Effects of maternal hawthorn-leaf flavonoid supplementation on the intestinal development of offspring chicks

Abstract

Metabolic disorders in maternal generation during the late egg-laying period have adverse effects on neonatal development. The study was conducted to clarify the effects of maternal feeding of hawthorn-leaf flavonoid (HF) on the microbial community and intestinal development of chicks. Breeder hens were fed a basic corn-soybean diet, while the treatment groups were supplemented with 30 or 60 mg/kg HF. The offspring chicks were divided into CON, LHF, and HHF groups according to the maternal treatments. Maternal HF supplementation at 60 mg/kg increased the average daily gain and decreased the feed conversion rate of chicks (P < 0.05), but did not affect the average daily feed intake. HF treatments increased the villus height to crypt depth ratio and up-regulated the protein expressions of PCNA, IGF-1R, PI3K and p-mTOR in the jejunum (P < 0.05) of 1-day-old and 14-day-old chicks. Additionally, maternal HF treatment up-regulated the mRNA expression of tight junction transmembrane proteins (occludin) and scaffolding proteins (ZO-1 and ZO-2) in the jejunum of 1-day-old chicks (P < 0.05). Moreover, the maternal effects of HF on ZO-1 expression could last for 14 d (P < 0.05). Interestingly, dietary HF supplementation altered the vertically transmitted microbial community from breeder hens to chicks, especially increased the relative abundance of probiotics (i.e., Clostridium_sensu_stricto_1) in the meconium of chicks (P < 0.05), which may help with early gut microbiota colonization and intestinal development. In summary, dietary HF supplementation for breeder hens altered the bacterial community of neonates and might promote intestinal development of chicks through the IGF-1R/AKT/mTOR signaling pathway.

INTRODUCTION

Intestinal development in young animals is essential for the metabolism, physiology, disease state, and growth performance (Lu et al., 2019). Pathogenic microorganisms and environmental disruptors can affect the intestinal health of newly hatched birds due to their immature immune systems, underdeveloped intestinal microbiota and mucosal barrier (Neveling et al., 2020; Weström et al., 2020). Previous studies have reported maternal diet and health may have remarkable effects on the offspring's intestinal development and initial colonization of the microbiota, which plays an important role in shaping future health (Matamoros et al., 2013). Results from several studies have shown discernible variations in the gut microbiota of infants from overweight and normal-weight mothers, implying a potential association between maternal weight and metabolism and offspring microbiota development (Collado et al., 2010; Collado et al., 2012; Galley et al., 2014). Thus, it is of great significance to find some strategies to enhance the intestinal development of young animals. Our previous studies have reported that breeder hens had severe fatty liver syndrome in the late laying period, which inhibited embryonic development (Dai et al., 2021; Lv et al., 2018b). This suggests that nutritional status and metabolism can effectively influence the development of offspring (Kelly and Coutts, 2000; Lilburn and Loeffler, 2015). However, the effects of maternal nutrition on the intestinal development and function of offspring chicks are still unclear.

Hawthorn-leaf flavonoid (HF), extracted from hawthorn leaves, exerts important effects on improving growth and immunity (Fu et al., 2013; Shi et al., 2019). Our research has shown that dietary supplementation with HF could improve the reproduction performance of broiler breeder hens by relieving oxidative stress and lipid deposition (Dai et al., 2021), which provides a research basis for studying the impact of maternal feeding of HF on the intestinal health of offspring. Lv, et al. (2018a) has proved that maternal genistein treatment promotes embryonic development by activating the insulin-like growth factors -1 (IGF-1) signaling pathway. It has also been reported that adding flavonoids to maternal diets can activate the mammalian target of rapamycin (mTOR) signaling pathway, and promote liver development in offspring (Won et al., 2017). However, the effects of maternal dietary flavonoid supplementation on offspring intestinal development and function are still unclear. Furthermore, Matamoros, et al. (2013) reported that the initial colonization of microbiota is critical for intestinal health in young animals. Mounting evidence from mammalian studies demonstrates that vertical transmission of microbiota has a significant impact on offspring intestinal development (Galley et al., 2014; Chu et al., 2016). Previous studies have reported a strong dose-dependent antibacterial activity of HF against Gram-positive bacteria (i.e., Staphylococcus aureus and Streptococcus faecalis) (Belkhir et al., 2013; Benabderrahmane et al., 2021). Whereas, the effects of maternal HF supplementation on the gut microbiota of offspring chicks have not yet been clarified. Especially, the reproductive physiology of poultry and birds is different from that of mammals. Therefore, the present research was conducted to clarify the regulatory effect of maternal HF supplementation on the gut microflora intestinal development of offspring chicks.

