Origin recognition complex subunit 6 (ORC6) is a key mediator of LPS-induced NFκB activation and the pro-inflammatory response

Abstract

Lipopolysaccharide (LPS)-activated pro-inflammatory responses play a critical role in sepsis, a life-threatening condition. This study investigates the role of origin recognition complex subunit 6 (ORC6) in LPS responses in macrophages and monocytes. Silencing ORC6 using targeted shRNA significantly reduced LPS-induced expression and production of IL-1β (interleukin-1 beta), TNF-α (tumor necrosis factor alpha), and IL-6 (interleukin-6) in THP-1 human macrophages, peripheral blood mononuclear cells (PBMCs), and bone marrow-derived macrophages (BMDMs). Additionally, ORC6 knockout (KO) via the CRISPR/Cas9 method in THP-1 macrophages inhibited LPS-induced pro-inflammatory responses, while ectopic overexpression of ORC6 enhanced LPS-induced expression and production of pro-inflammatory cytokines. ORC6 is crucial for the activation of the nuclear factor kappa B (NFκB) signaling cascade in macrophages and monocytes. LPS-induced NFκB activation was largely inhibited by ORC6 silencing or KO, but potentiated following ORC6 overexpression. Mechanistically, ORC6 associated with nuclear p65 after LPS stimulation, an interaction necessary for NFκB activation. Overexpression of ORC6 did not recover the reduced pro-inflammatory response to LPS in THP-1 macrophages with silenced p65. Furthermore, the NFκB inhibitor BMS-345,541 nearly eliminated the pro-inflammatory response enhanced by ORC6 overexpression in response to LPS. Further studies revealed that ORC6 depletion inhibited NFκB activation induced by double-stranded RNA (dsRNA) and high mobility group box 1 (HMGB1) in THP-1 macrophages. In vivo experiments demonstrated that macrophage-specific knockdown of ORC6 protected mice from LPS-induced septic shock and inhibited LPS-stimulated production of IL-1β, TNF-α, and IL-6 in mouse serum. ORC6 silencing also inhibited LPS-induced NFκB activation in ex vivo cultured PBMCs following macrophage-specific knockdown of ORC6. These findings highlight ORC6 as a pivotal mediator in LPS-induced NFκB activation and the pro-inflammatory response in sepsis, suggesting that targeting ORC6 could be a novel therapeutic strategy for managing sepsis and related inflammatory conditions.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12964-024-01768-7.

Introduction

Sepsis represents a significant global health challenge, with high mortality rates and substantial healthcare burden [1–4]. It arises from the dysregulated immune response to an infection [1–3]. Sepsis manifests when the body’s immune system initiates a systemic inflammatory response to combat the invading pathogen, initiating a cascade of pro-inflammatory mediators into the bloodstream [1–3]. This hyperactive immune response can cause widespread inflammation and tissue damage throughout the body, ultimately resulting in organ dysfunction or even organ failure [1–3]. Swift recognition and intervention are critical for improving outcomes in septic patients, emphasizing the urgent need for effective diagnostic and therapeutic strategies to mitigate the devastating effects of this condition [1–3].

A pivotal mediator in the pathophysiology of sepsis is lipopolysaccharide (LPS), also referred to as endotoxin, which is an integral component of the outer membrane of gram-negative bacteria [5–9]. Upon dissemination into the bloodstream during infection, LPS initiates a complex cascade of inflammatory responses by engaging with specific receptors, notably Toll-like receptor 4 (TLR4) and CD14, primarily expressed on immune cells including macrophages and monocytes [10–12]. Subsequent activation of these receptors triggers intracellular signaling pathways, culminating in the production and release of various pro-inflammatory cytokines, including tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and interleukin-6 (IL-6) [10, 11]. These cytokines orchestrate a systemic inflammatory response, contributing to the pathogenesis of sepsis and associated organ dysfunction.

One of the primary signaling cascades activated by LPS in these cells is the nuclear factor kappa B (NFκB) pathway [13–15]. This pathway plays a pivotal role in regulating immune responses, including the production of pro-inflammatory cytokines [13–15]. Targeting and inhibiting the NFκB cascade can therefore be a strategic approach to control inflammation [13–15]. LPS binding to TLR4 and CD14 will recruit adaptor proteins including MyD88 (myeloid differentiation primary response 88) and TRIF (TIR-domain-containing adapter-inducing interferon-β), initiating activation of the IκB kinase (IKK) complex [13–15]. The activated IKK complex phosphorylates and degrades the inhibitor of NFκB (IκB), allowing the NFκB dimers to translocate into the nucleus and activate target gene transcription involved in inflammation and immune response [16, 17]. Additionally, LPS was also shown to activate NFκB through the TRIF-dependent pathway, contributing to the production of pro-inflammatory cytokines and type I interferon [18].

