Abstract
Aberrant endoplasmic reticulum (ER) and inner nuclear membrane (INM) proteins are destroyed through ER-associated degradation (ERAD) and INM-associated degradation (INMAD). We previously showed the Hrd1, Doa10, and Asi ERAD and INMAD ubiquitin ligases (E3s) in Saccharomyces cerevisiae confer resistance to hygromycin B, which distorts the ribosome decoding center. Here, we assessed the requirement of Ubc6 and Ubc7, the primary ERAD and INMAD ubiquitin-conjugating enzymes (E2s) for hygromycin B resistance. Loss of either E2 sensitized cells to hygromycin B, with UBC7 deletion having a greater impact, consistent with characterized roles for Ubc6 and Ubc7 in ER and INM protein quality control.
Figure 1. UBC6 and UBC7 confer resistance to hygromycin B .
(A) Endoplasmic Reticulum (ER)-Associated Degradation and Inner Nuclear Membrane (INM)-Associated Degradation pathways. In conjunction with the E2 Ubc7, the E3 Hrd1 promotes degradation of aberrant ER luminal and transmembrane proteins as well as proteins that clog ER translocons. The E3 Doa10 functions with two E2s, Ubc6 and Ubc7, to mediate degradation of aberrant transmembrane proteins at the ER or INM in addition to soluble cytosolic or nucleoplasmic proteins. The trimeric Asi E3 complex (Asi1, Asi2, and Asi3) works with Ubc6 and Ubc7 to target aberrant transmembrane INM and soluble nucleoplasmic proteins. Ubc7 is anchored at the ER membrane through interaction with Cue1. Ub, ubiquitin. (B) and (C) Sixfold serial dilutions of yeast of the indicated genotype were spotted on medium lacking (No Drug) or containing increasing concentrations of hygromycin B. Plates were incubated at 30°C and imaged after 1-2 days. Experiments were performed three or more times.
Description
Degradation of misfolded, excess, and otherwise aberrant proteins is critical for cellular homeostasis. The ability to recognize and destroy faulty proteins declines with age, and disruptions to enzymes contributing to protein quality control (PQC) contribute to several diseases (Badawi et al., 2023; Guerriero & Brodsky, 2012) . Eukaryotic cells possess compartment-specific PQC mechanisms, including those dedicated to the turnover of aberrant proteins at the physically continuous endoplasmic reticulum (ER) membrane and inner nuclear membrane (INM) (Mehrtash & Hochstrasser, 2019) . ER-associated degradation (ERAD) promotes turnover of aberrant ER luminal, transmembrane, and translocon-clogging proteins as well as cytosolic polypeptides that contact the ER surface. INM-associated degradation (INMAD) mediates proteolysis of faulty INM transmembrane and INM-abutting soluble nucleoplasmic proteins. ERAD and INMAD both employ ubiquitin-conjugating enzymes (E2s) and ubiquitin ligases (E3s) to polyubiquitylate proteins ( Figure 1A ), destining them for destruction by cytosolic or nucleoplasmic proteasomes.