MATERIALS AND METHODS

Ethics Statement

The experiment was conducted following the guidelines and regulations of the Animal Ethical and Welfare Committee of Nanjing Agricultural University (protocol number PZ20201205).

Animals and Experimental Groups and Diet Regimes

Qiling chickens is an important Chinese native local breed. A total of 270 healthy Qiling breeder hens (60-wk-old) with similar laying performance were used as the experimental animals. The hens were randomly allocated to 3 groups (6 replicates) with 15 birds in each replicate. The basic diet used in this experiment was prepared according to the nutrient requirement of Chinese Feeding Standard of Chicken (NY/T33–2004) (Table 1). The commercial HF (80% purity, containing vitexin-2″-O-rhamnoside, 48%; vitexin-4″-O-glucoside, 12%; vitexin, 8%; hyperoside, 6%; others, 6%, FY3776) used in the experiment were purchased from Nantong Jingwei Co., Ltd. (Jiangsu, China). Three levels of HF including 0, 30 mg/kg, and 60 mg/kg were added to the basal ration as the experimental treatments. In an 8-wk experiment, all birds were raised in 2-level cages according to the method described by our previous study (Dai et al., 2021) and the basal diet did not contain HF. All breeder hens were subjected to artificial insemination in accordance with standard procedures.

Table 1.

Ingredient compositions and nutrient levels of the basic corn-soybean diet (as-fed basis).

Items	Breeder hens	1 to 28 d
Ingredient (%)
Corn	54.99	53.28
Soybean meal	34.15	38.57
Limestone	7.23	1.05
Soybean oil	0.50	3.70
Dicalcium phosphate	2.09	1.98
NaCl	0.35	0.35
1Trace mineral premix	0.30	0.50
Choline chloride (50%)	0.12	0.30
D/L-Methionine	0.17	0.17
2Vitamin premix	0.10	0.10
Total	100.00	100.00
3Nutrient levels
Metabolizable energy (MJ /Kg)	11.84	12.35
Crude protein (%)	16.10	21.57
Available phosphorus (%)	0.47	0.45
Methionine (%)	0.34	0.49
Lysine (%)	0.81	1.15
Calcium (%)	3.70	1.05

¹Supplied the following per kg complete diet: Cu 8 mg; Zn 75 mg; Fe 80 mg; Mn 100 mg; Se 0.15 mg; I 0.35 mg.

²Provided per kilogram of diet: vitamin A, 12,500 IU; vitamin D3, 2,500 IU; vitamin E, 80 IU; vitamin K, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; nicotinic acid, 50 mg; pantothenic acid, 20 mg; vitamin B6, 4 mg; folic acid, 1.25 mg; vitamin B12, 0.025 mg; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; niacin, 50 mg.

³Crude protein was measured value. Metabolizable energy, available phosphorus, methionine, lysine and calcium are calculated values;Soybean added to the hen diet with a protein content of 42%; Soybean added to the offspring chicks with a protein content of 46%.

A total of 180 hatching eggs (30 eggs per replicate) from each group were collected at the last week of experiment for subsequent study. Hatching eggs were collected, stored and hatched under the standard requirements described by Jiang, et al. (2022). Gender identification was conducted after chicks hatching. A total of 228 one-day-old hatched male chicks were divided into three groups (6 replicates) with 12 birds in each replicate. According to maternal diet treatments the offspring were divided into 3 groups: 1) the offspring of breeder hens fed a basal diet (CON), 2) the offspring of breeder hens fed a basal diet supplemented with 30 mg/kg HF (LHF), and 3) the offspring of breeder hens fed a basal diet supplemented with 60 mg/kg HF (HHF). As shown in Table 1, the diet was formulated to meet the nutritional requirements of broilers according to the Chinese Feeding Standard of Chickens (NY/T33-2004). Crude protein was determined according to method 990.04. (AOAC, 1990). Metabolizable energy, available phosphorus, methionine, lysine and calcium are calculated values according to our previous study (Jiang et al., 2022).

Sample Collection

All chicks were weighed after fasting for 8 h at 1, 14, and 28-day-old. On d 1 and 14, one chick from each replicate was randomly selected from each group. Blood was collected from the wing vein. The serum was then centrifuged from the blood at 3,000 g for 15 min at 4°C and stored at -20°C for later use. Six birds (one bird each replicate) from each group were sacrificed using CO₂ asphyxiation following the methods of previous research (Dai et al., 2020; Dai et al., 2021). Jejunal tissues of broilers were collected immediately, a portion was frozen in liquid nitrogen for measurements of gene and protein expression, another portion was fixed in 4% paraformaldehyde for histological analyses. The small amount of meconium from each chicken was not conducive to the extraction of microbial genomes, so meconium from each replicate (12 chicks) was collected and mixed evenly for high-throughput sequencing.

