetin treatment. After broussonin E administration, the expression of proinflammatory factors rose again. These results indicate that ginkgetin can inhibit the inflammatory response in DCD donor livers, and this protective effect can be inhibited by broussonin E.
Figure 5.
Ginkgetin inhibited the inflammatory response of DCD donor livers through the JAK2/STAT3 signaling pathway. mRNA expression level in liver of IL-1β (A), IL-10 (B) and TNF-α (C) were tested by real-time PCR. Data are presented as mean±SD, * P<0.05, ** P<0.01, and *** P<0.001. n=5 per group. All statistical analysis were performed using GraphPad Prism 8.0.1 software (San Diego, CA, USA).
Discussion
Liver transplantation is the only effective treatment for patients with end-stage liver disease, and the wide use of DCD organs can be used to make up for the shortage of donor organs. DCD donor liver injury includes warm ischemia injury in vivo, cold perfusion injury during procurement, cold storage injury during preservation, and reperfusion injury after restoration of blood supply. IRI is an inevitable process of liver transplantation; it is also the main risk factor during liver transplantation, and affects the short-term and long-term function of liver transplant recipients.
IRI mainly occurs in tissues and organs that recover blood perfusion after the ischemic stage. The restoration of blood supply can improve tissue and organ damage caused by ischemia, but the damage after blood reperfusion exceeds its improvement effect [15]. The pathogenesis of IRI involves a variety of pathophysiological mechanisms, including oxidative stress, calcium overload, innate immune activation and sterile inflammatory response [16–19]. In the warm ischemia stage, due to the lack of oxygen and oxidative substrates, the electron transport chain of oxidative metabolism of hepatocytes is interrupted, and ATP-dependent enzymes such as sodium pumps cannot work, resulting in cell edema and ion metabolism disorder [19]. In the cold ischemia stage, although cell metabolism is maintained at a low level, hepatic sinusoidal endothelial cells are still continuously damaged, which leads to changes in gene expression and transcriptional regulation [19,20]. In the reperfusion stage, the restored oxygen supply and hypoxanthine accumulated in the ischemic stage generate a large amount of ROS under the action of xanthine oxidase, which attacks the membrane structure of cells [21] and leads to the permeability transition of mitochondria, which further leads to the activation of cell death programs, including apoptosis, autophagy-related cell death, and necrosis [22]. Necrotic or damaged cells actively or passively release damage-associated molecular patterns (DAMPs), promoting aggregation of immune cells and release of proinflammatory factors, resulting in sterile inflammatory response, which further aggravates liver tissue damage [23,24]. Previous studies [13,25,26] have found that the inflammatory response is an important factor causing IRI in the liver, and IRI can be effectively reduced by inhibiting the inflammatory response.
Ginkgetin is a polycyclic polyphenolic compound extracted from the traditional Chinese medicine Ginkgo biloba. Previous studies have found that ginkgetin can inhibit growth of tumor cells, promote apoptosis of tumor cells [27,28], reduce blood lipids, and improve atherosclerosis [6]. Recent studies have found that ginkgetin can inhibit the inflammatory response. Using human neutrophil elastase (HNE)-stimulated A549 cells and ovalbumin-induced allergic mouse models, Tao et al [29] found that ginkgetin decreased MUC5AC mRNA expression by inhibiting aberrant expression of Akt and p38 pathways. Thus, neutrophils and IL-8 levels were significantly reduced. Zhang et al [30] found that ginkgetin could reduce apoptosis and improve survival of H9C2 cardiomyocytes treated with H2O2 and CoCl2 by mediating the NF-κB signaling pathway. Ginkgetin reduced the CoCl2-induced inflammatory response and the levels of cleaved caspase 3, IL-6, and TNF-α. In previous studies using a rat model of ischemic stroke, ginkgetin was found to regulate the JAK2/STAT3/SIRT1 signaling pathway, thus reducing neuronal apoptosis and PI3K, Akt, Bcl-2, NF-κB, and TLR-4 [9].
