Oocyte activation with phospholipase Cζ mRNA induces repetitive intracellular Ca²⁺ rises and improves the quality of pig embryos after intracytoplasmic sperm injection

Abstract

For the intracytoplasmic sperm injection (ICSI) procedure in pigs, an electrical pulse (EP) has been used as an effective method for oocyte stimulation, but unlike sperm, EP is unable to induce Ca²⁺ oscillations. In this study, we investigated the effects of generating artificial Ca²⁺ oscillations with phospholipase Cζ (PLCζ) mRNA, a candidate sperm factor, on fertilization, embryonic development, and gene expression after ICSI. Firstly, the concentration of PLCζ mRNA of a fixed volume (1.0 pl) that would induce a pattern of Ca²⁺ rise similar to that of in vitro fertilized (IVF) sperm was examined and determined to be 300 ng/μl. Secondly, the effects of oocyte stimulation methods on fertilization and embryonic development were investigated. ICSI-oocytes were activated by EP (EP group) or by PLCζ mRNA (PLCζ group). Furthermore, IVF-oocytes (IVF group) and ICSI-oocytes with and without an injection of buffer (buffer and untreated groups, respectively) were used as controls. It was found that the rates of normal fertilization in the PLCζ and EP groups were significantly higher than those in the buffer and untreated groups. The blastocyst formation rates did not differ among the groups. The embryo quality in the EP group was inferior to those in the PLCζ and IVF groups. Additionally, the expression level of a proapoptosis-related gene (Caspase-3) in the EP group was significantly higher than those in the PLCζ and IVF groups. Our data suggest that oocyte activation by PLCζ mRNA has the effect of improving embryo quality.

In mammalian oocytes, repetitive rises in the intracellular free Ca²⁺ concentration, known as Ca²⁺ oscillations, are induced with sperm-specific phospholipase C-ζ (PLCζ) [1] during fertilization. Ca²⁺ oscillations trigger a series of oocyte activation events, such as the inactivation of maturation-promoting factor, resumption of meiosis, extrusion of cortical granules, and transformation of sperm and oocyte nuclei into male and female pronuclei, respectively, which in turn leads to embryonic development [2].

Intracytoplasmic sperm injection (ICSI) is a useful technique for producing live offspring from nonmotile sperm. Pig spermatozoa are known to be particularly sensitive to cold shock, and membrane damage may occur as a result of freezing/thawing, resulting in a loss of fertilization capacity [3]. Therefore, ICSI is more useful in pigs. However, it has been reported that, in pigs, sperm injection alone may not fully activate oocytes and that normal fertilization (confirmed by the emission of two polar bodies and formation of two pronuclei: 2PB2PN) often fails [2, 4]. Mouse spermatozoa have less soluble PLCζ bound to the sperm head, whereas pig spermatozoa seem to possess both soluble and less soluble PLCζ [5,6,7]. Soluble PLCζ leaks easily from pig spermatozoa after membrane damage, causing a decline in oocyte activation capacity [8]. Therefore, artificial stimulation is required to effectively activate porcine oocytes after ICSI (ICSI-oocyte) [2].

To date, various types of artificial stimulation for inducing oocyte activation after ICSI have been examined in pigs. The delivery of an electrical pulse activates oocytes by triggering an influx of extracellular Ca²⁺ through pores in the plasma membrane [9,10,11,12]. Calcium ionophores [13], ionomycin [12], and CaCl₂ [9] activate oocytes through the release of stored intracellular Ca²⁺ or influx of extracellular Ca²⁺ [14, 15]. This form of stimulation induces only a single rise of intracellular Ca²⁺ [16,17,18]. Cycloheximide, 6-dimethylaminopurine [12], and U0126 [11] trigger the resumption of meiosis through inactivation of a protein that maintains oocytes in metaphase (maturation-promoting factor [11]). These protein synthesis inhibitors do not increase the intracellular Ca²⁺ [19].