Serum Biochemical Parameters, Insulin-Like Growth Factor 1 Level

The clinical Laboratory in Nanjing Hospital of Chinese Medicine was responsible for determining serum concentrations of triglyceride, cholesterol, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol. The indices were obtained respectively by commercial kits (A110-1-1, A111-1-1, A113-1-1, and A112-1-1, Jiancheng Biotechnology, Nanjing, China) and an automatic biochemical analyzer (TBA-120FR, Toshiba Corporation, Tokyo, Japan). All experimental procedures were performed according to the manufacturer's instructions.

The serum IGF-1 levels were detected using commercial RIA kits (Beijing North Institute of Biological Technology, Beijing, China) provided by the company of Shanghai Xinfan Biotechnology. The sensitivity for IGF-1 determinations was 1.0 ng/ml. The intra-assay coefficient of variation was < 10% and the inter-assay coefficient of variation was < 15%.

Morphology Analysis of Jejunum

After adequate fixation using 4% paraformaldehyde, tissue samples were washed with flowing distilled water for 12 hours and then soaked through a graded series of ethanol and xylene, following the method of Dai et al. (2021). Next, the soaked tissues were embedded in paraffin and sectioned at 4 μm thickness using a Lecia RM2235 microtome (Leica Biosystems, Buffalo Grove, IL). The sections were deparaffinized and rehydrated using the xylene and diluted ethanol respectively, and finally stained with hematoxylin and eosin. The images of the jejunum were acquired using an Olympus Simon-01 microscope (Olympus Optical, Beijing, China). The villus height (VH) and crypt depth (CD) of the jejunum in chicks were measured from eight points per slide by a blinded viewer using the ImagePro Plus (version 6.0) software, following the method of Dai et al. (2021). Average values of the 2 indices were calculated as well as the villus height to crypt depth ratio.

RNA Extraction and Detection, cDNA Synthesis, and Real-Time PCR Analysis

Total RNA in the intestinal epithelial tissues were extracted using the commercial kit (RC-112-01, Vazyme, Nanjing, China) according to its instruction. The cDNA synthesis was performed using the HiScript II 1st Strand cDNA synthesis kit (+ gDNA wiper) (R212-01, Vazyme, Nanjing, China) after assessing the purity and concentration of total RNA in each sample using the Nanodrop (2000C, Thermo, America). Next, one-step real-time RT-PCR was performed using ChamQTM SYBR qPCR Master Mix (Q311-02, Vazyme, Nanjing, China) in a real-time PCR machine (QuantStudio 5 Flex, Thermo, America) according to the method described by Dai et al. (2021). The primer pairs used are shown in Table 2, including tight junction [epithelial cadherin (E-cadherin), Claudin-1, Claudin-2, Claudin-3, Claudin-5, zonula occludens (ZO)-1, ZO-2, ZO-3, and Occludin]. Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. Relative mRNA expression levels of each target gene were normalized to the control using the 2^−ΔΔCT method.

Table 2.

Primers used for quantitative real-time PCR analysis.

Gene	Primer sequence (5′ →3′)	Amplicon size (bp)	GenBank accession number
E-cadherin	F: AGCCCCAGTGCTTCTCTCTA	197	NM_131820.1
	R: CCTCCCGATCAGCAACTCTC
Claudin-1	F: ACCCACAGCCTAAGTGCTTC	200	NM_001013611.2
	R: AGGTCTCATAAGGCCCCACT
Claudin-2	F: AGGGGCTATGGATGGAGTGT	189	NM_001277622.1
	R: AGCCCTGATTGAAGACGGTG
Claudin-3	F: AGGGGTTCTCAGCTCTCACT	332	NM_204202.1
	R: GTTTCTCCGCCAGACTCTCC
Claudin-5	F: TTGCAGGTCGCCAGAGATAC	269	NM_204201.1
	R: AGGCAAGTGCATGTTACCGA
ZO-1	F: ACTGTGACCCCAAAACCTGG	294	XM_015278981.2
	R: CTCCCTGCTTGTGGCATGTA
ZO-2	F: GGCTCCCAAAATGAGATGCG	123	NM_204918.1
	R: TTGGGCGTGACGTATAGCTG
ZO-3	F: CACAAAGGGTTACGCAAGGC	198	XM_015299760.2
	R: AGAGCTCCAGGAGGGTCTTC
Occludin	F: ACCAGAATGGTACCCTGAGC	141	XM_025144247.1
	R: ATTACACAGCTTCAGCCTTACA
GAPDH	F: TCAGCACCATCTGACAATGC	148	NC_006088.5
	R: AGTAGGCAGCATCCCATCTG

F: represents forward, R: represents reward.