The highly conserved transmembrane Hrd1 and Doa10 E3s mediate ERAD in Saccharomyces cerevisiae , targeting distinct classes of aberrant proteins for degradation based on the location and nature of the degradation signals (degrons) (Carvalho et al., 2006; Huyer et al., 2004; Metzger et al., 2008; Rubenstein et al., 2012; Runnebohm, Richards, et al., 2020; Sato et al., 2009) . Doa10 also functions in INMAD alongside the heterotrimeric Asi E3 (composed of Asi1, Asi2, and Asi3) (Deng & Hochstrasser, 2006; Foresti et al., 2014; Khmelinskii et al., 2014) . Loss of either Asi1 or Asi3 abolishes Asi PQC function (Foresti et al., 2014; Woodruff et al., 2021) . Hrd1, Doa10, and the Asi complex have partially overlapping E2 dependencies. Hrd1 functions primarily with the soluble E2 Ubc7 (human homolog, UBE2G2), which is anchored at the membrane by the transmembrane protein Cue1 (Bays et al., 2001; Lips et al., 2020; Plemper et al., 1999) . By contrast, Doa10 and Asi use two E2s, Ubc7 and the transmembrane Ubc6 (human homolog, UBE2J2) (Foresti et al., 2014; Khmelinskii et al., 2014; Swanson et al., 2001) . Ubc6 and Ubc7 participate in a sequential ubiquitylation mechanism, with Ubc6 “priming” substrates with an initial ubiquitin molecule and Ubc7 elongating polyubiquitin chains (Lips et al., 2020; Weber et al., 2016) . It is likely that additional E2s contribute to a lesser extent to ERAD and INMAD. For example, in some circumstances, the E2 Ubc1 partially compensates for impaired Ubc7 function in promoting Hrd1 substrate ubiquitylation (Bays et al., 2001) .
The aminoglycoside hygromycin B binds to and distorts the ribosome A site, thereby likely increasing the frequency of mistranslation and generation of PQC substrates (Brodersen et al., 2000; Ganoza & Kiel, 2001) . Mutation of genes encoding several proteins with documented or predicted PQC function causes hygromycin B hypersensitivity (Bengtson & Joazeiro, 2010; Chuang & Madura, 2005; Daraghmi et al., 2023; Flagg et al., 2023; Jaeger et al., 2018; Turk et al., 2023; Verma et al., 2013) . Indeed, we have previously shown that loss of several ubiquitin ligases, including Hrd1, Doa10, Asi1, or Asi3, sensitizes cells to hygromycin B (Crowder et al., 2015; Doss et al., 2022; Niekamp et al., 2019; Runnebohm, Evans, et al., 2020; Woodruff et al., 2021) . A role for Ubc6 and Ubc7 in combatting hygromycin B-induced proteotoxic stress has not been demonstrated. Given their functions as the major characterized E2s in ERAD and INMAD, we predicted loss of either enzyme would reduce fitness in the presence of this drug.
To assess the roles of Ubc6 and Ubc7 in combatting proteotoxic stress caused by hygromycin B, we cultured serial dilutions of wild type yeast, yeast lacking UBC6 and UBC7 individually or in concert, as well as a yeast strain rendered broadly defective for ERAD and INMAD by simultaneous deletion of HRD1 , DOA10 , and ASI1 ( Figure 1B ). All strains grew similarly in the absence of hygromycin B. Loss of either UBC6 or UBC7 sensitized yeast to hygromycin B, with UBC7 deletion having a stronger impact. Combined deletion of both UBC6 and UBC7 caused a greater growth defect than individual absence of either E2-encoding gene. Finally, hrd1 Δ doa10 Δ asi1 Δ yeast exhibited a more profound growth defect than any E2 mutant.
To validate these results, we assessed hygromycin B sensitivity of ubc6 Δ and ubc7 Δ yeast strains in a distinct genetic background, as well as three double mutants lacking catalytic components of the ERAD or INMAD E3s ( Figure 1C ). As before, loss of either E2 sensitized yeast to hygromycin B, with cells lacking Ubc7 faring more poorly than those without Ubc6. Loss of any two ERAD or INMAD E3s approximately phenocopied ubc7 Δ yeast.
A greater role for Ubc7 than Ubc6 in combatting proteotoxicity likely reflects broader Ubc7 participation in ERAD and INMAD. Loss of Ubc6 is expected to compromise Doa10 and Asi function, while UBC7 deletion is predicted to abolish all three major branches of ERAD and INMAD. The observation that ubc6 Δ ubc7 Δ double mutant yeast exhibit a stronger growth defect than either ubc6 Δ or ubc7 Δ single mutant suggests independent functions for both Ubc6 and Ubc7. Identification of Ubc6-dependent, Ubc7-independent PQC substrates would support this model. Further, an enhanced growth defect of hrd1 Δ doa10 Δ asi1 Δ compared to ubc6 Δ ubc7 Δ yeast is in agreement with other reports indicating additional E2s (such as Ubc1) may function with ERAD and INMAD E3s, when the primary E2s are unavailable.