In mice, it has been suggested that differences in the pattern of Ca²⁺ rises affect the resumption of meiosis, recruitment of maternal mRNA, PN formation, global pattern of gene expression at the blastocyst stage, and development to term [20,21,22]. In contrast, it has been proposed that oocyte activation and embryonic development are independent of any specific pattern of Ca²⁺ rise because any released Ca²⁺ reaches a threshold concentration and triggers oocyte activation [23,24,25]. In pigs, we have also confirmed that the delivery of an electrical pulse, which induces a single Ca²⁺ rise [16], is effective for the induction of oocyte activation, normal fertilization, and embryonic development to the blastocyst stage [4]. Furthermore, electrically stimulated ICSI-oocytes can develop into piglets [26]. These findings suggest that a specific pattern of Ca²⁺ rises may not be indispensable for oocyte activation, fertilization, or embryonic development in pigs. However, the efficiency of offspring production by ICSI is very low compared with that of in vitro fertilization (IVF) [26, 27]. This may be because the rise in Ca²⁺ caused by the electrical pulses is different from that caused by sperm fertilization. Therefore, to improve the oocyte stimulation method for ICSI-oocyte, we tried to induce the repetitive rises of intracellular Ca²⁺ by injection of PLCζ mRNA that are similar to those by sperm fertilization and also investigated the effects of this procedure on fertilization, in vitro embryonic development, and gene expression pattern in blastocyst.

Materials and Methods

All chemicals and reagents used in this study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise indicated.

Oocyte collection and in vitro maturation

Ovaries were obtained from prepubertal cross-bred gilts (Landrace, Large White, and Duroc breeds) at a local slaughterhouse and transported to the laboratory at 35°C. Cumulus-oocyte complexes (COCs) were collected from follicles 2–6 mm in diameter in glucose-free, HEPES-buffered Tyrode medium [28]. The COCs were cultured in six-well dishes (Research Institute for the Functional Peptides, Yamagata, Japan) for 20–22 h in 100 μl of maturation medium, a modified North Carolina State University (NCSU)-37 solution [29] containing 10% (v/v) pig follicular fluid, 0.6 mM cysteine, 50 µM β-mercaptoethanol, 1 mM dibutyl cAMP (dbcAMP), 10 IU/ml equine chorionic gonadotropin (PMSA for Animal; ZENOAQ, Fukushima, Japan), and 10 IU/ml human chorionic gonadotropin (HCG for animal; Kyoritsu, Tokyo, Japan). They were subsequently cultured for 24 h in maturation medium without dbcAMP or hormones. Maturation culture was carried out at 38.5°C in an atmosphere of CO₂, O₂, and N₂ adjusted to 5%, 5%, and 90%, respectively (5% CO₂ and 5% O₂). After maturation, cumulus cells were removed from the oocytes by treatment with 150 IU/ml hyaluronidase and gentle pipetting. Denuded oocytes with the first polar body were harvested under a stereomicroscope and used as in vitro-matured oocytes.

PLCζ cDNA constructs

The pig PLCζ sequence was obtained from the GenBank Database (Accession No. AB113581) and cloned according to the method described by Yoneda et al. (2006) [30] with slight modifications. The pig PLCζ cDNA construction was obtained from the testis of cross-bred Landrace, Large White, and Duroc pigs. Full-length pig PLCζ was amplified using PCR using the primers to incorporate a 5′-Xho and 3′-Pst sites. The primers used were: 5′-TCG ACT CGA GCG AGG AGA AAC AGA ACA GC-3′ (forward primer and Xho site) and 5′-CGT GAG CTG CAG AGC TAA CGA TAT TTC TGG CAC T-3′ (reverse primer and Pst site). The amplified cDNA was subcloned into the pBlueScript KS vector (Addgene, Cambridge, MA, USA) using Pst and Xho sites. The sequence of the obtained pig PLCζ cDNA was confirmed to be the same as that in the GenBank Database (Accession No. AB113581) using a Big Dye Terminator V3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). The GenBank Database (accession no. AB113581) references Dr. Yoneda’s research using Landrace testes [30], so it seems to be thought that the breed of pig does not affect the nucleotide sequence of PLCζ.

Pig PLCζ mRNA preparation

The pig PLCζ cDNA was subcloned into the pTnT expression vector (Promega, Madison, WI, USA). The plasmid was linearized at the BamHI site. Capped and polyadenylated pig PLCζ mRNA was prepared using a mMESSAGE mMACHINE T7 ULTRA KIT (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions. The capped and polyadenylated RNA was purified by LiCl preincubation, resuspended in nuclease-free water, and stored at −80°C until use.

Microinjection of pig PLCζ mRNA

The pig PLCζ mRNA was diluted to 300 or 500 ng/μl with injection buffer (120 mM KCl, 20 mM HEPES, pH 7.4 [31]) and then microinjected using Narishige manipulators (Narishige, Tokyo, Japan). The injection volume was approximately 1.0 pl.