Western Blot

To extract the proteins, the jejunum was homogenized in Radio Immunoprecipitation Assay (RIPA) solution containing phenylmethylsulfonyl fluoride (PMSF). Equal amounts of proteins (20 µg) were electrophoresed in 4 - 20% (w/v) SDS-PAGE, and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). The membranes were blocked for 2 h at room temperature with TBST solution containing 5% bovine serum albumin before being treated with primary antibodies overnight at 4°C. The primary antibodies were PCNA (1:1000, ab29, Abcam, Cambridge, UK), p-mTOR (1:1000, AP0490, ABclonal Biotechnology Co., Ltd., Wuhan, China), mTOR (1:1000, A2445, ABclonal Biotechnology Co., Ltd., Wuhan, China), p-AKT (1:1000, 966l, Cell Signaling), AKT (1:1000, 13038s, Cell Signaling, USA), PI3K (1:1000, AB2757501, ABclonal Biotechnology Co., Ltd., Wuhan, China), IGF-1R (1:1000, 20254-1-AP, Proteintech Group, Inc., IL, USA), β-actin (1:5000, 66009, Proteintech Group, Inc., IL). The membranes were treated with a secondary antibody (1:5000, AS003, AS014, ABclonal Biotechnology Co., Ltd., Wuhan, China) after being washed with TBST buffer 4 times. Finally, the blots were visualized and normalized according to the method described by Dai et al. (2021). The intensities of the immunoreactive bands were quantified by Image J V.1.54 (National Institutes of Health, Bethesda, MD) to estimate the protein expressions.

Bacterial DNA Extraction and High-Throughput Amplicon Sequencing

The genomic DNA in the intestinal digesta samples was extracted using the TIANamp stool DNA kit (DP328, TIANGEN Biotechnology, Beijing, China) following the manufacturer's protocol. The DNA concentration was quantified by the Qubit Fluorometer with a Qubit dsDNA BR assay kit (Invitrogen, Waltham, MA), and the DNA quality was detected by the agarose gel electrophoresis. The targets in V4 variable region of bacterial 16S rRNA gene was amplified from the extracted DNA by the polymerase chain reaction (PCR). The PCR primers are 515F (5′-GTG CCAGCMGCC GCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). The primers were labelled with adapter, pad, and linker sequences. The PCR procedure following the steps of Lin, et al. (2021). Then the products followed the steps of purified, quantified, and homogenization to form a sequencing library for Illumina HiSeq 2500 platform (Illumina, San Diego, CA). All those steps were conducted at BGI Genomics, Shenzhen, China.

Bioinformatics Analysis

Raw sequencing reads were filtered using Cutadapt (version 2.6) (Martin, 2011) to obtain clean data. Bacterial amplicon sequence variants (ASVs) were generated using the Qiime2 pipeline v.2022.2 (Bolyen, 2019) and annotated with the SILVA database (version 138) (Quast et al., 2013). Next, the rarefaction curve, alpha diversity, and beta diversity of samples were analysed with phyloseq v.1.38.0 (McMurdie and Holmes, 2013) of R software (version 4.1.2.) and MicrobiotaProcess (version 1.6.6) (Xu et al., 2023), the specific steps of visualization were referred to the methods of Liu, et al. (2021). Differential bacteria between groups were analysed using the linear discriminant analysis (LDA) effect size (LEfSe) analysis (Segata et al., 2011).

Statistical Analysis

Data were analyzed by one-way ANOVA using SPSS (version 24.0, SPSS Inc., Chicago, IL). Results were described as the mean ± SEM. P < 0.05 was considered to be statistically significant.

RESULTS

Growth Performance and Organ Weight

The effects of maternal dietary HF on the growth performance and organ weight of the chicks have presented in Table 3. In comparison with CON group, the body weight of chicks was increased in HHF group at d 1, 14, and 28 (P < 0.05). Dietary addition of HF in the diet of breeder hens significantly improved the feed conversion ratio of HHF group in 3 phases including d 1 to 14 (P = 0.026), d 14 to 28 (P = 0.037), and d 1 to 28 (P = 0.029). Besides, dietary HF significantly increased the average daily gain of HHF group in 3 phases including d 1 to 14 (P = 0.046), d 14 to 28 (P = 0.014) and d 1 to 28 (P = 0.017), but no difference was found in the average daily feed intake among the three groups during the whole experimental period. Maternal dietary supplementation of 60 mg/kg HF can significantly increase the breast muscle weight at d 14 (P < 0.05). Nevertheless, the weight of liver and spleen among the 3 groups at d 1 and 14 showed no significant differences.

Table 3.

Effects of maternal dietary HF on the growth performance and organ weight.