Our data are consistent with a previous study demonstrating overexpression of genes encoding either E2 enhances resistence to multiple stresses, including heat stress, oxidative stress, and presence of the toxic amino acid analog canavanine (Hiraishi et al., 2006) . Conversely, previous work showed that ubc7 Δ and hrd1 Δ doa10 Δ yeast exhibited similar hypersensitivity to cadmium (Swanson et al., 2001) . Large-scale analyses indicated loss of UBC7 reduces tolerance to multiple transition metals, which oxidatively damage a range of biological macromolecules, including proteins (Bleackley et al., 2011; Ruotolo et al., 2008; Zhao et al., 2020) , and genotoxic agents (Alamgir et al., 2010; Brown et al., 2006; Gaytan et al., 2013; Kapitzky et al., 2010) . We note hygromycin B hypersensitivity was not observed for ubc6 Δ or ubc7 Δ yeast in a previous report (Chuang & Madura, 2005) . This may be due to differences in effective drug concentrations in culture medium. In alignment with our results, we have also recently shown that loss of Doa10, Hrd1, and Ubc7 homologs sensitizes the pathogenic fungi Candida albicans to hygromycin B (Doss et al., 2023) . Overall, our work supports a critical and conserved function for endoplasmic reticulum and inner nuclear membrane ubiquitin-conjugating enzymes in protein quality control.
Methods
Growth assays
Yeast growth was analyzed as previously described (Watts et al., 2015) . Briefly, sixfold dilutions of each yeast strain were spotted onto yeast extract-peptone-dextrose medium (Guthrie & Fink, 2004) lacking or containing hygromycin B (Gibco) at the indicated concentrations and incubated at 30°C for the indicated amount of time.
ASI3 gene replacement
To generate yeast strains VJY409 and VJY410, ASI3 was replaced by natMX4 through homologous recombination. A 1464-bp nat4MX4 cassette with termini possessing sequences flanking the ASI3 gene was PCR-amplified from pAG25 (Goldstein & McCusker, 1999) using primers VJR274 (5’ AGGAACAGTCATTACGTAGGGATTTTCAAAAGTTTGACTGCACATACGATTTAGGTGACAC) and VJR275 (5’ TCCTATGATGTCTTAAATACGTATACCTAATAAAATAATTAATACGACTCACTATAGGGAG 3’). The natMX4 cassette was introduced into VJY22 ( hrd1 Δ ::kanMX4 ) yeast and VJY102 ( doa10 Δ ::kanMX4 ) by lithium acetate transformation (Guthrie & Fink, 2004) . Successful integration in nourseothricin-resistant clones were verified by PCR at the 5’ and 3’ recombination junctions, and genotypes at the DOA10 , HRD1 , and ASI3 loci were PCR validated for both strains.
Reagents
Yeast strains used in this study.