Preparation of sperm

Ejaculated spermatozoa were collected from a Duroc pig and cryopreserved [32, 33]. For ICSI, frozen spermatozoa were thawed in phosphate-buffered saline (PBS) (Takara, Shiga, Japan) supplemented with 5 mg/ml bovine serum albumin (BSA; Fraction V) (PBS-BSA) and centrifuged for 2 min at 700 × g. The sperm pellet was resuspended in PBS-BSA and subjected to repeated freezing-thawing without cryoprotectant three times to reduce the amount of PLCζ through induction of membrane damage [8]. These sperm, defined as “membrane-damaged”, were centrifuged for 2 min at 700 × g and the pellet was resuspended in PBS-BSA and kept at room temperature until use. For IVF, cryopreserved spermatozoa were thawed in medium 199 (with Earle’s salts; Thermo Fisher Scientific) adjusted to pH 7.8 and centrifuged for 2 min at 700 × g. The sperm pellet was resuspended in 100 μl of medium199 (pH 7.8) and preincubated at 38°C for 15 min before insemination.

Western blotting

The quantity of PLCζ in membrane-damaged sperm was confirmed using western blotting (Fig. 1) as described previously [8] with some modifications. Pig PLCζ was detected using anti-PLCζ rabbit serum generated against a 19-mer sequence (MENKWFLSMVRDDFKGGKI) at the N-terminus of pPLCζ (accession no. BAC78817) as previously described [5]. After denaturation by boiling at 99.5°C for 3 min, samples were separated using SDS-PAGE on 10% polyacrylamide gel and then transferred onto a PVDF membrane (GE Healthcare, Chicago, USA). The membrane was blocked using blocking buffer [5% (w/v) skim milk in PBS supplemented with 0.1% Tween 20 (T-PBS)] and then incubated with anti- pig PLCζ antibody (1:5000, [5]) overnight at 4ºC in T-PBS. After washing three times with T-PBS, the membranes were treated with horseradish peroxidase-labeled anti-rabbit immunoglobulin G (IgG; 1:5000, Cell Signaling Technology, Danvers, MA, USA) in T-PBS for 1 h at room temperature. After washing once for 15 min and five times for 5 min each in T-PBS, peroxidase activity was visualized using the ECL Plus Western blotting detection system (GE Healthcare) according to the manufacturer’s instructions. The intensity of the bands was analyzed using ImageJ software (ver. 1.41; National Institutes of Health, Bethesda, MD, USA). Data on the quantity of PLCζ in the membrane-damaged sperm was quantified in comparison to that of the non-treated (control) sperm.

Fig. 1.

Decrease in the quantity of PLCζ in the membrane-damaged pig sperm. The sperm concentration was 1 × 10⁵ cells/lane for SDS-PAGE. After western blotting (A), the intensity of the band of the membrane-damaged sperm group was quantified using Image J and compared with that of the Non-treatment group (B).

ICSI

Oocytes were transferred to a 20-μl drop of modified NCSU-37 solution without glucose but supplemented with 0.17 mM sodium pyruvate, 2.73 mM sodium lactate, 4 mg/ml BSA, 50 µM β-mercaptoethanol (IVC-PyrLac [34]), and 20 mM HEPES (IVC-PyrLac-HEPES [26]). A small volume (0.5 μl) of the membrane-damaged sperm suspension was transferred to a 2-μl drop of IVC-PyrLac-HEPES supplemented with 4% (w/v) polyvinyl pyrrolidone (MW 360,000) (IVC-PyrLac-HEPES-PVP), which was prepared close to the drops used for the oocytes. All the drops were placed on the cover of a plastic dish and covered with paraffin oil (Nacalai Tesque, Kyoto, Japan). Membrane-damaged spermatozoa were injected into the ooplasm using a piezoactuated micromanipulator (PMAS-CT150; Prime Tech Ltd., Ibaraki, Japan).

Electrical pulse

Oocyte stimulation by electrical pulses was performed as previously described [26]. Briefly, oocytes were transferred to a stimulation solution consisting of 0.28 M d-mannitol, 0.05 mM CaCl₂, 0.1 mM MgSO₄, and 0.1 mg/ml BSA. They were then stimulated with a direct current pulse of 1.5 kV/cm for 20 µsec, using a somatic hybridizer (SSH-2; Shimadzu, Kyoto, Japan). After the electrical pulse, oocytes were washed and cultured in IVC-PyrLac.