Items	Groups			P-value
	CON	LHF	HHF
Body Weight (g)
1 d	39.01 ± 0.43b	39.95 ± 0.30ab	40.19 ± 0.32a	0.031
14 d	226.10 ± 4.65b	238.79 ± 5.69ab	245.36 ± 4.22a	0.026
28 d	497.71 ± 15.67b	532.69 ± 16.94ab	558.01 ± 8.69a	0.042
Growth performance
Average daily gain (g/d)
1 to 14 d	13.36 ± 0.30b	14.27 ± 0.38ab	14.66 ± 0.28a	0.046
14 to 28 d	19.40 ± 0.79b	20.99 ± 0.81ab	22.34 ± 0.32a	0.014
1 to 28 d	16.38 ± 0.54b	17.63 ± 0.60ab	18.85 ± 0.30a	0.017
Average daily feed intake (g/d)
1 to 14 d	32.46 ± 0.28	32.82 ± 0.53	32.69 ± 0.17	0.869
14 to 28 d	53.96 ± 1.55	55.36 ± 1.37	56.42 ± 0.89	0.174
1 to 28 d	43.21 ± 0.64	44.09 ± 0.78	44.55 ± 0.43	0.472
Feed conversion ratio
1 to 14 d	2.43 ± 0.14a	2.30 ± 0.08ab	2.23 ± 0.11b	0.026
14 to 28 d	2.78 ± 0.08a	2.63 ± 0.16ab	2.53 ± 0.09b	0.037
1 to 28 d	2.61 ± 0.09a	2.47 ± 0.12b	2.38 ± 0.08b	0.029
Organ weight
Liver (g)
1 d	0.48 ± 0.01	0.52 ± 0.01	0.51 ± 0.02	0.134
14 d	3.75 ± 0.18	4.12 ± 0.27	3.65 ± 0.15	0.357
Spleen (g)
1 d	0.02 ± 0.002	0.019 ± 0.002	0.019 ± 0.002	0.521
14 d	0.47 ± 0.04	0.47 ± 0.03	0.46 ± 0.05	0.278
Breast muscle (g)
1 d	0.35 ± 0.01	0.35 ± 0.02	0.36 ± 0.02	0.788
14 d	10.19 ± 0.26b	10.50 ± 0.24ab	11.57 ± 0.40a	0.042

CON, mother generation fed with a basic corn-soybean diet; LHF, mother generation fed with a basic corn-soybean diet supplemented with 30 mg/kg hawthorn-leaf flavonoid; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid. Data are presented as mean value ± SEM (n = 6). Without the same mark (a, b) represent statistically significant differences (P < 0.05).

Serum Biochemical Parameters and IGF-1 Level

Table 4 showed the effects of maternal dietary HF on the serum biochemical and hormone of male chicks. Serum concentrations of low-density lipoprotein cholesterol were decreased on d 1 in the LHF and HHF groups (P < 0.05). The serum IGF-1 level was increased in HF treatment groups on d 1(P < 0.05). On d 14, there was no significant difference in the serum concentration of triglyceride, cholesterol, low-density lipoprotein cholesterol and IGF-1 among the three groups.

Table 4.

Effects of maternal dietary HF on the serum biochemical and IGF-1 level of male chicks.

Items	Groups			P-value
	CON	LHF	HHF
1-day-old
TG (mmol/L)	0.81 ± 0.13	0.83 ± 0.14	0.79 ± 0.16	0.967
T-CHO (mmol/L)	5.13 ± 0.54	5.21 ± 0.53	5.26 ± 0.31	0.988
LDL-C (mmol/L)	2.11 ± 0.28a	1.18 ± 0.15b	1.20 ± 0.18b	0.007
HDL-C (mmol/L)	129 ± 9	141 ± 5	140 ± 6	0.425
IGF-1 (ng/ml)	276 ± 8b	323 ± 11a	312 ± 10a	0.010
14-day-old
TG (mmol/L)	0.79 ± 0.24	0.69 ± 0.14	0.59 ± 0.21	0.774
T-CHO (mmol/L)	5.73 ± 0.39	5.10 ± 0.48	4.84 ± 0.38	0.345
LDL-C (mmol/L)	1.86 ± 0.16	1.72 ± 0.12	1.83 ± 0.11	0.606
HDL-C (mmol/L)	95 ± 3	83 ± 7	94 ± 2	0.139
IGF-1 (ng/ml)	325 ± 7	312 ± 19	333 ± 18	0.631

TG, triacylglycerol; T-CHO, total cholesterol; LDL-C, low density lipoprotein; HDL-C, high-density lipoprotein; IGF-1, Insulin-like growth factor 1. CON, mother generation fed with a basic corn-soybean diet; LHF, mother generation fed with a basic corn-soybean diet supplemented with 30 mg/kg hawthorn-leaf flavonoid; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid. Data are presented as mean value ± SEM (n = 6). No identical mark (a, b) indicates a statistically significant difference (P < 0.05).