|
Name |
Genotype |
Figure or purpose |
Reference |
|
VJY6 (alias MHY500) |
MATa his3- Δ 200 leu2-3,112 ura3-52 lys2-801 trp1-1 gal2 |
1B |
|
|
VJY22 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3Δ0 hrd1 Δ:: kanMX4 |
Used to generate VJY409 |
|
|
VJY44 (alias MHY496) |
MATa his3- Δ 200 leu2-3,112 ura3-52 lys2-801 trp1-1 gal2 ubc6- Δ 1 :: HIS3 |
1B |
|
|
VJY50 (alias MHY551) |
MATa his3- Δ 200 leu2-3,112 ura3-52 lys2-801 trp1-1 gal2 ubc7 Δ:: LEU2 |
1B |
|
|
VJY102 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 doa10 Δ:: kanMX4 |
Used to generate VJY410 |
|
|
VJY305 (alias SKY252) |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 doa10 Δ:: kanMX4 hrd1 Δ:: kanMX4 |
1C |
|
|
VJY409 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 hrd1 Δ:: kanMX4 asi3 Δ:: natMX4 |
1C |
This study |
|
VJY410 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 doa10 Δ:: kanMX4 asi3 Δ:: natMX4 |
1C |
This study |
|
VJY476 (alias BY4741) |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 |
1C |
|
|
VJY723 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ubc6 Δ:: kanMX4 |
1C |
|
|
VJY1075 |
MATa his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ubc7 Δ:: kanMX4 |
1C |
|
|
VJY1096 (alias MHY553) |
MATa his3- Δ 200 leu2-3,112 ura3-52 lys2-801 trp1-1 gal2 ubc6 Δ:: HIS3 ubc7 Δ:: LEU2 |
1B |
|
|
VJY1098 (MHY11132, ABM297) |
MATa his3- Δ 200 leu2-3,112 ura3-52 lys2-801 trp1-1 gal2 doa10 Δ:: HIS3 hrd1 Δ:: LEU2 asi1 Δ:: kanMX6 |
1B |
Acknowledgments
Acknowledgments
Experiments to determine sensitivity of ubc6 Δ yeast to hygromycin B were piloted by undergraduate students in the Fall 2022 Methods in Cell Biology (BIO 315) Course at Ball State University (Noah Bische, James Carty, Kieran Claypool, Natalie Coomer, Alexandria Deel, Emily Desai, Allison Dittmer, Grace Gilbert, Evan Gosnell, Bryce Harman, Kerrigan Huffman, Breanna Long, Dorcas Macanthony, Mildred Obungu, Dylan Seiler, Cole Strassburger) and validated in the research laboratory of EMR. We thank Evan Rogers for serving as a Teaching Assistant in BIO 315. We thank Christopher Hickey, Mark Hochstrasser, Stefan Kreft, and Adrian Mehrtash for generously sharing yeast strains. We thank the Saccharomyces Genome Database for thorough, organized, and up-to-date curation of yeast genetic information (Wong et al., 2023). We thank the Ball State University Division of Online and Strategic Learning for supporting an initiative to transform undergraduate laboratory courses into authentic research-based learning experiences. We dedicate this manuscript to Susan Calvin – thank you for you all you have done to promote student success (and to save reagents from failing freezers!). All the best for a fun and fulfilling retirement!
Funding Statement
<p>This work was funded by NIH grant R15 GM111713 (EMR). Work in the lab of PJS is funded by NIH grant R15 G067291 and NIH grant R15 CA252996. Work in the lab of ALK is funded by NINDS-1R15NS128837 and John’s Hopkins Merkin PNNR Seed Funds. KAP was supported by the Ball State University Teacher-Scholar Program and a Ball State University Pepsi Scholarship Summer Research Award. RMV was supported by a Research Grant from the Ball State University Chapter of Sigma Xi. SLO was supported by a Ball State University Graduate School Capstone Completion Fellowship. LFO and SLO were supported by Ball State University Aspire Student Research grants. Preliminary studies conducted in BIO 315 were funded by the Ball State University Department of Biology. This project was conceived while EMR was supported in part by a Ball State University Excellence in Teaching award (sponsored by the Ball State University Division of Online and Strategic Learning and the Office of the Provost).</p>
