ABSTRACT
Tuberculosis (TB) is a leading cause of death among infectious diseases worldwide due to latent TB infection, which is the critical step for the successful pathogenic cycle. In this stage, Mycobacterium tuberculosis resides inside the host in a dormant and antibiotic-tolerant state. Latent TB infection can also lead to multisystemic diseases because M. tuberculosis invades virtually all organs, including ocular tissues. Ocular tuberculosis (OTB) occurs when the dormant bacilli within the ocular tissues reactivate, originally seeded by hematogenous spread from pulmonary TB. Histological evidence suggests that retinal pigment epithelium (RPE) cells play a central role in immune privilege and in protection from antibiotic effects, making them an anatomical niche for invading M. tuberculosis. RPE cells exhibit high tolerance to environmental redox stresses, allowing phagocytosed M. tuberculosis bacilli to maintain viability in a dormant state. However, the microbiological and metabolic mechanisms determining the interaction between the RPE intracellular environment and phagocytosed M. tuberculosis are largely unknown. Here, liquid chromatography-mass spectrometry metabolomics were used to illuminate the metabolic state within RPE cells reprogrammed to harbor dormant M. tuberculosis bacilli and enhance antibiotic tolerance. Timely and accurate diagnosis as well as efficient chemotherapies are crucial in preventing the poor visual outcomes of OTB patients. Unfortunately, the efficacy of current methods is highly limited. Thus, the results will lead to propose a novel therapeutic option to synthetically kill the dormant M. tuberculosis inside the RPE cells by modulating the phenotypic state of M. tuberculosis and laying the foundation for a new, innovative regimen for treating OTB.
IMPORTANCE
Understanding the metabolic environment within the retinal pigment epithelium (RPE) cells altered by infection with Mycobacterium tuberculosis and mycobacterial dormancy is crucial to identify new therapeutic methods to cure ocular tuberculosis. The present study showed that RPE cellular metabolism is altered to foster intracellular M. tuberculosis to enter into the dormant and drug-tolerant state, thereby blunting the efficacy of anti-tuberculosis chemotherapy. RPE cells serve as an anatomical niche as the cells protect invading bacilli from antibiotic treatment. LC-MS metabolomics of RPE cells after co-treatment with H2O2 and M. tuberculosis infection showed that the intracellular environment within RPE cells is enriched with a greater level of oxidative stress. The antibiotic tolerance of intracellular M. tuberculosis within RPE cells can be restored by a metabolic manipulation strategy such as co-treatment of antibiotic with the most downstream glycolysis metabolite, phosphoenolpyruvate.
KEYWORDS: Mycobacterium tuberculosis, ocular tuberculosis, metabolomics, chemotherapy
INTRODUCTION
Tuberculosis (TB) is a global infectious disease with high mortality and morbidity caused by infection with Mycobacterium tuberculosis, primarily affecting the lungs—a condition known as pulmonary TB. M. tuberculosis can also affect other organs, leading to extrapulmonary TB, which accounts for approximately 16% of total TB cases reported annually (1, 2). Extrapulmonary TB can arise from either primary infection or secondary infection, where the pathogen spreads from the primarily affected organs (3). Secondary infections typically occur due to the hematogenous or lymphatic spread of M. tuberculosis bacilli from the lungs, which evades the host immune system or antibiotic effects by entering a dormant state (4, 5). The bacilli can become pathogenic through opportunistic reactivation (6). A significant challenge for an efficient control for extrapulmonary TB cases is the lack of proper diagnostic methods and treatment regimens. The World Health Organization recommends a 6-month 2RHZE-4RH regimen comprising rifampicin (R), isoniazid (H), pyrazinamide (Z), and ethambutol (E) for the initial 2 months, followed by RH for the subsequent 4 months (7, 8). The necessity for such an extended treatment course is primarily attributed to the well-documented mycobacterial dormancy and the high antibiotic tolerance associated with latent TB infection. Conventional TB chemotherapy struggles to eradicate the bacilli effectively, and thus, surviving bacilli can regrow when the antibiotic effects wane or when resistant mutants emerge. Consequently, there is a pressing need for the development of appropriate treatment strategies to combat the dormant M. tuberculosis bacilli present in the cases of extrapulmonary TB.
Ocular tuberculosis (OTB) represents a form of extrapulmonary TB that should never be underestimated if considering its potential to cause significant visual loss in affected patients (9–11). Similar to other extrapulmonary TB cases, OTB can arise from primary infection within the ocular tissues or more commonly as a secondary infection disseminated from the lungs via the bloodstream. OTB leads to inflammation of the uvea and retina, resulting in TB uveitis, which stands as the most prevalent manifestation of OTB and is a key contributor to ocular inflammatory diseases (9, 12, 13). Diagnosing OTB poses a formidable challenge, as the majority of OTB patients do not exhibit pulmonary TB symptoms, and established gold standards for investigations and diagnostic criteria are currently lacking. Furthermore, OTB is typically paucibacillary and hence is difficult to diagnose the cases through conventional methods like smear microscopy, culture, or PCR. Consequently, timely diagnosis of OTB is often significantly delayed, with diagnosis remaining presumptive. Therefore, there is an urgent need to enhance our understanding of OTB pathogenesis and the interaction between ocular tissues and invading M. tuberculosis to enable the development of innovative treatment strategies.
The retinal pigment epithelium (RPE) cells form a layer that lines the outer retina, separating the photoreceptors and neuroretina from the choroid and the systemic vasculature, thereby establishing the blood-retina barrier (14, 15). The vasculature at the choroid system carries high oxygen tension passing through the RPE layer toward the retina. As RPE cells harbor a large number of mitochondria, the mitochondrial complexes generate great levels of oxidative stress by producing superoxide, H2O2, and hydroxyl radical (16). The intrinsic environment within RPE cells is thus high in oxidative stress, and RPE cells have an important role in meeting the metabolic demand (17). The RPE cells play a crucial role in maintaining this barrier by serving as a physical lining through tight junctions. They facilitate the diffusion and transport of nutrients between the systemic circulation and the retina, while also regulating local immune system activity through the release of inflammatory cytokines (18–20). Essentially, RPE cells are responsible for the immune privilege of ocular tissues, making them a primary niche where invading pathogens reside. Indeed, previous studies investigating the cases of OTB uveitis have indicated that M. tuberculosis mostly localizes within the RPE cells followed by pathogenic reactivation often when the host’s immune system is compromised (11, 21–23). This finding underscores the significance of RPE cells in the pathogenesis of OTB and highlights their involvement in the disease progress.