In the present study, ALT, AST and proinflammatory factors were significantly increased after reperfusion in DCD donor livers, and the pathological scores were also significantly increased. After pretreatment with ginkgetin, the biochemical detection, proinflammatory factors, and pathological scores of DCD donor livers in rats were improved. Our results suggest that ginkgetin can improve the quality of DCD donor livers and has an important protective effect against IRI.
Jaks non-covalently bind to the cytoplasmic regions of cytokine receptors and promote the tyrosine phosphorylation of relevant Jaks, followed by the recruitment and dimerization of phosphorylated signal transducer and activator of transcription STAT3 through its SH2 domain, then the translocation of phosphorylated STAT to the nucleus to initiate a specific transcriptional program [31]. JAK2/STAT3 signal transduction pathway is the key to biological development and homeostasis, especially plays a huge role in immune and inflammatory responses [32,33]. Western blot analysis of rat liver showed that ginkgetin could significantly reduce the expression of p-JAK2/JAK2 and p-STAT3/STAT3, which inhibited the phosphorylation of JAK2/STAT3. In contrast, treatment of rats with ginkgetin and broussonin E significantly increased the phosphorylation of JAK2/STAT3 in the DCD donor livers, which was accompanied by worsening of liver biochemical measurements, proinflammatory factors, and pathological scores. These results suggest that ginkgetin can inhibit inflammation in DCD donor livers by inhibiting the activation of the JAK2/STAT3 pathway.
It is necessary to acknowledge the limitations of this study. Due to the time limitation, only part of the phenomenon was found while ginkgetin was applied to DCD donor livers, and more characteristics such as oxidative stress and mitochondrial function still need to be further studied. In addition, we only found that the JAK2/STAT3 pathway might play a role in the improvement of DCD donor liver quality by ginkgetin, and in vitro cellular intervention studies are needed in the future. The ameliorating effect of IRI we observed in DCD livers also requires analysis of whether IL-10 plays a role and whether it is caused only by ginkgetin.
In this study, the use of ginkgetin as a means of reducing liver IRI in DCD and improving the quality of DCD donor liver can expand the donor pool, improve the prognosis of patients, and reduce the treatment cost after transplantation.
Conclusions
Ginkgetin pretreatment of DCD donor livers in rats inhibited the JAK2/STAT3 signal pathway, inhibiting the inflammatory response and thereby improving the quality of DCD donor livers.
Supplementary Data
The rats were treated with different doses of ginkgetin.
Footnotes
Conflict of interest: None declared
Publisher’s note: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher
Declaration of Figures’ Authenticity: All figures submitted have been created by the authors, who confirm that the images are original with no duplication and have not been previously published in whole or in part.
Financial support: This study was supported by the Health Commission of Jiangxi Province and Administration of Traditional Chinese Medicine of Jiangxi Province (2019A304), the Natural Science Foundation of Jiangxi province (20224ACB206027), and the National Natural Science Foundation of China (82060122)
References
- 1.Moers C, Leuvenink HG, Ploeg RJ. Non-heart beating organ donation: overview and future perspectives. Transpl Int. 2007;20:567–75. doi: 10.1111/j.1432-2277.2007.00455.x. [DOI] [PubMed] [Google Scholar]