References
- Alamgir M, Erukova V, Jessulat M, Azizi A, Golshani A. Chemical-genetic profile analysis of five inhibitory compounds in yeast. BMC Chem Biol. 2010 Aug 6;10:6–6. doi: 10.1186/1472-6769-10-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Badawi S, Mohamed FE, Varghese DS, Ali BR. Genetic disruption of mammalian endoplasmic reticulum-associated protein degradation: Human phenotypes and animal and cellular disease models. Traffic. 2023 May 15;24(8):312–333. doi: 10.1111/tra.12902. [DOI] [PubMed] [Google Scholar]
- Bays NW, Gardner RG, Seelig LP, Joazeiro CA, Hampton RY. Hrd1p/Der3p is a membrane-anchored ubiquitin ligase required for ER-associated degradation. Nat Cell Biol. 2001 Jan 1;3(1):24–29. doi: 10.1038/35050524. [DOI] [PubMed] [Google Scholar]
- Bengtson MH, Joazeiro CA. Role of a ribosome-associated E3 ubiquitin ligase in protein quality control. Nature. 2010 Sep 12;467(7314):470–473. doi: 10.1038/nature09371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bleackley MR, Young BP, Loewen CJ, MacGillivray RT. High density array screening to identify the genetic requirements for transition metal tolerance in Saccharomyces cerevisiae. Metallomics. 2011 Jan 6;3(2):195–205. doi: 10.1039/c0mt00035c. [DOI] [PubMed] [Google Scholar]
- Brodersen DE, Clemons WM Jr, Carter AP, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V. The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell. 2000 Dec 22;103(7):1143–1154. doi: 10.1016/s0092-8674(00)00216-6. [DOI] [PubMed] [Google Scholar]
- Brown JA, Sherlock G, Myers CL, Burrows NM, Deng C, Wu HI, McCann KE, Troyanskaya OG, Brown JM. Global analysis of gene function in yeast by quantitative phenotypic profiling. Mol Syst Biol. 2006 Jan 17;2:2006.0001–2006.0001. doi: 10.1038/msb4100043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carvalho P, Goder V, Rapoport TA. Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins. Cell. 2006 Jul 28;126(2):361–373. doi: 10.1016/j.cell.2006.05.043. [DOI] [PubMed] [Google Scholar]
- Chen P, Johnson P, Sommer T, Jentsch S, Hochstrasser M. Multiple ubiquitin-conjugating enzymes participate in the in vivo degradation of the yeast MAT alpha 2 repressor. Cell. 1993 Jul 30;74(2):357–369. doi: 10.1016/0092-8674(93)90426-q. [DOI] [PubMed] [Google Scholar]
- Chuang SM, Madura K. Saccharomyces cerevisiae Ub-conjugating enzyme Ubc4 binds the proteasome in the presence of translationally damaged proteins. Genetics. 2005 Aug 22;171(4):1477–1484. doi: 10.1534/genetics.105.046888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crowder JJ, Geigges M, Gibson RT, Fults ES, Buchanan BW, Sachs N, Schink A, Kreft SG, Rubenstein EM. Rkr1/Ltn1 Ubiquitin Ligase-mediated Degradation of Translationally Stalled Endoplasmic Reticulum Proteins. J Biol Chem. 2015 Jun 8;290(30):18454–18466. doi: 10.1074/jbc.M115.663559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Daraghmi MM, Miller JM, Bailey CG, Doss EM, Kalinski AL, Smaldino PJ, Rubenstein EM. Macro-ER-phagy receptors Atg39p and Atg40p confer resistance to aminoglycoside hygromycin B in S. cerevisiae. MicroPubl Biol. 2023 Jan 31;2023 doi: 10.17912/micropub.biology.000738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deng M, Hochstrasser M. Spatially regulated ubiquitin ligation by an ER/nuclear membrane ligase. Nature. 2006 Oct 19;443(7113):827–831. doi: 10.1038/nature05170. [DOI] [PubMed] [Google Scholar]