The present study investigated the metabolic and biochemical states of the RPE intracellular environment that induce invading M. tuberculosis bacilli to enter a dormant and antibiotic-tolerant state. To explore the causality, liquid chromatography-mass spectrometry (LC-MS) metabolomics and qRT-PCR were employed to track the metabolic changes specific to RPE cells in response to environmental redox stresses and M. tuberculosis infection. Additionally, we also revealed that mycobacterial dormancy is linked to a heightened level of antibiotic tolerance against key first-line TB antibiotics. The findings of this study laid the groundwork for developing a novel treatment approach by modulating the intracellular metabolic state of M. tuberculosis through co-administration of phosphoenolpyruvate (PEP), the most downstream glycolysis intermediate of M. tuberculosis, along with known TB antibiotics. Treatment with PEP was shown to prevent the induction of M. tuberculosis dormancy within RPE cells, synthetically improving antibiotic susceptibility. This study not only elucidates the mechanistic underpinnings of RPE cellular metabolic remodeling in mediating mycobacterial dormancy but also introduces a fresh strategy for enhancing the efficacy of OTB treatment.
RESULTS AND DISCUSSION
Establishment of an in vitro RPE culture model to form dormant M. tuberculosis infection
A zebrafish model infected with red-fluorescent Mycobacterium marinum enabled intravital visualization of host-pathogen interactions (24). The bacilli were observed within the RPE cells. RPE cells represent a physiological niche where M. tuberculosis bacilli reside in a dormant state (22, 25). Despite the intensive studies, there is still a significant gap of knowledge regarding how intracellular M. tuberculosis bacilli maintain viability in a dormant state, and this mycobacterial dormancy in OTB cases is associated with antibiotic tolerance. To investigate this, we established an ex vivo RPE culture system under oxidative stress induced by treatment with H2O2. This system mimicked the physiological intracellular environment associated with mycobacterial dormancy. H2O2 is a well-known natural source of reactive oxygen species (ROS) within bacterial pathogens (26–28). Given that the RPE cellular layer serves as a frontline defense mechanism against the high redox stresses from hematogenous ROS, we hypothesized that intracellular M. tuberculosis bacilli within RPE cells encounter high levels of oxidative stress, leading to the induction of mycobacterial dormancy. To test the hypothesis, we utilized H2O2 as a source of oxidative stress and investigated a range of H2O2 concentrations optimal for mimicking physiological intracellular stress levels in RPE cultures post-infection with H37Ra bacilli at a multiplicity of infection (MOI) of 10:1 (29). We monitored bacterial growth kinetics by counting colony-forming units (CFU). Under a resting condition without H2O2 treatment, intracellular H37Ra inside RPE cells replicates at a rate similar to that in THP-1 macrophages for initial 5 days, albeit a significantly longer lag phase (Fig. 1A). Treatment with increasing doses of H2O2 progressively slowed down the replication rates of H37Ra within RPE cells up to 100 µM, with minimal impact on bacterial growth within THP-1 macrophages or under an in vitro condition (Fig. 1A; S1A). The growth kinetics revealed that the mycobacterial dormancy state in the RPE cells needs the environmental redox stresses, and the redox stress levels within RPE cells in response to the same H2O2 concentrations were significantly greater than those in THP-1 macrophages.
Fig 1.
Mycobacterial dormancy in RPE cells after exposing to the environmental redox stress. (A) CFU viability of intracellular H37Ra following infection of RPE cells or THP-1 macrophages with the treatment of 50 or 100 µM H2O2. (B) The effect of additional supplementation with 10 mM thiourea on CFU viability of H37Ra following treatment with 50 µM H2O2. Data points show the average of experimental triplicates ± SEM. **, P < 0.05 by Student’s t test.
To further examine if the slowed H37Ra replication was attributed to the greater levels of redox stresses arising from environmental ROS, we measured the amount of ROS biosynthesized by either RPE cells or THP-1 macrophages after treatment with the same concentrations, 50 or 100 µM, of H2O2. Notably, ROS levels in the RPE cells significantly increased after day 2 post-treatment with H2O2, while no increase of ROS in the THP-1 macrophages was observed (Fig. S1B). The induced ROS level was not associated with loss of RPE cell viability (Fig. S1A, right panel). Furthermore, the slowed replication rate of intracellular H37Ra within RPE cells was nearly fully restored by the treatment with 10 mM thiourea, a chemical known as an antioxidant, becoming the growth rate at a level similar to that observed in THP-1 macrophages (Fig. S1C). Thus, in vitro RPE cell culture treated with 50 µM H2O2 was the condition that successfully generated the mycobacterial dormancy similar to the physiological condition frequently observed in OTB cases.
Mycobacterial dormancy within the in vitro RPE culture system
Since dormant M. tuberculosis bacilli are known to accumulate triacylglycerol (TAG) at the cell wall as a critical indicator of mycobacterial dormancy (30–32) (Fig. 2A), we used our in vitro RPE culture system to collect H37Ra bacilli under a dormant state and extracted mRNA. The intracellular H37Ra in the THP-1 macrophages after treatment with 50 µM H2O2 was included as a control. First, we monitored the expression levels of M. tuberculosis genes such as DosR, lat, and tgs1 which were known to be responsive to mycobacterial dormancy (31, 33, 34). Indeed, their expression was significantly induced in intracellular H37Ra residing in H2O2-treated RPE cells, which was not clear in H2O2 treated THP-1 macrophages (Fig. 2B). The qRT-PCR result, growth kinetics, and ROS levels collectively indicated that H37Ra phenotypic dormancy in the H2O2-treated RPE cells was largely attributed to the greater level of redox stress within RPE cells than that of THP-1 macrophages. As we observed that DosR expression was induced under mycobacterial dormancy within the RPE cell culture system, we monitored 20 selected DosR regulon genes at days 1 and 3 after H37Ra infection (35, 36). As expected, the foregoing DosR regulon gene expression in RPE cells was significantly induced and kinetically matched to that of DosR, lat, and tgs1, but their responses became clearer at day 3 after H37Ra infection (Fig. 2C; Fig. S2C). Consistent with induced tgs1 expression, we also observed a greater accumulation of TAG at M. tuberculosis cell wall during residing inside the RPE cells than that of THP-1 macrophages (Fig. 2A).
Fig 2.
Metabolic evidence indicating the mycobacterial dormancy in the RPE cells. (A) Accumulation of TAG at M. tuberculosis cell wall was monitored after phagocytosed by RPE cells or THP-1 macrophages. (B) Intracellular H37Ra mRNA transcript levels of dormancy and persistence-associated genes following infection of RPE cells (black) or THP-1 macrophages (gray) and treatment with 0, 50, or 100 µM H2O2 for 1 day. (C) Heatmap depicting the mRNA transcripts of randomly selected DosR regulon genes following infection of RPE cells or THP-1 macrophages with 50 µM H2O2 treatment for 3 days. **, P < 0.05; ns, not significant by Student’s t test.