Jejunum Morphology

Intestinal development is the basis of nutrient digestion and absorption. Thus, we performed HE staining to observe the effects of maternal HF intake on the jejunum morphology of 1 and 14-day-old chicks (Figure 1A). We observed that the villus height to crypt depth ratio (VCR) in the HHF group was increased on d 1 and 14 compared to the CON group (Figure 1D) (P < 0.05). Compared to the CON group, the CD in the HHF group was significantly reduced at d 1 (Figure 1C) (P < 0.05).

Figure 1.

Representative photomicrographs of jejunum morphology in progeny (A). Statistical analysis of the villus height (B), crypt depth (B) and villus height to crypt depth ratio (D) of offspring. The gene expression related to tight junction on 1 (E) and 14 (F) d chicks. ZO, zonula occludens; claudin, tight junction protein claudin; E-Cadherin, epithelial cadherin. CON, mother generation fed with a basic corn-soybean diet; LHF, mother generation fed with a basic corn-soybean diet supplemented with 30 mg/kg hawthorn-leaf flavonoid; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid. Data are presented as mean value ± SEM (n = 6). Bars with different letters (a, b) indicate significant difference (P < 0.05).

Gene Expression Levels Related to Tight Junction in Jejunum

The tight junction is the physical barrier in the body against pathogenic invasion. As shown in the Figure 1, the mRNA expression of ZO-1, ZO-2, and Occludin in the jejunum of HHF group were much higher than that in the CON group at 1-day-old chicks (P < 0.05) (Figure 1E). Moreover, the ZO-1 and Claudin-1 mRNA expression in the HHF group was up-regulated at d 14 (P < 0.05) (Figure 1F).

Protein Expression of PCNA and IGF-1R/mTOR /AKT Pathway

PCNA and IGF1-R/mTOR /AKT pathways are associated with proliferation and growth. As shown in the Figure 2, the expression of p-Akt /AKT, PI3K, p-mTOR, p-mTOR /mTOR, PCNA and IGF-1R proteins in jejunum of HHF group were significantly increased at 1-day-old chicks (P < 0.05). In the 14-day-old birds, maternal dietary supplementation of 60 mg/kg HF elevated the protein expression of p-AKT, PI3K, p-mTOR/mTOR, PCNA and IGF-1R in the jejunum (P < 0.05).

Figure 2.

Effects of maternal dietary HF on the protein expression. mTOR, mammalian target of rapamycin; PI3K, phosphoinositide 3 kinase; Akt, protein kinase B; PCNA, proliferating cell nuclear antigen; IGF-1R, insulin-like growth factor 1 receptor. CON, mother generation fed with a basic corn-soybean diet; LHF, mother generation fed with a basic corn-soybean diet supplemented with 30 mg/kg hawthorn-leaf flavonoid; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid. Data are presented as mean value ± SEM (n = 6). Bars with different letters (a, b) indicate significant difference (P < 0.05).

Structure of the Microbiota

The rarefaction curves indicated good sequencing coverage of jejunum samples (Figure 3B). In addition, the microbial diversity of jejunum among the 3 groups was assessed by alpha and beta diversity. Chao1, ACE, Shannon, and Simpson were used to estimate the alpha diversity. The community richness (ACE and Chao1) and diversity (Shannon and Simpson) of jejunum among the three groups showed no difference (P > 0.05) (Figure 3A). From the Bray-Curtis distance PCoA of the jejunum (Figure 3C), we observed that the microbial communities were clustered into 2 different types of communities (P < 0.05).

Figure 3.

Alpha diversity analysis (A) of jejunum microbial communities between CON and HHF groups. Rarefaction curve of the jejunum (B). Principal coordinates analysis (PCoA) of the jejunum (C) based on Bray-Curtis distance. Relative abundance of the bacteria at the phylum (D) and genus (E) level in the jejunum. Cladogram indicating statistical differences of the jejunum microbial populations between CON and HHF (F). Linear discriminant analysis (LDA) score distribution of the jejunum microorganisms between CON and HHF (G). CON, mother generation fed with a basic corn-soybean diet; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid.

The bacterial relative abundance at the phylum and genus levels in the meconium were shown in Figure 3, Figure 3. HF treatments had no effect on the relative abundance of bacteria at phylum level (P > 0.05) (Table 5). In the genus level, maternal HF supplementation increased the relative abundance of Clostridium_sensu_stricto_1 and Epulopiscium in the meconium (P < 0.05), whereas there was a decline in the abundance of Terrisporobacter (P = 0.085), but it is not significant. We also employed the LEfSe analysis to explore the distinctive bacteria between the two groups (P < 0.05, LDA score > 2) (Figures 3F and 3G). The results indicated that the relative abundance of Clostridium_sensu_stricto_1, Clostridiaceae, Clostridiales, Enterobacteriaceae, Escherichia-Shigella, and Enterobacterales were higher in the HHF group. Nevertheless, the CON group had higher proportion of Terrisporobacter, Peptostreptococcaceae, and Peptostreptococcales_Tissierellales.