- Doss EM, Moore JM, Harman BH, Doud EH, Rubenstein EM, Bernstein DA. Characterization of endoplasmic reticulum-associated degradation in the human fungal pathogen Candida albicans. PeerJ. 2023 Aug 25;11:e15897–e15897. doi: 10.7717/peerj.15897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doss EM, Tragesser-Tiña ME, Huang Y, Smaldino PJ, True JD, Kalinski AL, Rubenstein EM. APC/C (Cdh1p) and Slx5p/Slx8p ubiquitin ligases confer resistance to aminoglycoside hygromycin B in Saccharomyces cerevisiae. MicroPubl Biol. 2022 Mar 24;2022 doi: 10.17912/micropub.biology.000547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flagg MP, Lam B, Lam DK, Le TM, Kao A, Slaiwa YI, Hampton RY. Exploring the "misfolding problem" by systematic discovery and analysis of functional-but-degraded proteins. Mol Biol Cell. 2023 Sep 20;34(13):ar125–ar125. doi: 10.1091/mbc.E23-06-0248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Foresti O, Rodriguez-Vaello V, Funaya C, Carvalho P. Quality control of inner nuclear membrane proteins by the Asi complex. Science. 2014 Sep 18;346(6210):751–755. doi: 10.1126/science.1255638. [DOI] [PubMed] [Google Scholar]
- Ganoza MC, Kiel MC. A ribosomal ATPase is a target for hygromycin B inhibition on Escherichia coli ribosomes. Antimicrob Agents Chemother. 2001 Oct 1;45(10):2813–2819. doi: 10.1128/AAC.45.10.2813-2819.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gaytán BD, Loguinov AV, Peñate X, Lerot JM, Chávez S, Denslow ND, Vulpe CD. A genome-wide screen identifies yeast genes required for tolerance to technical toxaphene, an organochlorinated pesticide mixture. PLoS One. 2013 Nov 18;8(11):e81253–e81253. doi: 10.1371/journal.pone.0081253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goldstein AL, McCusker JH. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 1999 Oct 1;15(14):1541–1553. doi: 10.1002/(SICI)1097-0061(199910)15:14<1541::AID-YEA476>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
- Guerriero CJ, Brodsky JL. The delicate balance between secreted protein folding and endoplasmic reticulum-associated degradation in human physiology. Physiol Rev. 2012 Apr 1;92(2):537–576. doi: 10.1152/physrev.00027.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guthrie C., Fink G. R. 2004. Guide to Yeast Genetics and Molecular and Cell Biology. Elsevier, San Diego.
- Habeck G, Ebner FA, Shimada-Kreft H, Kreft SG. The yeast ERAD-C ubiquitin ligase Doa10 recognizes an intramembrane degron. J Cell Biol. 2015 Apr 27;209(2):261–273. doi: 10.1083/jcb.201408088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hickey CM, Breckel C, Zhang M, Theune WC, Hochstrasser M. Protein quality control degron-containing substrates are differentially targeted in the cytoplasm and nucleus by ubiquitin ligases. Genetics. 2021 Mar 3;217(1):1–19. doi: 10.1093/genetics/iyaa031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hiraishi H, Mochizuki M, Takagi H. Enhancement of stress tolerance in Saccharomyces cerevisiae by overexpression of ubiquitin ligase Rsp5 and ubiquitin-conjugating enzymes. Biosci Biotechnol Biochem. 2006 Nov 7;70(11):2762–2765. doi: 10.1271/bbb.60250. [DOI] [PubMed] [Google Scholar]
- Huyer G, Piluek WF, Fansler Z, Kreft SG, Hochstrasser M, Brodsky JL, Michaelis S. Distinct machinery is required in Saccharomyces cerevisiae for the endoplasmic reticulum-associated degradation of a multispanning membrane protein and a soluble luminal protein. J Biol Chem. 2004 Jul 12;279(37):38369–38378. doi: 10.1074/jbc.M402468200. [DOI] [PubMed] [Google Scholar]