Previous studies showed that host immune cells were immunometabolically blunted to respond to the latent TB infection as M. tuberculosis in a dormant state significantly repopulates the glycolipids, especially ligands functioning as a pathogen-associated molecular pattern (37–40). As RPE cells are the main source to secrete inflammatory cytokines in the retina to build up the intraocular immune environment, we monitored the expression levels of proinflammatory cytokine genes such as il6 and tnfα in the H2O2-treated RPE cells or THP-1 macrophages after infection with H37Ra. We observed greater induction of il6 and tnfα expression in THP-1 macrophages infected with H37Ra than that of RPE cells, supporting our speculation that M. tuberculosis bacilli reside in RPE cells prevented from hyperactivation of proinflammatory response of host ocular immune system due to their phenotypic dormancy (Fig. S2A and B). Intriguingly, H2O2 treatment alone was not sufficient to induce the expression of these cytokines from both cell types, confirming the critical role of mycobacterial dormancy in the interaction between host and pathogen for the M. tuberculosis survival benefit during mycobacterial dormancy.
Metabolomics profile of H2O2-treated RPE cells for the dormant M. tuberculosis infection
To understand the mechanistic bases of H2O2-treated RPE intracellular milieu behind the mycobacterial dormancy, we set out to identify metabolic states of RPE cells altered by H2O2 treatment and/or H37Ra infection using LC-MS metabolomics (41, 42). H2O2-treated THP-1 macrophages with or without H37Ra infection were included as controls. The metabolic changes were determined by comparing the abundance of approximately 430 metabolites of RPE cells and THP-1 macrophages selected from the Metlin database (http://metlin.scripps.edu) with those of conditions with neither H2O2 treatment nor H37Ra infection (43). Since metabolome extraction was conducted without the step to separate intracellular H37Ra from the host cells, the detected metabolites could be from the host and/or pathogen. Using Metaboanalyst v5.0, multivariate unbiased clustering analyses identified a subset of metabolites and mapped annotated pathways. The pathway mapping analysis revealed that glutamate metabolism, amino acid metabolism (e.g., alanine, aspartate, ornithine, proline, and aromatic amino acids), urea cycle, and antioxidant metabolism pathways were upregulated when RPE cells were co-stimulated with H2O2 and H37Ra infection. Reciprocally, β-alanine, arginine, and histidine metabolism pathways were downregulated as compared to those in RPE cells in a resting condition (Fig. S3A through C). The untargeted metabolomics profiles and principal component analysis (PCA) suggested that treatment with 50 µM H2O2 alone was not sufficient to alter the metabolic networks of RPE cells (Fig. S4A), but additional H37Ra infection profoundly changed the RPE and THP-1 cellular metabolic networks (Fig. 3A and B; Fig.S4B). The targeted lipidomics profiles and PCA, based upon a database containing intermediates in fatty acid metabolism, cholesterol metabolism, and other lipid metabolism pathways, matched the conclusions drawn from the untargeted metabolomics analysis (Fig. S5A and B). Intriguingly, the metabolic networks of THP-1 macrophages between days 1 and 3 after H37Ra infection were not clearly different, indicating that the RPE cells at day 1 and THP-1 metabolic states at both days 1 and 3 were not sufficient to confer the mycobacterial dormancy.
Fig 3.
Intracellular metabolic state of RPE cells after co-treatment with H2O2 and H37Ra infection. (A and B) PCA of the metabolome profiles of infected RPE cells (A) and THP-1 macrophages (B) with or without treatment with 50 µM H2O2. Metabolites were collected at days 0, 1, and 3 post-infection. Pink spheres, triplicate samples of cells before infection or treatment with H2O2. Dark and light blue spheres, infected cells at days 1 and 3 post-infection, respectively. Red and green spheres, infected cells treated with H2O2 at days 1 and 3 post-infection, respectively. (C) Metabolite abundance of RPE cells and THP-1 macrophages treated with 50 µM H2O2 for 3 days. Bars are representative of triplicate samples and show average fold change relative to those at day 0. (D) Glutathione abundance in infected RPE cells following treatment with 50 µM H2O2 and supplementation of 10 mM PEP or thiourea. Data points show the average of experimental triplicates ± SEM. **, P < 0.05 by Student’s t test.
H2O2-treated RPE metabolic networks were continuously altered as the duration of H37Ra infection time was undergone. However, H2O2-treated THP-1 metabolic networks were not further altered even after additional stimulation with H37Ra infection (Fig. 3A and B; Fig. S4C). The PCAs indicated that H2O2-treated RPE metabolic networks at day 3 after H37Ra infection were important metabolic activities required to trigger the formation of a dormant H37Ra phenotypic state. Indeed, the metabolic networks included the enhanced abundance of metabolites involved in the antioxidant metabolism pathways such as glutathione, glutamate metabolism intermediates, glutamyl cysteine, cysteine, glycine, and GSH(Glutathione) disulfide, whose changes were not clear in RPE cells at day 1 after H37Ra infection or THP-1 cells at both days (Fig. 3C and D; Fig. S4D). The induced abundances of antioxidant metabolism pathway intermediates were fully restored by co-treatment with 10 mM thiourea (Fig. S4D). Intracellular ROS level in H2O2-treated RPE cells was reduced by treatment with 10 mM thiourea, corroborating with the mycobacterial dormancy and growth kinetics (Fig. 1B; Fig. S1B). Collectively, these findings suggested that redox stresses of H2O2-treated RPE cells were significantly enhanced by M. tuberculosis infection at and after day 3, and the intracellular metabolic environment was sufficient to lead M. tuberculosis bacilli to enter a dormant state. These findings were also supported by qRT-PCR results of H2O2-treated RPE cells at day 3 after H37Ra infection and intracellular H37Ra growth kinetics (Fig. 1A, 2B and C).
Antibiotic tolerance of intracellular M. tuberculosis within RPE cells was restored by co-treatment with phosphoenolpyruvate
The mycobacterial dormancy is in most cases accompanied by a high level of antibiotic tolerance against clinically important TB antibiotics such as isoniazid (INH) and rifampicin (RIF) (1, 27, 38, 44). We monitored the antibiotic sensitivity of intracellular H37Ra within H2O2-treated RPE cells against 5× (minimal inhibitory concentration) MIC-equivalent INH or RIF for a week. Treatment with RIF initially killed the bacilli within RPE cells and THP-1 macrophages by approximately 1.5 log10 CFU during the first 2 days. While the viable number of H37Ra within THP-1 macrophages continued to decrease, the viability of H37Ra within RPE cells was maintained after day 2 post treatment with RIF until day 7 (Fig. 4A, left panel). A greater level of antibiotic tolerance of H37Ra in the RPE cells than that of THP-1 macrophages was also observed after treatment with 5× MIC-equivalent INH (Fig. 4A, right panel). The greater antibiotic tolerance of H37Ra residing in the H2O2-treated RPE cells seemed to be largely due to its phenotypic dormancy induced by RPE intracellular redox stresses.