The origin recognition complex (ORC) subunit 6 (ORC6) is a crucial constituent of the ORC complex, a highly conserved protein complex vital for instigating DNA replication in eukaryotic cells [19]. It plays a central role in identifying and attaching to replication origins at the onset of DNA replication [20–23]. By engaging with other ORC subunits and supplementary factors involved in replication initiation, ORC6 facilitates the assembly of the pre-replication complex at DNA replication origins, enabling the recruitment of the replicative helicase and the subsequent unwinding of DNA strands [20–23].

While ORC6 is primarily associated with DNA replication, exploring its potential involvement in LPS-induced pro-inflammatory responses represents as an interesting scientific inquiry, particularly in the context of its broader roles in chromatin organization [24], transcriptional regulation [25], and the maintenance of genome stability [20] as well as in regulating signaling cascades, cell cycle progression [26], cancer progression [26, 27]. The findings of this study highlighted ORC6 as a pivotal mediator in LPS-induced NFκB activation and the pro-inflammatory response.

Materials and methods

Chemicals and reagents

LPS, puromycin, polybrene, BMS-345541, HMGB1 or dsRNA [poly(I: C) and CCK-8 were acquired from Sigma-Aldrich Chemicals (St. Louis, MO). The antibodies used in this study were sourced from Cell Signaling Technology (Danvers, MA) and Santa Cruz Biotechnology (Santa Cruz, CA). Gibco-BRL Co. (Logan, Utah) supplied the fetal bovine serum (FBS), cell culture medium, antibiotics, and various medium supplements. Genehem Co. (Shanghai, China) was responsible for synthesizing and validating the mRNA primers, viral constructs, and all other genetic sequences employed in experiments.

THP-1 cell culture

THP-1 cells, a human monocytic leukemia cell line, were provided by Dr. Xie [28], and were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. These cells were grown in a humidified incubator with 5% CO₂ at 37 °C and were maintained in suspension.

Ex-vivo culture of human and murine peripheral blood mononuclear cells (PBMCs)

PBMCs were isolated from healthy donors at author’s institution using lymphocyte separation medium from Sigma [28]. These primary human PBMCs were then cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS and other necessary additives as specified. The murine blood was collected via cardiac puncture into heparinized tubes, then diluted with an equal volume of PBS. The diluted blood was carefully layered over Ficoll-Paque and centrifuged at 500 x g for 30 min at room temperature. The PBMC layer was aspirated and transferred to a new tube, followed by washing with PBS through centrifugation at 250 x g for 12 min. This washing step was repeated twice to remove residual Ficoll-Paque. The resulting cell suspension was counted and assessed for viability using trypan blue exclusion. The isolated PBMCs were then ready for following experimental applications. All experimental protocols involving human cells were reviewed and approved by the Ethics Committee of authors’ institution, ensuring compliance with ethical standards of Declaration of Helsinki. Furthermore, written-informed consent was obtained from each participant, securing their agreement for the use of their cells in these studies.

Bone marrow-derived macrophages (BMDMs)

Bone marrow was harvested from C57/BL6 mice by flushing the femurs and tibias, followed by re-suspension of the cells. BMDMs were then washed and cultured in the RMPI medium containing 8% FBS and plus L929 cell-conditioned medium. All animal protocols employed in this study were approved and conducted in compliance with the Institutional Animal Care and Use Committee (IACUC) and the Ethics Review Board (ERB) of authors’ institution.

Quantitative real-time PCR (qPCR)

Total cellular RNA was isolated using TRIzol reagents (Gibco-BRL, Gaithersburg, MD). This was followed by reverse transcription using the TOYOBO ReverTra Ace RT-PCR kit, adhering strictly to the guidelines provided by the manufacturer. Quantitative PCR (qPCR) was then performed on the ABI Prism 7900 Fast Real-Time PCR system, employing the SYBR Green Real-Time Master Mix kit (Toyobo, Shanghai, China). For the qPCR analysis, 500 ng of cDNA from each sample was used, along with specific mRNA primers.