- Jaeger PA, Ornelas L, McElfresh C, Wong LR, Hampton RY, Ideker T. Systematic Gene-to-Phenotype Arrays: A High-Throughput Technique for Molecular Phenotyping. Mol Cell. 2018 Jan 18;69(2):321–333.e3. doi: 10.1016/j.molcel.2017.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kapitzky L, Beltrao P, Berens TJ, Gassner N, Zhou C, Wüster A, Wu J, Babu MM, Elledge SJ, Toczyski D, Lokey RS, Krogan NJ. Cross-species chemogenomic profiling reveals evolutionarily conserved drug mode of action. Mol Syst Biol. 2010 Dec 21;6:451–451. doi: 10.1038/msb.2010.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khmelinskii A, Blaszczak E, Pantazopoulou M, Fischer B, Omnus DJ, Le Dez G, Brossard A, Gunnarsson A, Barry JD, Meurer M, Kirrmaier D, Boone C, Huber W, Rabut G, Ljungdahl PO, Knop M. Protein quality control at the inner nuclear membrane. Nature. 2014 Dec 18;516(7531):410–413. doi: 10.1038/nature14096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lips C, Ritterhoff T, Weber A, Janowska MK, Mustroph M, Sommer T, Klevit RE. Who with whom: functional coordination of E2 enzymes by RING E3 ligases during poly-ubiquitylation. EMBO J. 2020 Oct 5;39(22):e104863–e104863. doi: 10.15252/embj.2020104863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mehrtash AB, Hochstrasser M. Ubiquitin-dependent protein degradation at the endoplasmic reticulum and nuclear envelope. Semin Cell Dev Biol. 2018 Oct 9;93:111–124. doi: 10.1016/j.semcdb.2018.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mehrtash AB, Hochstrasser M. Ectopic RING activity at the ER membrane differentially impacts ERAD protein quality control pathways. J Biol Chem. 2023 Jan 19;299(3):102927–102927. doi: 10.1016/j.jbc.2023.102927. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Metzger MB, Maurer MJ, Dancy BM, Michaelis S. Degradation of a cytosolic protein requires endoplasmic reticulum-associated degradation machinery. J Biol Chem. 2008 Sep 23;283(47):32302–32316. doi: 10.1074/jbc.M806424200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niekamp JM, Evans MD, Scott AR, Smaldino PJ, Rubenstein EM. TOM1 confers resistance to the aminoglycoside hygromycin B in Saccharomyces cerevisiae . . MicroPubl Biol. 2019 Dec 6;2019 [PMC free article] [PubMed] [Google Scholar]
- Plemper RK, Bordallo J, Deak PM, Taxis C, Hitt R, Wolf DH. Genetic interactions of Hrd3p and Der3p/Hrd1p with Sec61p suggest a retro-translocation complex mediating protein transport for ER degradation. J Cell Sci. 1999 Nov 1;112 ( Pt 22):4123–4134. doi: 10.1242/jcs.112.22.4123. [DOI] [PubMed] [Google Scholar]
- Rubenstein EM, Kreft SG, Greenblatt W, Swanson R, Hochstrasser M. Aberrant substrate engagement of the ER translocon triggers degradation by the Hrd1 ubiquitin ligase. J Cell Biol. 2012 Jun 11;197(6):761–773. doi: 10.1083/jcb.201203061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Runnebohm AM, Evans MD, Richardson AE, Turk SM, Olesen JB, Smaldino PJ, Rubenstein EM. Loss of protein quality control gene UBR1 sensitizes Saccharomyces cerevisiae to the aminoglycoside hygromycin B. . Fine Focus. 2020 Oct 26;6(1):76–83. doi: 10.33043/FF.6.1.76-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Runnebohm AM, Richards KA, Irelan CB, Turk SM, Vitali HE, Indovina CJ, Rubenstein EM. Overlapping function of Hrd1 and Ste24 in translocon quality control provides robust channel surveillance. J Biol Chem. 2020 Oct 8;295(47):16113–16120. doi: 10.1074/jbc.AC120.016191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ruotolo R, Marchini G, Ottonello S. Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeast. Genome Biol. 2008 Apr 7;9(4):R67–R67. doi: 10.1186/gb-2008-9-4-r67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato BK, Schulz D, Do PH, Hampton RY. Misfolded membrane proteins are specifically recognized by the transmembrane domain of the Hrd1p ubiquitin ligase. Mol Cell. 2009 Apr 24;34(2):212–222. doi: 10.1016/j.molcel.2009.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sommer T, Jentsch S. A protein translocation defect linked to ubiquitin conjugation at the endoplasmic reticulum. Nature. 1993 Sep 9;365(6442):176–179. doi: 10.1038/365176a0. [DOI] [PubMed] [Google Scholar]