Fig 4.
Antibiotic tolerance of intracellular M. tuberculosis and its synthetic lethality. (A) CFU viability of intracellular H37Ra within RPE cells or THP-1 macrophages following co-treatment with 50 µM H2O2 and 5× MIC-equivalent RIF (left panel) or INH (right panel). (B) The effect of supplementing with 10 mM PEP on the CFU viability of intracellular H37Ra following exposure to 5× MIC-equivalent RIF or INH. ***, P < 0.001 by ANOVA.
We recently studied the semi-untargeted metabolomics profile of H37Rv phenotypic dormancy during adaptation to hypoxia and showed that central carbon metabolism pathways including glycolysis, TCA (tricarboxylic acid) cycle, and pyruvate metabolism pathways were highly altered in dormant H37Rv bacilli (37, 45, 46). Targeted metabolomics analysis showed a nearly complete depletion of PEP, the most downstream metabolite in the M. tuberculosis glycolysis. Exogenous supplementation with PEP significantly recovered the hypoxic M. tuberculosis growth compared to that without PEP, thereby improving antibiotic susceptibility to first-line TB antibiotics, INH and RIF. Thus, we first tested if treatment with PEP to H2O2-treated RPE cells prevented intracellular H37Ra within the cells from entering to a dormant state. Consistent with previous reports, supplementation with PEP significantly improved the growth rates of intracellular H37Ra within H2O2-treated RPE cells (Fig. S6A), indicating that externally supplemented PEP accessed the intracellular H37Ra and modulated its growth kinetics and metabolic activities. The growth restored by PEP supplementation was not by altering RPE metabolic networks but by directly modulating H37Ra bacterial metabolic networks (Fig. S6B). We next observed that intracellular H37Ra within H2O2-treated RPE cells was synthetically lethal to 5× MIC-equivalent RIF by co-treatment with 10 mM PEP, resulting in restoring the RIF-mediated bactericidal effect to a level similar to that of intracellular H37Ra within H2O2-treated THP-1 macrophages or RPE cells in a resting condition (Fig. 4A and B). The PEP-mediated improved antibiotic susceptibility of H37Ra residing in H2O2-treated RPE cells indicated that mycobacterial dormancy of M. tuberculosis within ocular tissues was associated with its metabolic adaptation and can be restored by reverse metabolic modulation by co-treatment with PEP. The metabolic modulation strategy has been intensively studied (45, 47–50) and thus considered a potential method in designing novel TB antibiotic regimen to overcome mycobacterial dormancy-mediated antibiotic tolerance often observed in OTB cases. We also tested the foregoing PEP-mediated synthetic antibacterial effects using Linage 2 W-Beijing HN878, a clinical strain known to harbor the highest risk of developing MDR (multidrug resistance) cases worldwide (51, 52). We observed that intracellular HN878 within H2O2-treated RPE cells was tolerant to RIF treatment, but the RIF sensitivity was significantly improved by co-treatment with 10 mM PEP (Fig. S7). This therapeutic strategy should be efficient to treat OTB patients as the drug delivery toward the site of infection may be much convenient compared to that within the pulmonary organs. Recent studies identified that RPE cells serve as a major niche that phagocytoses invading Mtb bacilli in OTB cases and the Mtb bacilli reside in a dormant and drug-tolerant state (22). Our result collectively provides the metabolic and biochemical bases why intracellular Mtb bacilli within RPE cells maintain the phenotypic dormancy and high levels of antibiotic tolerance. This study will be a great opportunity for mass eradication of M. tuberculosis infection in the ocular tissues by synthetically waking up the dormant M. tuberculosis bacilli.
MATERIALS AND METHODS
Bacterial strains, culture conditions, and chemicals
M. tuberculosis lineage 2 W-Beijing HN878 was cultured in a biosafety level 3 facility, and H37Ra was cultured in a biosafety level 2+ facility at 37°C in Middlebrook 7H9 broth (m7H9) or on Middlebrook 7H10 agar (m7H10; Difco) supplemented with 0.2% glucose, 0.04% tyloxapol (broth only), 0.5 g/L BSA (Bovine Serum Albumin), and 0.085% NaCl. We have complied with all relevant ethical regulation for work with M. tuberculosis clinical strains such as HN878.
PPE and THP-1 cell cultures
Human fetal RPE cells were purchased from ATCC. Passage 2 cells were transferred to 75 mL flasks and grown in confluence in Dulbecco Modified Eagle Medium (DMEM; Lonza BioWhittaker) containing 10% heat-inactivated fetal bovine serum (Gibco, Life Technologies), l-glutamine (1 mM), hydroxyethyl piperazineethanesulfonic acid buffer (10 mM), and penicillin G sodium and streptomycin sulfate (50 U/mL). For both RPE and THP-1 cells, the medium was changed twice each week. During the medium change, the cell cultures were evaluated by phase-contrast microscopy using trypan blue, and the number of nonviable cells was less than 5% in all experiments before M. tuberculosis was infected. The cells were transferred into 96-, 12-, or 6-well plates for intracellular M. tuberculosis load analysis.
Acute monocytic leukemia cell line (THP-1) was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% heat-inactivated fetal bovine serum and penicillin G sodium and streptomycin sulfate (50 U/mL). Adhesion of THP-1 to culture plates was attained by adding 20 ng/mL of phorbol 12-myristate 13 acetate (PMA) to each well. The slide or the plates were washed with PBS (Phosphate Buffered Saline) (37°C) twice before seeding. The THP-1 cells were plated in 96-, 12-, or 6-well plates; they were left still for 12 hours overnight with PMA-containing medium and then washed with 37°C PBS to remove nonadherent cells. The THP-1 cells were evaluated daily for morphologic changes, including cytoplasmic projections.
Mtb H37Ra or HN878 infection
The H37Ra or HN878 was cultured in Middlebrook 7H9 broth (BD Biosciences) to mid-logarithmic phase (optical density approximately 0.5). The culture was then pelleted, resuspended in an equal volume of PBS, and centrifuged at 800 RPM for 12 minutes to generate a single-cell suspension. One milliliter of aliquots containing 5 × 107 cells/mL was stored at –80°C until the morning of infection. RPE and THP-1 cell cultures were seeded at a density of 1 × 105 cells/well in a 96-well plate and were infected with an MOI of 10:1. After a 4-hour exposure of cells to M. tuberculosis, the attached cells in the culture wells were washed with culture medium to remove nonadherent Mtb. A complete medium (DMEM for RPE and RPMI1640 for THP-1) containing gentamycin (25 µg/mL) was then added to the culture wells for 24 hours to kill the remaining extracellular Mtb attached to the cell surface. At this time and beyond, the medium was replaced with an antibiotic-free medium.