- 2.Dageforde LA, Feurer ID, Pinson CW, et al. Is liver transplantation using organs donated after cardiac death cost-effective or does it decrease waitlist death by increasing recipient death? HPB (Oxford) 2013;15:182–89. doi: 10.1111/j.1477-2574.2012.00524.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lou JS, Bi WC, Chan GKL, et al. Ginkgetin induces autophagic cell death through p62/SQSTM1-mediated autolysosome formation and redox setting in non-small cell lung cancer. Oncotarget. 2017;8:93131–48. doi: 10.18632/oncotarget.21862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lim H, Son KH, Chang HW, et al. Effects of anti-inflammatory biflavonoid, ginkgetin, on chronic skin inflammation. Biol Pharm Bull. 2006;29:1046–49. doi: 10.1248/bpb.29.1046. [DOI] [PubMed] [Google Scholar]
- 5.Li G, Wang G, Wang S, et al. Ginkgetin in vitro and in vivo reduces Streptococcus suis virulence by inhibiting suilysin activity. J Appl Microbiol. 2019;127:1556–63. doi: 10.1111/jam.14365. [DOI] [PubMed] [Google Scholar]
- 6.Lian N, Tong J, Li W, et al. Ginkgetin ameliorates experimental atherosclerosis in rats. Biomed Pharmacother. 2018;102:510–16. doi: 10.1016/j.biopha.2018.03.107. [DOI] [PubMed] [Google Scholar]
- 7.Tian Z, Tang C, Wang Z. Neuroprotective effect of ginkgetin in experimental cerebral ischemia/reperfusion via apoptosis inhibition and PI3K/Akt/mTOR signaling pathway activation. J Cell Biochem. 2019;120:18487–95. doi: 10.1002/jcb.29169. [DOI] [PubMed] [Google Scholar]
- 8.Wu L, Qian C, Zhang W, et al. Ginkgetin suppresses ovarian cancer growth through inhibition of JAK2/STAT3 and MAPKs signaling pathways. Phytomedicine. 2023;116:154846. doi: 10.1016/j.phymed.2023.154846. [DOI] [PubMed] [Google Scholar]
- 9.Xu B, He X, Sui Y, et al. Ginkgetin aglycone attenuates neuroinflammation and neuronal injury in the rats with ischemic stroke by modulating STAT3/JAK2/SIRT1. Folia Neuropathol. 2019;57:16–23. doi: 10.5114/fn.2019.83827. [DOI] [PubMed] [Google Scholar]
- 10.O’Shea JJ, Schwartz DM, Villarino AV, et al. The JAK-STAT pathway: Impact on human disease and therapeutic intervention. Ann Rev Med. 2015;66:311–28. doi: 10.1146/annurev-med-051113-024537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sakatsume M, Igarashi K, Winestock KD, et al. The Jak kinases differentially associate with the alpha and beta (accessory factor) chains of the interferon gamma receptor to form a functional receptor unit capable of activating STAT transcription factors. J Biol Chem. 1995;270:17528–34. doi: 10.1074/jbc.270.29.17528. [DOI] [PubMed] [Google Scholar]
- 12.Huang SP, Guan X, Kai GY, et al. Broussonin E suppresses LPS-induced inflammatory response in macrophages via inhibiting MAPK pathway and enhancing JAK2-STAT3 pathway. Chin J Nat Med. 2019;17:372–80. doi: 10.1016/S1875-5364(19)30043-3. [DOI] [PubMed] [Google Scholar]
- 13.Zhong X, Xiao Q, Liu Z, et al. TAK242 suppresses the TLR4 signaling pathway and ameliorates DCD liver IRI in rats. Mol Med Rep. 2019;20:2101–10. doi: 10.3892/mmr.2019.10439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Suzuki S, Toledo-Pereyra LH, Rodriguez FJ, et al. Neutrophil infiltration as an important factor in liver ischemia and reperfusion injury. Modulating effects of FK506 and cyclosporine. Transplantation. 1993;55:1265–72. doi: 10.1097/00007890-199306000-00011. [DOI] [PubMed] [Google Scholar]
- 15.Siniscalchi A, Gamberini L, Laici C, et al. Post reperfusion syndrome during liver transplantation: From pathophysiology to therapy and preventive strategies. World J Gastroenterol. 2016;22:1551–69. doi: 10.3748/wjg.v22.i4.1551. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bardallo RG, Panisello-Roselló A, Sanchez-Nuno S, et al. Nrf2 and oxidative stress in liver ischemia/reperfusion injury. FEBS J. 2022;289:5463–79. doi: 10.1111/febs.16336. [DOI] [PubMed] [Google Scholar]