IVF

IVF was performed as described by Kikuchi et al. [34]. The oocytes were washed three times in pig fertilization medium (Pig-FM [35]) and then placed in individual 80-μl drops of the same medium that had been covered with warm paraffin oil. Generally, 10 μl of preincubation medium containing sperm was added to each fertilization drop to give a final concentration of 1 × 10⁴ sperm/ml, and then co-incubated for 4 h at 39°C under 5% CO₂ and 5% O₂. After co-incubation, the sperms attached to the oocytes were repeatedly pipetted and removed. Oocytes cultured for 10 h after insemination were placed in 700 µl of IVC-PyrLac-Hepes and centrifuged at 10,000 × g at 37°C for 20 min in a microcentrifuge [36]. Normally, fertilized oocytes were selected under an inverted microscope (IX70; Olympus, Tokyo, Japan).

Measurement of intracellular Ca²⁺

Immediately after PLCζ mRNA injection, buffer injection, IVF, or electrical pulse, each oocyte was loaded with 50 μg Fura-PE3/AM (Santa Cruz Biotechnology, TX, USA) supplemented with 0.02% Pluronic F-127 (Thermo Fisher Scientific) while transporting the oocytes from the laboratory to the measurement room at 38°C for 30 min. The Fura-PE3/AM prelabeled oocytes were monitored in 50-μl drops of Pyr-Lac-HEPES without BSA on a thin glass coverslip (Electron Microscopy Sciences, PA, USA) fitted into a stainless steel well covered with paraffin oil. Ca²⁺ imaging was performed for 4 h using an inverted microscope and AQUACOSMOS (Hamamatsu Photonics, Shizuoka, Japan). The fluorescence ratios were recorded every 30 sec and reported as the ratio of 340/380 nm fluorescence. The amplitude of any rise in Ca²⁺ concentration was calculated by subtracting the fluorescence level before the Ca²⁺ rise from that at the peak of the Ca²⁺ rise. After measurement, each oocyte showing a Ca²⁺ increase was assigned an identification number, cultured for a further 6 h, and observed individually after staining with aceto-orcein to confirm PN formation.

In vitro culture (IVC)

Two types of IVC medium were prepared. The first one was IVC-PyrLac [34]. The second one contained 5.55 mM glucose, as used in the originally reported NCSU-37 medium and was also supplemented with 4 mg/mL BSA and 50 mM β-mercaptoethanol (IVC-Glu). IVC-PyrLac was used for the first two days. The medium was changed once to IVC-Glu on the second day of IVC, and this medium was used for subsequent culture for four days. The IVC was carried out at 38.5°C under 5% CO₂ and 5% O₂.

Assessment of normal fertilization and embryonic development

Cultured oocytes were mounted on glass slides, fixed in 25% (v/v) acetic acid in ethanol, stained with 1% (w/v) orcein in 45% (v/v) acetic acid, and observed under a phase-contrast microscope. The rate of normal fertilization was examined 10 h after ICSI or IVF. The rate of blastocyst formation and the number of cells per blastocyst were examined on Day 6 (the day of ICSI or IVF was defined as Day 0).

Total RNA extraction and real-time PCR

Blastocysts were collected on Day 6, and total RNA was extracted using Sepazol (Nacalai Tesque) in accordance with the manufacturer’s instructions. After being treated with DNase I (Takara) at 37°C for 30 min, RNA was subjected to first-strand cDNA synthesis at 37°C for 30 min using a RevertraAce (TOYOBO Co., Osaka, Japan). Relative quantification of the transcripts of interest was performed using real-time PCR using a LightCycler (Roche Diagnostics, Basel, Switzerland). PCR amplification was performed in 20 µl of a reaction mixture consisting of 1 µl cDNA, 0.4 µM each primer, and 10 µl SYBR premix Ex Taq II (Takara). The cycling conditions were 95°C for 3 min, followed by 50 cycles of 95°C for 5 sec, 55°C for 30 sec, and 72°C for 30 sec. The primers used in this study are listed in Table 1. Target gene expression was normalized to the expression of the beta-actin (ACTB) gene.

Table 1. Primer sequences used for real-time time PCR analysis.