Cell viability assessment
Cells were seeded at a density of 5 × 105 cells/well in a 24-well plate and allowed to adhere for 24 hours. They were then washed twice with 37°C PBS to remove non-adherent cells, and a complete medium containing H2O2 (0–150 µM) was added to the culture wells for 24 hours. Cell supernatants were collected, and the number of viable cells was counted by phase-contrast microscopy using trypan blue exclusion.
Ex vivo CFU enumeration assay
Enumeration of viable intracellular Mtb was accomplished by lysing infected cells with 100 µL 0.5% Triton X-100. After incubation at 37°C for 5 minutes, cell lysates were harvested, and released bacilli were enumerated by plating serial dilutions of the lysate on m7H10 agar. All cultures were performed in triplicate. Agar plates were cultivated in a 37°C humidified incubator with 5% CO2 for 3–4 weeks before determining the CFU.
In vitro CFU enumeration assay
Mtb viability was determined using liquid cultures manipulated under experimentally identical conditions for metabolomics and qRT-PCR profiling, which we previously demonstrated to be microbiologically similar. CFUs were determined by plating serial dilutions on m7H10 after incubating for at least 3–4 weeks at 37°C. CFU enumeration assays were conducted in two independent triplicates.
Metabolite extraction for LC-MS analysis
Cells were seeded at a density of 5 × 105 cells in a 6-well plate and allowed to adhere for 24 hours. Cells were then infected as described previously, and culture media was replaced with complete media containing H2O2 (50 µM), PEP (10 mM), or thiourea (10 mM) as needed. Metabolites were extracted at 1 or 3 days post-infection (43, 53). Cells were washed three times with PBS and metabolically quenched with 500 µL ice-cold 40:40:20 (acetonitrile:methanol:water). Adherent cells were mechanically detached, and metabolites were extracted by lysis with 0.1 mm zirconia beads in a Precellys tissue homogenizer for 1 minute under continuous cooling at or below 2°C. Lysates were clarified by centrifugation, and the residual protein content of metabolite extracts was determined (BCA protein assay kit, Thermo Scientific) to normalize the samples to cell biomass.
LC-MS for metabolomics profiling
LC-MS differentiation and detection of each metabolite were performed with an Agilent Accurate Mass 6230 TOF coupled with an Agilent 1290 Liquid Chromatography system using a Cogent Diamond Hydride Type C column (Microsolv Technologies, Long Branch, NJ, USA) with solvents and configuration as previously described (38, 46). An isocratic pump was used for continuous infusion of a reference mass solution to allow mass axis calibration. Detected ions were classified as metabolites based on unique accurate mass-retention time identifiers for masses showing the expected distribution of accompanying isotopologues. Metabolites were analyzed using Agilent Qualitative Analysis B.07.00 and Profinder B.07.00 software (Agilent Technologies, Santa Clara, CA, USA) with a mass tolerance of <0.005 Da. Standards of authentic chemicals of known amounts were mixed with bacterial lysates and analyzed to generate the standard curves used to quantify metabolite levels. All data obtained by metabolomics profiling were the average of at least two independent triplicates. Bioinformatics analysis was carried out using MetaboAnalyst v5.0 (www.metaboanalyst.ca), which is a web-based available software for processing metabolomics data, and pathway mapping was performed on the basis of annotated human metabolic pathways available in the Kyoto Encyclopedia of Genes and Genomes pathway database. Metabolomics data were analyzed by statistical analysis. The clustered heatmap and hierarchical clustering trees were generated using Cluster 3.0 and Java Tree View 1.0. A univariate statistical analysis involving an unpaired t test was used to identify significant differences in the abundance of metabolites between each group.
RNA extraction and qRT-PCR
Cells were seeded at a density of 1 × 105 cells/well in a 12-well plate and infected as previously described (54). Total RNA from Mtb-infected RPE or THP-1 cells was extracted using TRIzol Reagent (Sigma-Aldrich) and mechanical lysing with 0.1 mm zirconia beads in a Percellys tissue homogenizer. Lysates were clarified by centrifugation, and TRIzol supernatant was removed and used for RNA extraction. RNA was isolated using a Qiagen RNA extraction kit. RNA concentrations were determined using a Nanodrop, and qRT-PCR was performed using an iQ SYBR-Green Supermix (Bio-Rad) and Mastercycler ep Realplex 2 (Eppendorf). Data were normalized by GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) or sigA expression level, and all primers were designed using GenScript primer design software. All primers and sequences are available in Table 1.
TABLE 1.