Western blotting

For each condition, 30 µg of lysate proteins were resolved on 10–12% SDS-PAGE gels and subsequently transferred onto PVDF membranes (Sigma). After blocking with 10% non-fat milk in PBST, the membranes were probed with appropriate primary and secondary antibodies. Detection of protein signalings was achieved using ECL reagents (Bio-Rad, Shanghai, China). To isolate nuclear fraction lysates, cells were first collected and resuspended in a hypotonic buffer. Cellular membranes were subsequently disrupted using a homogenizer. Nuclei were pelleted by centrifugation, washed, and lysed with a high-salt nuclear extraction buffer (Sigma). Insoluble material was removed by centrifugation, and the supernatant containing nuclear fraction proteins was collected for further analyses. The intensity of each protein band was quantified utilizing ImageJ software. All uncropped blotting images are listed in Figure S1.

ELISA

The concentrations of the cytokines, IL-1β, TNF-α, and IL-6 (both murine and human), were measured using commercial ELISA kits (R&D Systems, Shanghai, China), following the manufacturer’s instructions. The assay involves capturing cytokines onto microplate wells coated with specific antibodies, followed by detection using enzyme-labeled antibodies. Protein standards were employed for normalization to ensure accurate quantification.

ORC6 knockout (KO)

The lentiviral CRISPR/Cas-9-GFP plasmid targeting the human ORC6 gene (specific DNA sequence: CGGCCTCTCCGCACGCACCA, PAM: CGG), along with a puromycin resistance gene, was supplied by GeneChem (Shanghai, China). Cells were initially transduced with a lentiviral construct expressing Cas9. Subsequently, they were transduced with the ORC6 knockout (KO) construct. Stable cells were selected using puromycin. To isolate cell clones, GFP-positive cells were sorted by fluorescence-activated cell sorting (FACS) into individual wells of a 96-well plate and cells were subjected to genotyping to confirm ORC6 depletion. This process yielded two stable monoclonal clones, designated as koORC6-Clo1 and koORC6-Clo2. As a control, cells were transduced with both the lentiviral Cas9-expressing construct and a CRISPR/Cas-9-GFP control plasmid, referred to as “koC”.

ORC6 silencing

Lentiviruses encoding various ORC6-targeting shRNAs, each designed to target distinct, validated sequences, were supplied by Genechem (Shanghai, China). These lentiviral vectors also included GFP and a puromycin resistance gene. The prepared lentiviruses were introduced to cultured monocytes or macrophages in a medium containing polybrene. Following transduction, stable monocytes or macrophages were selected using puromycin at a concentration of 2.0 µg/mL. The effectiveness of ORC6 silencing in these stable cells was confirmed through Western blotting and qPCR assays. For human ORC6 shRNAs, shORC6-1 (targeting CCCCTTGGACAGGGCTTATTTAA), shORC6-4 (targeting: ACATATCAGAGCTGTCTTAAATC), and shORC6-6 (targeting TCCCTTGTCTTATTCAGAATATA) were utilized. For murine ORC6, the shRNA targeting GCCCCTTGGATAGAGCATATTTAAT (“sh-mORC6”) was utilized. For controls, lentivirus carrying scramble control shRNA was used to transduce control monocytes or macrophages.

ORC6 overexpression

The prepared lentivirus encoding the ORC6-expressing construct (GV280, Genechem, Shanghai, China) were added to cultured monocytes or macrophages in a medium containing polybrene. Following transduction, stable monocytes or macrophages were selected using puromycin at a concentration of 2.0 µg/mL. The effectiveness of ORC6 overexpression in these stable cells was confirmed through Western blotting and qPCR assays. The lentivirus carrying empty vector (“Vec”) was used to transduce control monocytes or macrophages.

Cell viability and death assays

Cells were initially seeded at a density of 4 × 10⁴ cells/mL onto 96-well tissue culture plates. After the treatment was applied, CCK-8 dye was added to each well and incubated for 2 h. The optical density (OD) of CCK-8, which reflects cell viability, was measured at 450 nm using an absorbance microplate reader (BioTek Instruments, Winooski, VT). To quantify the extent of cell death, a LDH assay was subsequently performed using a LDH assay kit (Biyuntian, Wuxi, China). The percentage of LDH released was then calculated by dividing the LDH activity in the supernatant by the total LDH activity.

p65 DNA-binding assay of NFκB activity

To assess NFκB (p65) DNA-binding activity, nuclear fraction protein extracts from monocytes/macrophages were prepared. These extracts were then incubated in a TransAM™ ELISA microplate (Active Motif, Carlsbad, CA) coated with a specific NFκB oligonucleotide sequence to allow for p65 binding. Post-binding, wells were washed, and NFκB (p65) was detected using a primary antibody specific to p65, followed by a horseradish peroxidase-conjugated secondary antibody. The addition of a chromogenic substrate facilitated the quantification of p65 DNA-binding activity via colorimetric detection, with absorbance at 450 nm measured using a plate reader.