Table 5.

Effects of maternal HF supplementation on the relative abundance of bacteria at phylum and genus level in the meconium of chicks.

Items	Groups		P-value
	CON	HHF
Phylum
Firmicutes	98.31 ± 2.41	98.50 ± 0.79	0.877
Proteobacteria	1.22 ±1.98	1.16 ± 0.55	0.952
Genus
Clostridium_sensu_stricto_1	57.26 ± 14.60b	74.04 ± 2.95a	0.036
Enterococcus	25.95 ± 17.09	14.57 ± 2.31	0.178
Terrisporobacter	7.77 ± 5.12	3.13 ± 1.25	0.085
Staphylococcus	4.69 ± 2.70	3.14 ± 2.56	0.381
Epulopiscium	1.67 ± 0.74b	2.94 ± 0.64a	0.043
Escherichia-Shigella	0.32 ± 0.27	0.63 ± 0.29	0.118

CON, mother generation fed with a basic corn-soybean diet; HHF, mother generation fed with a basic corn-soybean diet supplemented with 60 mg/kg hawthorn-leaf flavonoid. Data are presented as mean value ± SD (n = 5). No identical mark (a, b) indicates a statistically significant difference (P < 0.05).

DISCUSSION

Maternal flavonoid supplementation can intergenerationally promote the development and metabolism of offspring. In the present experiment, adding 60 mg/kg HF to the diet of hens increased the body weight and breast muscle weight of offspring, which was in agreement with Gao, et al. (2023) who fed 20 mg/kg (powder) genistein for breeder hens. The increased body weight and breast muscle weight may be related to the higher serum IGF-1 levels in the offspring of the HF treatment group. IGF-1 is an important growth factor and has been demonstrated to stimulate cell proliferation and differentiation. Chen, et al. (2016) reported that subcutaneous injection of puerarin (50 mg/kg per day) in the abdomen of pregnant rat could alleviate the intrauterine growth restriction of the fetus induced by a low-protein diet by increasing the level of IGF-1 hormone. Similarly, Lv, et al. (2018a) found that maternal dietary supplementation with 40 mg/kg genistein (power) facilitated embryo development by activating the IGF signaling pathway. Moreover, some research pointed out that maternal supplementation with flavonoids (i.e., genistein and cyanidin-3-O-glucoside) can influence the lipid and carbohydrate metabolism of offspring through epigenetic modifications (Li et al., 2019; Lv et al., 2019; Persico et al., 2021). Coincidentally, we found that maternal HF treatment reduced the serum low-density lipoprotein cholesterol level of 1-day-old chicks. These results suggested that supplementing HF for breeder hens could regulate the growth and metabolism of chicks, but the mechanism is still unclear and needs to be investigated in the future.

Intestinal morphology is vital for nutrient absorption and epithelial barrier function. The villus height, crypt depth, and ratio between villus height to crypt depth are the indicators of intestinal morphology, and these indicators have a positive relationship with the growth performance of animals during the fattening period (Wijtten et al., 2012; Lu et al., 2019). It is reported that broilers with shorter jejunum crypt depth have better growth performance and feed conversion ratio (Wang et al., 2015). In the present study, dietary HF supplementation for aged breeder hens decreased crypt depth and increased villus height in offspring chicks, and these alterations were positively correlated with chick growth performance. It is reported that the shorter crypt depth reduces the energy and protein consumption for continually renewing intestinal epithelium cells, thus sparing more resources for gaining weight (Marković et al., 2009). In addition, the increased villus height can enhance the contact between the intestine and chyme, which is conducive to the digestion and absorption of nutrients (Habegger et al., 2014). Accumulating evidence suggests that maternal flavonoid diet can alter intestinal health in offspring. Similar results were also found in offspring by Liu, et al. (2020b) who fed 100 mg/kg of quercetin (power) to the pregnant mice challenged with fine particulate matter. These results could be because maternal flavonoids shaped the intestinal bacterial community structure. In the present experiment, the relative abundance of Epulopiscium was increased in the chicks, which could degrade polysaccharides into substrates that can be fermented to acetic acid (Sannino et al., 2023), thereby supporting cell renewal and promote digestive enzyme activities (Wang et al., 2018). An increase in acetic acid producing Clostridiaceae was observed in the offspring, which could support this inference in the present experiment.