qRT-PCR primers and sequences
| Forward | Reverse | |
|---|---|---|
| DosR | CCGAATGTTCCTAGCCGAAA | TTCAACTCCGTCGCGAATAC |
| lat | CTGGACATAGTGCTCGATCTG | AGGAGGCAACGAATGTGAA |
| tgs1 | GGGTTTCTCAAGGCAGAAGA | GTTGAGCGAGCGACGATAA |
| Rv0079 | AAACCGGTCGTGCTAAGG | GAACAAATGCACGTCGTAGTC |
| Rv0080 | GAAGCCGACGACCTTGAT | GGTGTCCATCGCCATGTT |
| Rv0081 | CGTTCGGTCGGTGAGTTG | GGTGCGGCAATCGAATAGA |
| Rv0082 | GGGTGTGAGGTGGAGATTT | GTCACCAACAACGCATCG |
| Rv0083 | CACGTCCGCGCTGTATG | CATGTTCTCGGTCGTCGAATAG |
| Rv0569 | GACCACCGAGGGTTGATTATT | GAATCACCGTCGCCACAT |
| Rv0570 | TGTTTCTCGACACGATCAATAGG | GCCGAGATTACATGACTCGTAAG |
| Rv0571 | GGTTTGCGACGCTGTTATTC | AAGCGAGCAGCTCAATGT |
| Rv0572 | CGCGGATTCTGGTCTTCAC | TTGCCGTCCTGGAAGTAGTA |
| Rv0574 | CGGATGCACCCGGATAAC | TGGTAGCCGAAATCGAGAATG |
| Rv1733 | GTGATCGACAGCAACACGA | TCACCGCTGCGTTCTATTC |
| Rv1734 | GTCATGACGACCGTGCT | CGCGTCAGCTCGTTGAT |
| Rv1736 | TGCACACCATCTCCACATAC | CCGATTAGCTCCACGAACC |
| Rv1737 | CTTCGTGATGCACCCTACTT | CGCGTACAGAAACGACATCT |
| Rv1738 | AAGGAATTGGTGGGTGTTGG | ACCTTCAACATTCGCTTCCC |
| Rv1812 | CTTCGGATCCCTTGGTATGTC | GCCCTGCGATACCACTTT |
| Rv1813 | CAGAGCAAGTCGCACTAGAAA | TGGTATTTCGAGCCGTTGTAG |
| Rv1996 | CGAATGGAGAAACCTCGAAGA | ATCGCACACCACGACTTT |
| Rv2623 | CCACGGTCCACAGTGAAAT | GACAACCCACGACCATCAG |
| SigA | ACGAAGACCACGAAGACCTCGAA | GTAGGCGCGAACCGAGTCGGCGG |
| il-6 | AAGCCAGAGCTGTGCAGATGAGTA | TGTCCTGCAGCCACTGGTTC |
| tnfα | CCCAGGGACCTCTCTCTAATC | ATGGGCTACAGGCTTGTCACT |
| gapdh | GTGGTCTCCTCTGACTTCAACA | CTCTTCCTCTTGTGCTCTTGCT |
| DosR | CCGAATGTTCCTAGCCGAAA | TTCAACTCCGTCGCGAATAC |
ROS measurement
Intracellular ROS of RPE and THP-1 cells was determined by previously established protocols (45, 55). The ROS was monitored by measuring the changes in the florescence of the ROS-sensitive fluorophore H2DCF-DA. Cells were initially seeded at a density of 1 × 106 cells/mL in a 12-well plate and then treated with various concentrations of H2O2. After incubating at 37°C for 0, 1, and 3 days, 10 µM of H2DCF-DA dye was added and incubated at 37°C for an additional 30 min. The fluorescence was measured by a microplate reader at 485/535 nm. After measuring the ROS values, the amount was normalized to the total number of cells and expressed relative to those at day 0.
TAG staining and flow cytometry assay
M. tuberculosis cells, recovered from RPE cells or THP-1 macrophages following treatment with H2O2 for 1 or 3 days, were concentrated by centrifugation and stained with Auramine-O and Nile Red at 1:100 dilution from a stock of 100 µg/mL in methanol. Cells were mixed and incubated for 15 min in the dark being inverted every 3 min for mixing. Cells were washed with PBS twice, and labeling intensity was monitored by Invitrogen Attune Flow Cytometer (31).
Statistical analysis
All experiments including metabolomics and qRT-PCR were conducted in triplicate and repeated at least two times unless otherwise described. The results shown represented mean ± SEM. Statistical analyses were conducted Prism software (GraphPad 9). To determine statistical significance, we employed two-tailed unpaired Student’s t tests for comparing two groups and ANOVA tests for comparing more than two groups. We considered P < 0.05 statistically significant.
Supplementary Material
ACKNOWLEDGMENTS
We thank all members of Hyungjin Eoh lab members for their help throughout the work described in this report. This work was supported by NIH grant R01 AI168088.
R.L., L.R., and E.H. designed research studies. R.L., D.J.N., L.R., and L.J.J. conducted experiments. R.L., D.J.N., L.R., and E.H. analyzed data. K.N. and A.H. provided materials. R.L., D.J.N., R.N., and E.H. wrote the manuscript.
Contributor Information
Hyungjin Eoh, Email: heoh@usc.edu.
Prabagaran Narayanasamy, University of Nebraska Medical Center, Omaha, Nebraska, USA.
DATA AVAILABILITY
All data generated or analyzed during this study are included in this published article and its supplemented files. The metabolomics raw datasets were deposited in MetaboLights. The accession number is MTBLS9841.
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/spectrum.00788-24.
Fig. S1 to S7.
An accounting of the reviewer comments and feedback.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Gold B, Nathan C. 2017. Targeting phenotypically tolerant Mycobacterium tuberculosis. Microbiol Spectr 5. doi: 10.1128/microbiolspec.TBTB2-0031-2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Nathan C. 2009. Taming tuberculosis: a challenge for science and society. Cell Host Microbe 5:220–224. doi: 10.1016/j.chom.2009.02.004 [DOI] [PubMed] [Google Scholar]
- 3. Sharma SK, Mohan A. 2004. Extrapulmonary tuberculosis. Indian J Med Res 120:316–353. [Google Scholar]
- 4. Golden MP, Vikram HR. 2005. Extrapulmonary tuberculosis: an overview. Am Fam Physician 72:1761–1768. [PubMed] [Google Scholar]
- 5. Moule MG, Cirillo JD. 2020. Mycobacterium tuberculosis dissemination plays a critical role in pathogenesis. Front Cell Infect Microbiol 10:65. doi: 10.3389/fcimb.2020.00065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Flynn JL, Chan J. 2001. Tuberculosis: latency and reactivation. Infect Immun 69:4195–4201. doi: 10.1128/IAI.69.7.4195-4201.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Norval PY, Blomberg B, Kitler ME, Dye C, Spinaci S. 1999. Estimate of the global market for rifampicin-containing fixed-dose combination tablets. Int J Tuberc Lung Dis 3:S292–300. [PubMed] [Google Scholar]
- 8. Eoh H, Liu R, Lim J, Lee JJ, Sell P. 2022. Central carbon metabolism remodeling as a mechanism to develop drug tolerance and drug resistance in Mycobacterium tuberculosis. Front Cell Infect Microbiol 12:958240. doi: 10.3389/fcimb.2022.958240 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Albert DM, Raven ML. 2016. Ocular tuberculosis. Microbiol Spectr 4. doi: 10.1128/microbiolspec.TNMI7-0001-2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Ang M, Chee SP. 2017. Controversies in ocular tuberculosis. Br J Ophthalmol 101:6–9. doi: 10.1136/bjophthalmol-2016-309531 [DOI] [PubMed] [Google Scholar]
- 11. Basu S, Elkington P, Rao NA. 2020. Pathogenesis of ocular tuberculosis: new observations and future directions. Tuberculosis (Edinb) 124:101961. doi: 10.1016/j.tube.2020.101961 [DOI] [PubMed] [Google Scholar]