Gene	Sequence (5´–3´)	accession No.	References
ADAM10	F: GGCTTGGAGGAGTGTACCTG	NM_001130531	Kwon et al., 2016 [49]
	R: GCTAGAGGACCGTCAGCATC
CASP3	F: ACTGTGGGATTGAGACGG	NM_214131	Hou et al., 2016 [50]
	R: GGAATAGTAACGAGGTGCTG
CDH1	F: ACTGGGTTATCCCTCCCATC	NM_001163060	Kwon et al., 2016 [49]
	R: AAACGGGCCTTTCTCATTTT
Glut1	F: GGTGCTCCTGGTCCTGTTCTTC	NC_010448	Wang et al., 2015 [51]
	R: CCTCGGGTGTCTTGTCGCTTT
mTOR	F: AGGAGACCTCCTTTAACCAG	XM_003127584.6	Luo et al., 2020 [52]
	R: ATGTACTTCCTGCACCACTC
Oct4	F: GTGAGAGGCAACCTGGAGAG	NM_001113060.1	Luo et al., 2020 [52]
	R: TCGTTGCGAATAGTCACTGC
CDX2	F: GGCAGCCAAGTGAAAACCAG	NM_001278769.1	Jeong et al., 2019 [53]
	R: GCCTTTCTCCGAATGGTGAT
NANOG	F: CATGAGTGTGGATCCAGCTTG	XM_021092390.1	Luo et al., 2020 [52]
	R: CCTGAATAAGCAGATCCATGG
ACTB	F: GCCAACCGTGAGAAGATGAC	NC_010445	―
	R: AGTCCATCACGATGCCAGTG

Experimental design

Firstly, to decide the PLCζ mRNA injection concentration that would yield a repetitive pattern of Ca²⁺ rises similar to that triggered by fertilizing sperm, we measured the Ca²⁺ rises in pig oocytes after injection of 300 or 500 ng/μl pig PLCζ mRNA. As controls, oocytes injected with injection buffer alone (buffer group) and in vitro fertilized oocytes (IVF group) were prepared. In addition, we confirmed that an electrical pulse could not induce a repetitive pattern of Ca²⁺ rises (EP group).

Secondly, to evaluate the effects of oocyte stimulation methods on fertilization and embryonic development after ICSI, we examined the efficiencies of normal fertilization and blastocyst formation and embryo quality in ICSI-oocytes injected with 300 ng/μl PLCζ mRNA (PLCζ group) or stimulated by an electrical pulse (EP group) at 1 h after sperm injection. Embryo quality was evaluated by the number of cells per blastocyst and the expression of pluripotency genes Oct4 (octamer-binding transcription factor 4), Nanog (Nanog homeobox), and CDX2 (caudal type homeobox 2). As controls, we prepared a buffer group, an IVF group, and ICSI-oocytes that were given no further treatment (untreated group).

Finally, to evaluate the effect of the oocyte stimulation methods used in the second experiment on the expression of genes associated with embryonic development, we examined the expression levels of the blastocyst formation regulatory genes CDH1 (cadherin 1) and ADAM10 (ADAM metallopeptidase domain 10), the glucose uptake regulatory gene Glut1 (glucose transporter type 1), the growth and metabolism regulatory gene mTOR (mechanistic target of rapamycin), and the pro-apoptotic gene CASP3 (caspase-3).

Statistical analysis

All percentage data were subjected to arcsine transformation [37] before statistical analysis. Statistical analysis of data from more than three replicates was performed using analysis of variance (ANOVA) and Tukey’s multiple range test using Statcel 2 (OMS Publishing Inc., Tokyo, Japan). Differences were considered statistically significant at P < 0.05. All data are expressed as mean ± SEM.

