Generation of CHOPi012-A iPSC line from a patient with visceral myopathy-related chronic intestinal pseudo-obstruction

Abstract

Visceral myopathies are debilitating conditions characterized by dysfunction of smooth muscle in visceral organs (bowel, bladder, and uterus). Individuals affected by visceral myopathy experience feeding difficulties, growth failure, life-threatening abdominal distension, and may depend on intravenous nutrition for survival. Unfortunately, our limited understanding of the pathophysiology of visceral myopathies means that current therapies remain supportive, with no mechanism-based treatments. We developed a patient-derived iPSC line with a c.769C>T p.R257C/+ mutation, the most common genetic cause of visceral myopathy. This cell line will facilitate studies of how the ACTG2 R257C heterozygous variant affects smooth muscle development and function.

Resource Table:

Unique stem cell line identifier	CHOPi012-A
Alternative name(s) of stem cell line	CHOPACTG2-R257C
Institution	Children’s Hospital of Philadelphia
Contact information of distributor	Deborah L. French, frenchd@chop.edu
Type of cell line	iPSC
Origin	Human
Additional origin info required for human ESC or iPSC	Age: 2 years Sex: Female Ethnicity if known: White
Cell Source	total PBMCs
Clonality	Clonal
Method of reprogramming	Sendai virus
Genetic Modification	N/A
Type of Genetic Modification	N/A
Evidence of the reprogramming transgene loss	N/A
Associated disease	Visceral myopathy
Gene/locus	ACTG2/c.769C>T
Date archived/stock date	November 2019
Cell line repository/bank	https://hpscreg.eu/cell-line/CHOPi012-A
Ethical approval	Children’s Hospital of Philadelphia, Committee for the Protection of Human Subjects (IRB), IRB 13-010357

Resource utility

This is the first patient-derived ACTG2 mutant iPSC line published. This mutation causes life-threatening visceral myopathy. This new cell line will facilitate mechanistic studies of how the ACTG2 R257C mutation affects smooth muscle cell function and development.

Resource Details

ACTG2 encodes gamma smooth muscle actin (actin gamma 2, smooth muscle), one of six actin isoforms, and the most abundant actin in visceral smooth muscle. Heterozygous point mutations in ACTG2 are the most common cause of visceral myopathy, a human genetic disorder characterized by bowel, bladder, and uterine smooth muscle weakness. The bowel manifestations are called myopathic chronic intestinal pseudo-obstruction (CIPO). The bladder disease is called myopathic bladder. The most severe form causes marked bowel and bladder dysfunction and reduced colon growth in utero, a disease called Megacystis Microcolon Intestinal Hypoperistalsis Syndrome (MMIHS). Symptoms include massive bowel dilation, vomiting, and inability to survive without at least intermittent intravenous nutrition. Myopathic bladder may need to be drained via a catheter. Unfortunately, current therapies are only supportive, with no mechanism-based treatments available. This new iPSC line will facilitate studies of disease mechanisms that could lead to new treatments or cures.

To generate the iPSC line, the four Yamanaka reprogramming factors (OCT3/4, SOX2, c-MYC, and KLF4) were transduced into human PMBCs by Sendai viral infection. Data represent one of three independent clones that were expanded and characterized (Table 1). Colonies were screened for characteristic morphology (Fig. 1A) and expression of intracellular (Fig. 1B) and extracellular (Fig. 1C) stemness markers. A normal karyotype was demonstrated by G-band analysis (Fig. 1D) and DNA fingerprinting by STR analysis confirmed the genetic authenticity of the line. The expected c.769C>T substitution for the ACTG2 R257C heterozygous mutation was confirmed by Sanger sequencing (Fig. 1E). The iPSCs tested negative for mycoplasma (Supp Fig. 1) and Sendai viral clearance was confirmed by qRT-PCR (Fig. 1F). Pluripotency was confirmed by directed differentiation to the three germ layers and analysis of surface markers by flow cytometry (Fig. 1G).

Table 2:

Reagents details

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Mouse anti-Oct3/4 (C-10)	1:200	Santa Cruz #sc-5297	RRID:AB_628051
	Rabbit anti-Nanog (D73G4)	1:400	Cell Signaling #4903S	RRID:AB_10559205
	Rabbit anti-Sox2 (D6D9)	1:50	Biolegend #330306	RRID:AB_1279440
	AF488 anti-human SSEA-3	1:400	Biolegend #330408	RRID:AB_1089200
	AF647 anti-human SSEA-4	1:100	Biolegend #330614	RRID:AB_2119064
	AF488 anti-human Tra-1-60	1:50	Biolegend #330706	RRID:AB_1089242
	AF647 anti-human Tra-1-81	1:50	Biolegend #301910	RRID:AB_493257
Differentiation Markers	PE Mouse anti-human Sox17	1:25	BD #561591	RRID:AB_10717121
	Mouse anti-human FoxA2	1:100	Santa Cruz #sc-101060	RRID:AB_1124660
	Rabbit anti-FOXG1	1:300	Abcam #196868	RRID:AB_2892604
	AF647 anti-human PAX6	1:20	BD #562249	RRID:AB_2644844
	Mouse anti-Hand1	1:200	Novus #NBP2-00576	RRID:AB_2877685
	CD144 APC	1:20	eBioscience #17-1449-42	RRID:AB_10804754
Secondary antibodies	Goat anti-mouse IgG2a-AF647	1:400	Jackson Immunoresearch #115-605-206	RRID:AB_2338917
	Goat anti-rabbit IgG-AF488	1:400	Jackson Immunoresearch #111-545-144	RRID: AB_2338052
	Goat anti-mouse IgG2b-AF488	1:400	Jackson Immunoresearch #115-545-207	RRID:AB_2338856
	Primers
	Target	Size of band	Forward/Reverse primer (5′–3′)
Sendai screening Taqman (qRT-PCR)	SEV	59 bp	Mr04269880_mr
	SEV-KLF4	67 bp	Mr04421256_mr
	SEV-KOS	80 bp	Mr04421257_mr
	SEV-cMYC	89 bp	Mr04269876_mr
	GAPDH	157 bp	Hs02786624_g1
Targeted mutation analysis/sequencing	ACTG2 exon 8 screen	387	GGGACAACCAAACTATCAGAGC/ CCCTTCCTAGGAAAATGTGAGG
	ACTG2 sequencing	N/A	GACATCAAGGAGAAGCTGTGC
Mycoplasma detection	16S Ribosomal RNA	518 bp	CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA
	GAPDH control	150 bp	GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT

Figure 1.

Characterization of CHOPi012-A iPSC line

Materials and Methods

Generation and culture of iPSCs

Peripheral blood mononuclear cells (PBMCs) from a patient with visceral myopathy were isolated and reprogrammed as previously described (Maguire et al, 2019). Briefly, cells were expanded in QBSF-60 supplemented with EPO (2 U/ml), SCF (50 ng/ml), IGF-1 (40 ng/ml), IL-3 (10 ng/ml), dexamethasone (1.5 μM), ascorbic acid (50 ng/ml), glutamine (1%), and penicillin/streptomycin (1%). Cells were transduced with Sendai viral vectors expressing Oct3/4, Sox2, Klf4, and cMyc (ThermoFisher), according to the manufacturers’ instructions, and plated on irradiated mouse embryonic fibroblasts (MEFs). Transduced cells were maintained in DMEM/F12 (80%) supplemented with knockout serum replacement (20%), glutamine (1%), non-essential amino acids (1%), penicillin/streptomycin (1%), beta-mercaptoethanol (0.1 mM), bFGF (10 ng/ml) at 37°C, 5% CO2, 5% O2, 90% N2. Medium was replenished every 2–3 days for 3–4 weeks until uniform colonies could be mechanically isolated for expansion on MEFs.

Flow cytometry and immunocytochemistry

TrypLE-dissociated single cells were analysed using a CytoFLEX flow cytometer (Beckman Coulter) and FlowJo software program (BD Biosciences). For cell surface stemness markers, cells were incubated with the appropriate antibody combinations for 15–30 minutes at room temperature. For intracellular markers, cells were permeabilized with saponin buffer and incubated with primary and secondary antibodies for 30 minutes at room temperature. Unstained samples were used as negative controls. Immunocytochemistry was performed as previously described (Maguire et al., 2019). Cells were imaged with a Leica DMI4000 B inverted fluorescent microscope.

Mutation verification

PCR amplification was performed on genomic DNA extracted with the Purelink Genomic DNA extraction kit (ThermoFisher) with the following parameters: 95 ◦C × 10 m, 35 cycles of 95 ◦C × 30 s/58 ◦C × 30 s/72 ◦C × 90 s, and 4 ◦C hold. Sequencing was performed by Genewiz.

STR and karyotype analyses

DNA fingerprinting and G-band analyses were performed by Cell Line Genetics. Twenty cells in metaphase were counted and 7 were analysed with a 500 G resolution reported as good.

Sendai clearance

Total RNA (Purelink RNA Micro kit, InVitrogen) was reverse transcribed using random hexamers with Superscript III Reverse Transcriptase (Life Technologies). qRT-PCR (LightCycler 480II, Roche) for the viral backbone, reprogramming factors (SEV, KLF4, KOS, cMyc), and GAPDH (control) was performed using the TaqMan Fast Advanced Master Mix (Applied Biosystems) with corresponding probes (Table 2).

Trilineage differentiation

For mesoderm and endoderm differentiation, cells were grown on MEFs and transitioned to feeder free conditions in mTeSR1 while cells grown in feeder free conditions were used for ectoderm differentiation. Mesoderm (Mills et al., 2014), endoderm (Mukherjee et al., 2021), and ectoderm (Dawicki-McKenna et al., 2023) differentiations were performed as previously described. Days of cell collection were day 4 for mesoderm, day 3 for endoderm, and day 8 for ectoderm.

Mycoplasma

PCR analysis for mycoplasma was performed as previously described (Maguire et al., 2019).

Table 1:

Characterization and validation

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Fig. 1A
Phenotype	Qualitative analysis by immunocytochemistry	Nuclear localization of OCT 3/4	Fig. 1B
	Quantitative analysis by flow cytometry	SSEA3/4: 99%, TRA160/181: 99%, NANOG 98%, OCT3/4 98%, SOX2 99%	Fig. 1B and 1C
Genotype	Karyotype (G-banding) and resolution	46XX, Resolution 500	Fig. 1D
Identity	Microsatellite PCR (mPCR) OR	N/A
	STR analysis	24 sites tested and match iPSC and PBMC	Submitted in archive with journal
Mutation analysis (IF APPLICABLE)	Sequencing	ACTG2 c.769C>T	Fig. 1E
	Southern Blot	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by RT-PCR. Negative	Supplementary Fig. 1
	Sendai virus	Sendai virus negative by qRT-PCR	Fig. 1F
Differentiation potential	Directed differentiation	Proof of three germ layer formation	Fig. 1G
List of recommended germ layer markers	Expression of these markers has to be demonstrated by protein levels using flow cytometry; at least 2 markers need to be shown per germ layer	Ectoderm: FOXG1,PAX6 Endoderm: SOX17, FOXA2 Mesoderm: HAND1, CD144	Fig. 1G
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A
	HLA tissue typing	N/A