- 12. Shakarchi FI. 2015. Ocular tuberculosis: current perspectives. Clin Ophthalmol 9:2223–2227. doi: 10.2147/OPTH.S65254 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Teixeira-Lopes F, Alfarroba S, Dinis A, Gomes MC, Tavares A. 2018. Ocular tuberculosis - a closer look to an increasing reality. Pulmonology 24:289–293. doi: 10.1016/j.pulmoe.2018.02.006 [DOI] [PubMed] [Google Scholar]
- 14. Mrugacz M, Bryl A, Zorena K. 2021. Retinal vascular endothelial cell dysfunction and neuroretinal degeneration in diabetic patients. J Clin Med 10:458. doi: 10.3390/jcm10030458 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Raviola G. 1977. The structural basis of the blood-ocular barriers. Exp Eye Res 25 Suppl:27–63. doi: 10.1016/s0014-4835(77)80009-2 [DOI] [PubMed] [Google Scholar]
- 16. Datta S, Cano M, Ebrahimi K, Wang L, Handa JT. 2017. The impact of oxidative stress and inflammation on RPE degeneration in non-neovascular AMD. Prog Retin Eye Res 60:201–218. doi: 10.1016/j.preteyeres.2017.03.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Brown EE, DeWeerd AJ, Ildefonso CJ, Lewin AS, Ash JD. 2019. Mitochondrial oxidative stress in the retinal pigment epithelium (RPE) led to metabolic dysfunction in both the RPE and retinal photoreceptors. Redox Biol 24:101201. doi: 10.1016/j.redox.2019.101201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Kaur C, Foulds WS, Ling EA. 2008. Blood-retinal barrier in hypoxic ischaemic conditions: basic concepts, clinical features and management. Prog Retin Eye Res 27:622–647. doi: 10.1016/j.preteyeres.2008.09.003 [DOI] [PubMed] [Google Scholar]
- 19. Mölzer C, Heissigerova J, Wilson HM, Kuffova L, Forrester JV. 2020. Immune privilege: the microbiome and uveitis. Front Immunol 11:608377. doi: 10.3389/fimmu.2020.608377 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Holtkamp GM, Kijlstra A, Peek R, de Vos AF. 2001. Retinal pigment epithelium-immune system interactions: cytokine production and cytokine-induced changes. Prog Retin Eye Res 20:29–48. doi: 10.1016/s1350-9462(00)00017-3 [DOI] [PubMed] [Google Scholar]
- 21. Bansal R, Basu S, Gupta A, Rao N, Invernizzi A, Kramer M. 2017. Imaging in tuberculosis-associated uveitis. Indian J Ophthalmol 65:264–270. doi: 10.4103/ijo.IJO_464_16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Nazari H, Karakousis PC, Rao NA. 2014. Replication of Mycobacterium tuberculosis in retinal pigment epithelium. JAMA Ophthalmol 132:724–729. doi: 10.1001/jamaophthalmol.2014.270 [DOI] [PubMed] [Google Scholar]
- 23. Kon OM, Beare N, Connell D, Damato E, Gorsuch T, Hagan G, Perrin F, Petrushkin H, Potter J, Sethi C, Stanford M. 2022. BTS clinical statement for the diagnosis and management of ocular tuberculosis. BMJ Open Respir Res 9:e001225. doi: 10.1136/bmjresp-2022-001225 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Takaki K, Ramakrishnan L, Basu S. 2018. A zebrafish model for ocular tuberculosis. PLoS One 13:e0194982. doi: 10.1371/journal.pone.0194982 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Rao NA, Saraswathy S, Smith RE. 2006. Tuberculous uveitis: distribution of Mycobacterium tuberculosis in the retinal pigment epithelium. Arch Ophthalmol 124:1777–1779. doi: 10.1001/archopht.124.12.1777 [DOI] [PubMed] [Google Scholar]
- 26. Gold B., Warrier T, Nathan C. 2021. A multistress model for high throughput screening against nonreplicating Mycobacterium tuberculosis. Methods Mol Biol 2314:611–635. doi: 10.1007/978-1-0716-1460-0_27 [DOI] [PubMed] [Google Scholar]
- 27. Bryk R, Gold B, Venugopal A, Singh J, Samy R, Pupek K, Cao H, Popescu C, Gurney M, Hotha S, Cherian J, Rhee K, Ly L, Converse PJ, Ehrt S, Vandal O, Jiang X, Schneider J, Lin G, Nathan C. 2008. Selective killing of nonreplicating mycobacteria. Cell Host Microbe 3:137–145. doi: 10.1016/j.chom.2008.02.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Gold Ben, Pingle M, Brickner SJ, Shah N, Roberts J, Rundell M, Bracken WC, Warrier T, Somersan S, Venugopal A, Darby C, Jiang X, Warren JD, Fernandez J, Ouerfelli O, Nuermberger EL, Cunningham-Bussel A, Rath P, Chidawanyika T, Deng H, Realubit R, Glickman JF, Nathan CF. 2012. Nonsteroidal anti-inflammatory drug sensitizes Mycobacterium tuberculosis to endogenous and exogenous antimicrobials. Proc Natl Acad Sci U S A 109:16004–16011. doi: 10.1073/pnas.1214188109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Vandal OH, Pierini LM, Schnappinger D, Nathan CF, Ehrt S. 2008. A membrane protein preserves intrabacterial pH in intraphagosomal Mycobacterium tuberculosis. Nat Med 14:849–854. doi: 10.1038/nm.1795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Barisch C, Soldati T. 2017. Mycobacterium marinum degrades both triacylglycerols and phospholipids from its Dictyostelium host to synthesise its own triacylglycerols and generate lipid inclusions. PLoS Pathog 13:e1006095. doi: 10.1371/journal.ppat.1006095 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Daniel J, Maamar H, Deb C, Sirakova TD, Kolattukudy PE. 2011. Mycobacterium tuberculosis uses host triacylglycerol to accumulate lipid droplets and acquires a dormancy-like phenotype in lipid-loaded macrophages. PLoS Pathog 7:e1002093. doi: 10.1371/journal.ppat.1002093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Low KL, Rao PSS, Shui G, Bendt AK, Pethe K, Dick T, Wenk MR. 2009. Triacylglycerol utilization is required for regrowth of in vitro hypoxic nonreplicating Mycobacterium bovis bacillus Calmette-Guerin. J Bacteriol 191:5037–5043. doi: 10.1128/JB.00530-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Peddireddy V, Doddam SN, Ahmed N. 2017. Mycobacterial dormancy systems and host responses in tuberculosis. Front Immunol 8:84. doi: 10.3389/fimmu.2017.00084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Voskuil MI, Visconti KC, Schoolnik GK. 2004. Mycobacterium tuberculosis gene expression during adaptation to stationary phase and low-oxygen dormancy. Tuberculosis (Edinb) 84:218–227. doi: 10.1016/j.tube.2004.02.003 [DOI] [PubMed] [Google Scholar]