Results

Measurement of intracellular Ca²⁺ in oocytes after injection of PLCζ mRNA

The patterns of Ca²⁺ rise in pig oocytes injected with PLCζ mRNA or buffer and also after IVF or electrical pulse are shown in Fig. 2. The rises in Ca²⁺ concentration in pig oocytes injected with 300 ng/μl (n = 4 oocytes) or 500 ng/μl (n = 6 oocytes) pig PLCζ mRNA were an amplitude of 0.55 ± 0.01 and 0.47 ± 0.02 occurred at 1.5 ± 0.2 times/4 h and 3.1 ± 0.4 times/4 h, respectively. In addition, the mean interval between the Ca²⁺ rises was 120.5 ± 23.5 min and 49.9 ± 4.4 min for 300 ng/μl and 500 ng/μl pig PLCζ mRNA, respectively. In monospermic fertilized oocytes (n = 11 oocytes), the rise in Ca²⁺ concentration with an amplitude of 0.62 ± 0.08 occurred at 139 ± 6.5 min intervals for 1.3 ± 0.14 times/4 h. These oocytes, with a confirmed Ca²⁺ rise, formed PNs. Oocytes injected with the buffer alone showed no Ca²⁺ rise. These observations suggested that the oocyte stimulation achieved by injection of 300 ng/μl pig PLCζ mRNA was more similar to that achieved by IVF than that achieved using 500 ng/μl pig PLCζ mRNA. Therefore, the following experiments were performed using an injection of 300 ng/μl pig PLCζ mRNA. Additionally, in the EP group, it was not possible to measure the Ca²⁺ rise that occurred simultaneously with the electrical pulse due to a technical aspect, but the Ca²⁺ rise was not observed during the measurement starting 30 minutes post-electrical pulse. This indicates that Ca²⁺ rise caused by an electrical pulse is different from PLCζ mRNA and IVF.

Fig. 2.

Changes in intracellular Ca²⁺ concentration in pig oocytes after microinjection of pig PLCζ mRNA. The intracellular Ca²⁺ concentration was measured in oocytes from 30 min after injection with 300 ng/μl (A), 500 ng/μl (B) of pig PLCζ mRNA or buffer (C) of a fixed volume (1.0 pl), in vitro fertilization (D), or stimulation by an electrical pulse (E). In all experiment groups, the start time of measurement is defined as “0 hour”. Data show the ratio value of 340/380 nm fluorescence over time.

Effect of oocyte stimulation method on normal fertilization and embryonic development

The rates of normal fertilization did not differ among the PLCζ (78.6 ± 7.5%), EP (72.2 ± 3.6%), and IVF (50.0 ± 6.6%) groups (Fig. 3A). The rates in the buffer (24.3 ± 3.1%) and untreated (28.2 ± 4.2%) groups were significantly lower than those in the PLCζ and EP groups. The rates of blastocyst formation did not differ among the groups overall (20.3 ± 7.2%, 28.3 ± 7.4%, 3.9 ± 3.0%, 9.4 ± 4.0%, and 19.3 ± 5.8% for the PLCζ, EP, buffer, untreated, and IVF groups, respectively) (Fig. 3B). The mean number of cells per blastocyst in the EP group (32.1 ± 3.0 cells) was significantly lower than those in the PLCζ and IVF groups (57.2 ± 5.2 cells and 51.8 ± 3.9 cells) but similar to those in the other control groups (29.0 ± 3.2 cells and 34.8 ± 6.2 cells for the buffer and untreated groups, respectively) (Fig. 3C). Furthermore, the expression level of Oct4 in the EP group was significantly lower compared with the PLCζ and IVF groups (Fig 4A). Examples of blastocysts obtained from each group are shown in Fig. 5.

Fig. 3.

The efficiency of normal fertilization (A), blastocyst formation (B), and mean number of cells per blastocyst (C) after ICSI or IVF. Data are presented as mean ± SEM for more than three separate experiments. Different superscripts (a, b) indicate values that are significantly different (P < 0.05).

Fig. 4.

Relative transcript levels of pluripotent genes (A) and embryonic development-associated genes (B) in blastocysts. mRNA expression of each gene was measured using quantitative RT-PCR. The expression in the blastocyst in the PLCζ mRNA-injected and electrical pulse-stimulated groups was compared with that of the IVF group. The data are presented as mean ± SEM after three separate assays. Different superscripts (a, b) indicate values that are significantly different (P < 0.05).

Fig. 5.

Blastocysts developed from the ICSI-oocytes stimulated by pig PLCζ mRNA (A) or electrical pulse (B) and the in vitro fertilized oocytes (C). Scale bar: 100 µm.

Effect of the difference in oocyte stimulation method on gene expression

There were no significant differences in the expression levels of mTOR, Glut1, CDH1, and ADAM10, but the expression of CASP3 in the EP group was significantly (P < 0.05) upregulated relative to that in the PLCζ and IVF groups (Fig. 4B).

Discussion

In the present study, we found that oocyte activation resulting from the injection of PLCζ mRNA improved embryo quality and reduced the expression of a proapoptosis-related gene.