- 17.Kalogeris T, Baines CP, Krenz M, et al. Ischemia/reperfusion. Comprehensive Physiology. 2016;7:113–70. doi: 10.1002/cphy.c160006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pittas K, Vrachatis DA, Angelidis C, et al. The role of calcium handling mechanisms in reperfusion injury. Curr Pharm Des. 2018;24:4077–89. doi: 10.2174/1381612825666181120155953. [DOI] [PubMed] [Google Scholar]
- 19.Eltzschig HK, Eckle T. Ischemia and reperfusion – from mechanism to translation. Nat Med. 2011;17:1391–401. doi: 10.1038/nm.2507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Quesnelle KM, Bystrom PV, Toledo-Pereyra LH. Molecular responses to ischemia and reperfusion in the liver. Arch Toxicol. 2015;89:651–57. doi: 10.1007/s00204-014-1437-x. [DOI] [PubMed] [Google Scholar]
- 21.Tchilikidi KY. Liver graft preservation methods during cold ischemia phase and normothermic machine perfusion. World J Gastrointest Surg. 2019;11:126–42. doi: 10.4240/wjgs.v11.i3.126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Dar WA, Sullivan E, Bynon JS, et al. Ischaemia reperfusion injury in liver transplantation: Cellular and molecular mechanisms. Liver Int. 2019;39:788–801. doi: 10.1111/liv.14091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Thorgersen EB, Barratt-Due A, Haugaa H, et al. The role of complement in liver injury, regeneration, and transplantation. Hepatology. 2019;70:725–36. doi: 10.1002/hep.30508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mihm S. Danger-associated molecular patterns (DAMPs): Molecular triggers for sterile inflammation in the liver. Int J Mol Sci. 2018;19(10):3104. doi: 10.3390/ijms19103104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xiao Q, Ye Q, Wang W, et al. Mild hypothermia pretreatment protects against liver ischemia reperfusion injury via the PI3K/AKT/FOXO3a pathway. Mol Med Rep. 2017;16:7520–26. doi: 10.3892/mmr.2017.7501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Liu Z, Zhang X, Xiao Q, et al. Pretreatment donors after circulatory death with simvastatin alleviates liver ischemia reperfusion injury through a KLF2-dependent mechanism in rat. Oxid Med Cell Longev. 2017;2017:3861914. doi: 10.1155/2017/3861914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Su Y, Sun CM, Chuang HH, et al. Studies on the cytotoxic mechanisms of ginkgetin in a human ovarian adenocarcinoma cell line. Naunyn Schmiedebergs Arch Pharmacol. 2000;362:82–90. doi: 10.1007/s002100000240. [DOI] [PubMed] [Google Scholar]
- 28.Ye ZN, Yu MY, Kong LM, et al. Biflavone ginkgetin, a novel Wnt inhibitor, suppresses the growth of medulloblastoma. Nat Prod Bioprospect. 2015;5:91–97. doi: 10.1007/s13659-015-0056-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tao Z, Jin W, Ao M, et al. Evaluation of the anti-inflammatory properties of the active constituents in Ginkgo biloba for the treatment of pulmonary diseases. Food Funct. 2019;10:2209–20. doi: 10.1039/c8fo02506a. [DOI] [PubMed] [Google Scholar]
- 30.Zhang L, Liu J, Geng T. Ginkgetin aglycone attenuates the apoptosis and inflammation response through nuclear factor-κB signaling pathway in ischemic-reperfusion injury. J Cell Biochem. 2019;120:8078–85. doi: 10.1002/jcb.28086. [DOI] [PubMed] [Google Scholar]
- 31.Agashe RP, Lippman SM, Kurzrock R. JAK: Not just another kinase. Mol Cancer Ther. 2022;21:1757–64. doi: 10.1158/1535-7163.MCT-22-0323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wang X, Lupardus P, Laporte SL, et al. Structural biology of shared cytokine receptors. Ann Rev Immunol. 2009;27:29–60. doi: 10.1146/annurev.immunol.24.021605.090616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wallweber HJ, Tam C, Franke Y, et al. Structural basis of recognition of interferon-α receptor by tyrosine kinase 2. Nat Struct Mol Biol. 2014;21:443–48. doi: 10.1038/nsmb.2807. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
The rats were treated with different doses of ginkgetin.