- 35. Park H-D, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR. 2003. Rv3133C/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis . Mol Microbiol 48:833–843. doi: 10.1046/j.1365-2958.2003.03474.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Rustad TR, Harrell MI, Liao R, Sherman DR. 2008. The enduring hypoxic response of Mycobacterium tuberculosis. PLoS One 3:e1502. doi: 10.1371/journal.pone.0001502 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Eoh H, Wang Z, Layre E, Rath P, Morris R, Branch Moody D, Rhee KY. 2017. Metabolic anticipation in Mycobacterium tuberculosis. Nat Microbiol 2:17084. doi: 10.1038/nmicrobiol.2017.84 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Lee JJ, Lee S-K, Song N, Nathan TO, Swarts BM, Eum S-Y, Ehrt S, Cho S-N, Eoh H. 2019. Transient drug-tolerance and permanent drug-resistance rely on the trehalose-catalytic shift in Mycobacterium tuberculosis. Nat Commun 10:2928. doi: 10.1038/s41467-019-10975-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Bacon J, Alderwick LJ, Allnutt JA, Gabasova E, Watson R, Hatch KA, Clark SO, Jeeves RE, Marriott A, Rayner E, Tolley H, Pearson G, Hall G, Besra GS, Wernisch L, Williams A, Marsh PD. 2014. Non-replicating Mycobacterium tuberculosis elicits a reduced infectivity profile with corresponding modifications to the cell wall and extracellular matrix. PLoS One 9:e87329. doi: 10.1371/journal.pone.0087329 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Dulberger CL, Rubin EJ, Boutte CC. 2020. The mycobacterial cell envelope - a moving target. Nat Rev Microbiol 18:47–59. doi: 10.1038/s41579-019-0273-7 [DOI] [PubMed] [Google Scholar]
- 41. Eoh H. 2014. Metabolomics: a window into the adaptive physiology of Mycobacterium tuberculosis. Tuberculosis (Edinb) 94:538–543. doi: 10.1016/j.tube.2014.08.002 [DOI] [PubMed] [Google Scholar]
- 42. Rhee KY, de Carvalho LPS, Bryk R, Ehrt S, Marrero J, Park SW, Schnappinger D, Venugopal A, Nathan C. 2011. Central carbon metabolism in Mycobacterium tuberculosis: an unexpected frontier. Trends Microbiol 19:307–314. doi: 10.1016/j.tim.2011.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Lee H, Lee JJ, Park NY, Dubey SK, Kim T, Ruan K, Lim SB, Park S-H, Ha S, Kovlyagina I, Kim K-T, Kim S, Oh Y, Kim H, Kang S-U, Song M-R, Lloyd TE, Maragakis NJ, Hong YB, Eoh H, Lee G. 2021. Multi-omic analysis of selectively vulnerable motor neuron subtypes Implicates altered lipid metabolism in ALS. Nat Neurosci 24:1673–1685. doi: 10.1038/s41593-021-00944-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Nathan C. 2014. Drug-resistant tuberculosis: a new shot on goal. Nat Med 20:121–123. doi: 10.1038/nm.3470 [DOI] [PubMed] [Google Scholar]
- 45. Lim J, Lee JJ, Lee S-K, Kim S, Eum S-Y, Eoh H. 2021. Phosphoenolpyruvate depletion mediates both growth arrest and drug tolerance of Mycobacterium tuberculosis in hypoxia. Proc Natl Acad Sci U S A 118:e2105800118. doi: 10.1073/pnas.2105800118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Eoh H, Rhee KY. 2013. Multifunctional essentiality of succinate metabolism in adaptation to hypoxia in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 110:6554–6559. doi: 10.1073/pnas.1219375110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Flentie K, Harrison GA, Tükenmez H, Livny J, Good JAD, Sarkar S, Zhu DX, Kinsella RL, Weiss LA, Solomon SD, Schene ME, Hansen MR, Cairns AG, Kulén M, Wixe T, Lindgren AEG, Chorell E, Bengtsson C, Krishnan KS, Hultgren SJ, Larsson C, Almqvist F, Stallings CL. 2019. Chemical disarming of isoniazid resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 116:10510–10517. doi: 10.1073/pnas.1818009116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Tallman KR, Levine SR, Beatty KE. 2016. Small-molecule probes reveal esterases with persistent activity in dormant and reactivating Mycobacterium tuberculosis. ACS Infect Dis 2:936–944. doi: 10.1021/acsinfecdis.6b00135 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Zhang Y, Yew WW, Barer MR. 2012. Targeting persisters for tuberculosis control. Antimicrob Agents Chemother 56:2223–2230. doi: 10.1128/AAC.06288-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Hasenoehrl EJ, Rae Sajorda D, Berney-Meyer L, Johnson S, Tufariello JM, Fuhrer T, Cook GM, Jacobs WR, Berney M. 2019. Derailing the aspartate pathway of Mycobacterium tuberculosis to eradicate persistent infection. Nat Commun 10:4215. doi: 10.1038/s41467-019-12224-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Manca C, Tsenova L, Bergtold A, Freeman S, Tovey M, Musser JM, Barry CE 3rd, Freedman VH, Kaplan G. 2001. Virulence of a Mycobacterium tuberculosis clinical isolate in mice is determined by failure to induce Th1 type immunity and is associated with induction of IFN-alpha /beta. Proc Natl Acad Sci U S A 98:5752–5757. doi: 10.1073/pnas.091096998 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Ordway D, Henao-Tamayo M, Harton M, Palanisamy G, Troudt J, Shanley C, Basaraba RJ, Orme IM. 2007. The hypervirulent Mycobacterium tuberculosis strain HN878 induces a potent Th1 response followed by rapid down-regulation. J Immunol 179:522–531. doi: 10.4049/jimmunol.179.1.522 [DOI] [PubMed] [Google Scholar]
- 53. Choi UY, Lee JJ, Park A, Jung KL, Lee S-A, Choi YJ, Lee H-R, Lai C-J, Eoh H, Jung JU. 2022. Herpesvirus-induced spermidine synthesis and eIF5A hypusination for viral episomal maintenance. Cell Rep 40:111234. doi: 10.1016/j.celrep.2022.111234 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Pohane AA, Carr CR, Garhyan J, Swarts BM, Siegrist MS. 2021. Trehalose recycling promotes energy-efficient biosynthesis of the mycobacterial cell envelope. mBio 12:e02801-20. doi: 10.1128/mBio.02801-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Quinonez CG, Lee JJ, Lim J, Odell M, Lawson CP, Anyogu A, Raheem S, Eoh H. 2022. The role of fatty acid metabolism in drug tolerance of Mycobacterium tuberculosis. mBio 13:e0355921. doi: 10.1128/mbio.03559-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 to S7.
An accounting of the reviewer comments and feedback.
Data Availability Statement
All data generated or analyzed during this study are included in this published article and its supplemented files. The metabolomics raw datasets were deposited in MetaboLights. The accession number is MTBLS9841.