Tight junctions are an important part of the intestinal physical barrier, which plays a crucial role in maintaining the permeability of the intestinal epithelium and preventing the invasion of exogenous pathogens (Altunbulakli et al., 2018; Blasig and Haseloff, 2011). Zhou, et al. (2018) described that supplementation of genistein in a maternal high-fat diet can improve the birth weight and intestinal barrier of filial generation. Similarly, our data showed that maternal HF supplementation up-regulated the mRNA expression of tight junction-related genes (ZO-1, occludin and claudin-1). This result may be closely related to the increased birth weight of offspring chicks after the mother received HF treatment. Previous studies have found that birth weight is positively associated with tight junction protein (i.e., ZO-1 and occludin) expression and growth potential in the fattening stage (Tao et al., 2019). The greater growth performance of offspring in the present experiment also supports this finding. Thus, maternal HF treatment can improve the intestinal barrier function of chicks, and this improvement shows close association with the increased birth weight.

Intestinal development at early age has a strong relationship with the intestinal barrier and morphology (Tang et al., 2016). It is reported that PCNA is a marker of mitosis and has positive connections with enterocyte proliferation (Jiang et al., 2019). In the present experiment, the upregulated protein expression of PCNA in 1 and 14-day-old chicks would be one reason for the improved intestinal barrier and morphology. Some studies have indicated that flavonoids can induce protein synthesis and cell growth by activating the IGF-1R/AKT/mTOR signaling pathway, and then play a role in promoting the differentiation of osteoblasts and muscle cells (Li et al., 2005; Yang et al., 2010; Wimmer et al., 2015). Moreover, mTOR and Akt promoted the intestinal development in the intrauterine growth retarded piglets (Wang et al., 2012). Our data showed that maternal HF treatment activated the IGF-1R/AKT/mTOR signaling pathway in the jejunum of chicks, including the increased serum IGF1 level and up-regulated expression of IGF1R, AKT, PI3K, and p-mTOR/mTOR in the intestine. These results may have a positive collection with the increased relative abundance of Clostridiaceae in the intestine of neonates. Liu, et al. (2020a) reported that Clostridiaceae could activate the Akt/mTOR signaling pathway in the intestinal epithelial, and then promote the development of the intestinal barrier. Collectively, these results indicated that maternal HF effect might promote intestinal development of offspring chicks by activating IGF-1R/AKT/mTOR signaling pathways.

The intestinal microbiota can impact host health, metabolism and immunity in various ways. Early gut colonizers in the infant's gut are the key to shaping the microbial community structure, which can have a long-term impact on the health and growth performance of chickens. Xiao, et al. (2021) reported that the diversity and richness of gut microbiota were low in newly hatched chicks. It has been proved that gut barrier dysfunction is an early or initiating step in the communication of bacterial diversity changes to the host (Ghosh et al., 2020). Similar results were also found in present experiment, but the bacterial diversity was increased in the HF treatment group, which explained the improved intestinal barrier function. Previous studies found that facultative anaerobes (i.e., Proteobacteria and Escherichia-Shigella) have priority for rapid colonization in the intestine, which may be related to the fact that the gut of newborn animals still contains some oxygen (Xiao et al., 2021). Results of the present experiment showed that facultative anaerobes were the dominant microbial community in meconium, which was in agreement with Gao, et al. (2023), who fed 20 mg/kg (powder) genistein to breeder hens in the late egg-laying period. Moreover, the composition of microbial community in the gut plays an important role in the digestion and absorption of nutrients and regulation of immunity. In the present research, HF supplementation to the maternal diet increased the relative abundance of Clostridium_sensu_stricto_1 in the meconium of the offspring. It is reported that Clostridium_sensu_stricto_1 could maintain the mucosal barrier by thickening the inner mucus layer (Wlodarska et al., 2015). In addition, the thickened mucus layer can promote the expression and activity of tight junction proteins (Ma et al., 2022), which explains the improved intestinal epithelial barrier and morphology in the offspring. Additionally, some studies have reported that Clostridium_sensu_stricto_1 can activate the PI3K/Akt/mTOR pathway by producing a metabolic product called disaccharides (Li et al., 2022; Mohseni et al., 2021). The numerical increase of Clostridium_sensu_stricto_1 caused by maternal HF would be one reason for the better intestinal development. Thus, maternal HF supplementation can regulate the intestinal bacterial community of neonates, which might improve the development and health of chicks.

CONCLUSIONS

In conclusion, maternal HF effect can increase the growth performance of offspring chicks. Interestingly, supplementing HF for breeder hens can alter the intestinal bacterial community of neonates, and promotes the intestinal development of chicks by activating the IGF-1R/AKT/mTOR signal pathway. The maternal effect can last until at least 14-day-old. Our research revealed the maternal effects of HF on the development of offspring, which can provide a theoretical basis for dietary adjustments in animals during pregnancy.

DISCLOSURES

The authors declare no conflicts of interest.