The frequency of Ca²⁺ increase induced by one sperm is much lower in pigs (1–4 times/4 h) [38] than in hamsters (20–30 times/h) [39] or mice (5–30 times/h) [40, 41]. In the present study, injection of 1 pL of 300 ng/µl PLCζ mRNA (300 fg PLCζ mRNA/oocyte) elicited low-frequency Ca²⁺ rises as observed in the pig IVF oocyte. However, we could not measure the amplitude of the Ca²⁺ increase simultaneously with the electrical pulse because of the lack of a suitable measurement system. However, electrical pulse stimulation has been proven to support the development of ICSI-oocytes into progeny [26]. Therefore, in the current situation, in which it is difficult to measure intracellular Ca²⁺ using electrical pulses, this electrical pulse condition was used as a suitable electrical stimulation in the present study.

In the second experiment, we investigated the effects of each oocyte stimulation method on normal fertilization and embryonic development using ICSI-oocytes rather than parthenogenetic oocytes because the transformation from the sperm nucleus to the male pronucleus requires sufficient activation of the oocyte [4]. Although the membrane-damaged sperm by repeated freezing-thawing without cryoprotectant three times were used for ICSI, it may be impossible to remove all PLCζ. Therefore, we cannot deny the involvement of PLCζ derived from sperm with oocyte activation in the PLCζ and EP groups. However, it can be concluded that the remaining PLCζ did not significantly change the pattern of Ca²⁺ oscillations observed in the first experimentation because the amount of PLCζ remaining was extremely small (Fig. 1).

Ca²⁺ rise parameters are transduced into changes in Ca²⁺/calmodulin-dependent kinase II (CaMKII) enzymatic activity and autophosphorylation. CaMKII phosphorylates a wide range of substrates to coordinate and regulate Ca²⁺-mediated alterations in cellular function [42]. High-frequency rises in Ca²⁺ sustain CaMKII activity due to autophosphorylation, whereas low-frequency rises are likely to generate transient increases and decreases in CaMKII activity [42]. In the present study, a single electrical pulse was able to support normal fertilization and blastocyst formation to an extent equal to those in the PLCζ and IVF groups. When the influx of Ca²⁺ triggered by a single pulse reaches a threshold concentration for oocyte activation, it may be possible to maintain CaMKII activity during cell cycle progression and oocyte activation events.

However, the mean number of cells per blastocyst – as a criterion of embryo quality – after the electrical pulse was inferior to those in the PLCζ and IVF groups. Furthermore, the expression level of Oct4 was also significantly lower than the PLCζ and IVF groups. High intracellular Ca²⁺ levels induce ROS generation, leading to oocyte apoptosis via the mitochondrial caspase-mediated pathway [43, 44]. It has been reported that the incidence of apoptosis correlates with embryo quality [45]. The amplitude of the rise in Ca²⁺ following an electrical pulse is determined by the electrical field parameters and the concentration of extracellular Ca²⁺ in the pulsing medium [16]. Based on a report by Sun et al. [16], our electrical pulse conditions may have induced a higher amplitude of Ca²⁺ rise than that in IVF-oocytes. Considering the expression of CASP3 in blastocysts after electrical pulse delivery, the reduction in the number of cells per blastocyst may be related to apoptosis.

In oocyte activation via PLCζ, apoptosis may be inhibited because protein kinase C (PKC), which is downstream of the oocyte activation pathway by PLCζ, is involved in the regulation of apoptosis [46]. PLCζ catalyzes the hydrolysis of phosphatidyl 4,5-bisphosphate to inositol 1,4,5-trisphosphate and diacylglycerol [47], an activator of conventional-type PKC (cPKC). Among the cPKC forms, PKC-α and -βII have been reported to have anti-apoptotic roles [48]. Therefore, not only the pattern of the rise in Ca²⁺ but also the induction of oocyte activation by PLCζ may contribute to the improvement of embryo quality. These results suggest that repeated rises of Ca²⁺ concentration with an appropriate amplitude via PLCζ are excellent for maintaining CaMKII activity while preventing apoptosis.

In conclusion, oocyte activation by injection of PLCζ mRNA with a repetitive pattern of Ca²⁺ rises had the effect of improving the embryo quality and may involve CASP3 gene downregulation. In contrast, normal fertilization and blastocyst formation were not affected by differences in the oocyte stimulation methods employed. The progression of fertilization and embryo development before implantation appeared to be dependent on the total Ca²⁺ signal, regardless of the pattern of Ca²⁺ rises.

Conflict of interests

All authors declare no conflict of interest.