- Swanson R, Locher M, Hochstrasser M. A conserved ubiquitin ligase of the nuclear envelope/endoplasmic reticulum that functions in both ER-associated and Matalpha2 repressor degradation. Genes Dev. 2001 Oct 15;15(20):2660–2674. doi: 10.1101/gad.933301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Pagé N, Robinson M, Raghibizadeh S, Hogue CW, Bussey H, Andrews B, Tyers M, Boone C. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 2001 Dec 14;294(5550):2364–2368. doi: 10.1126/science.1065810. [DOI] [PubMed] [Google Scholar]
- Turk Samantha M., Indovina Christopher J., Miller Jacob M., Overton Danielle L., Runnebohm Avery M., Orchard Cade J., Tragesser-Tiña Mary E., Gosser Samantha K., Doss Ellen M., Richards Kyle A., Irelan Courtney Broshar, Daraghmi Mahmoud M., Bailey Connor G., Niekamp Julia M., Claypool Kieran P., Engle Sarah M., Buchanan Bryce W., Woodruff Kelsey A., Olesen James B., Smaldino Philip J., Rubenstein Eric M. Lipid biosynthesis perturbation impairs endoplasmic reticulum–associated degradation. Journal of Biological Chemistry. 2023 Aug 1;299(8):104939–104939. doi: 10.1016/j.jbc.2023.104939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verma R, Oania RS, Kolawa NJ, Deshaies RJ. Cdc48/p97 promotes degradation of aberrant nascent polypeptides bound to the ribosome. Elife. 2013 Jan 22;2:e00308–e00308. doi: 10.7554/eLife.00308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watts SG, Crowder JJ, Coffey SZ, Rubenstein EM. Growth-based determination and biochemical confirmation of genetic requirements for protein degradation in Saccharomyces cerevisiae. J Vis Exp. 2015 Feb 16;(96):e52428–e52428. doi: 10.3791/52428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weber A, Cohen I, Popp O, Dittmar G, Reiss Y, Sommer T, Ravid T, Jarosch E. Sequential Poly-ubiquitylation by Specialized Conjugating Enzymes Expands the Versatility of a Quality Control Ubiquitin Ligase. Mol Cell. 2016 Aug 25;63(5):827–839. doi: 10.1016/j.molcel.2016.07.020. [DOI] [PubMed] [Google Scholar]
- Wong ED, Miyasato SR, Aleksander S, Karra K, Nash RS, Skrzypek MS, Weng S, Engel SR, Cherry JM. Saccharomyces genome database update: server architecture, pan-genome nomenclature, and external resources. Genetics. 2023 May 4;224(1) doi: 10.1093/genetics/iyac191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Woodruff KA, Richards KA, Evans MD, Scott AR, Voas BM, Irelan CB, Olesen JB, Smaldino PJ, Rubenstein EM. Inner Nuclear Membrane Asi Ubiquitin Ligase Catalytic Subunits Asi1p and Asi3p, but not Asi2p, confer resistance to aminoglycoside hygromycin B in Saccharomyces cerevisiae . . MicroPubl Biol. 2021 Jun 1;2021 doi: 10.17912/micropub.biology.000403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao YY, Cao CL, Liu YL, Wang J, Li SY, Li J, Deng Y. Genetic analysis of oxidative and endoplasmic reticulum stress responses induced by cobalt toxicity in budding yeast. Biochim Biophys Acta Gen Subj. 2020 Jan 3;1864(3):129516–129516. doi: 10.1016/j.bbagen.2020.129516. [DOI] [PubMed] [Google Scholar]