Co-immunoprecipitation (Co-IP)

The detailed experimental protocol has been previously described [28]. In brief, after the designated treatments, nuclear lysates of monocytes or macrophages were prepared, each containing 600 µg of proteins. These lysates were initially pre-cleared by Protein A/G Sepharose (Santa Cruz Biotech, Santa Cruz, CA) to reduce non-specific binding. Subsequently, they were incubated with an anti-ORC6 or an anti-p65 antibody from Santa Cruz Biotech. To isolate the ORC6-p65 immuno-complexes, Protein G Sepharose beads were added to the mixture. The complexes were then washed several times and were analyzed using Western blotting.

AP-1 luciferase assay

The AP-1 luciferase reporter assay was employed to quantitatively assess the transcriptional activity of AP-1 in macrophages. THP-1 cells were seeded into 24-well plates and were transfected with 0.5 µg of an AP-1 luciferase reporter plasmid (Genechem) and 0.05 µg of Renilla luciferase plasmid (Genechem) using Lipofectamine 3000. Following overnight incubation, cells were stimulated with LPS (100 ng/mL) for 2 h. Post-stimulation, cells were lysed, and luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, Wisconsin). The firefly luciferase activity, indicative of AP-1 transcriptional activity, was measured and results were expressed as relative luciferase units (RLU).

Animal studies

A GV684 construct, pAAV-CD68p-EGFP-MIR155(MCS)-WPRE-SV40 PolyA, encoding shRNA sequence against murine ORC6 (targeting TGCCCCTTGGATAGAGCATATTTAATT), was produced by Genechem (Shanghai, China). The vector was engineered with the CD68 promoter region (CD68p), ensuring its expression is specific to monocytes and macrophages. Control GV684 scramble control shRNA AAV was also produced by Genechem. The generated virus, at 100 µL per mouse, was injected to the tail vein of the C57/BL6 mice (3-3.5 week old, half male and half female, 18.2–18.6 g in weights). The mice were purchased from the Animal Center of Soochow University. Three weeks after virus injection, mice were intraperitoneally injected with 50 mg/kg of LPS and were analyzed afterwards. All animal-related procedures were performed with the approval of the Institutional Animal Care and Use Committee (IACUC) and the Ethics Committee at authors’ institution.

Statistical analyses

Data were presented as the mean ± standard deviation (SD). Statistical analyses were conducted using SPSS software (version 23, SPSS Inc., Chicago, IL), with a significance threshold set at P < 0.05. For comparisons across multiple groups, two-way ANOVA followed by Bonferroni post hoc tests were utilized. To assess significance between two treatment groups, a two-tailed unpaired T-test was performed using Excel 2013.

Results

ORC6 silencing ameliorates LPS-induced pro-inflammatory response in THP-1 human macrophages

To explore ORC6’s potential involvement in the pro-inflammatory response triggered by LPS in macrophages, we utilized THP-1 human macrophages [29]. Seven distinct shRNAs targeting different sequences of human ORC6 were employed for infection. Subsequently, puromycin was introduced to select stable cell clones, and ORC6 expression was assessed in these stable cells. Notably, among the tested shRNAs, shORC6-1, shORC6-4, and shORC6-6 exhibited significant downregulation of both mRNA (Fig. 1A) and protein (Fig. 1B). The expression of ORC1, a control gene, remained unaffected by the listed ORC6 shRNAs (Fig. 1A and B).

Fig. 1.

ORC6 silencing ameliorates LPS-induced pro-inflammatory response in THP-1 human macrophages. Stable THP-1 human macrophages were subjected to treatment with specific ORC6 shRNAs (“shORC6-1/-4/-6”, encompassing three distinct sequences) or a scramble control shRNA (“shC”). Subsequent analyses were performed to assess the expression levels of both ORC6 and ORC1 mRNA and protein (A and B). Following this, the aforementioned THP-1 cells were exposed to LPS (100 ng/mL) for specified time intervals, mRNA expression and protein secretion (to the medium) of pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, were evaluated using qPCR (C-E) and ELISA assays (F-H), respectively. Additionally, assessments of cell viability and death were conducted via CCK-8 assay (I) and medium LDH release assay (J), respectively. THP-1 human macrophages were treated with LPS (100 ng/mL) for specified time intervals, the expression levels of ORC6 mRNA (K) and protein (L) were tested. The designation “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “shC” cells. ^#P < 0.05 compared to “shC” (A and B). Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

Crucially, silencing ORC6 with these shRNAs significantly suppressed the LPS-induced mRNA expression of pro-inflammatory cytokines, including IL-1β (Fig. 1C), TNF-α (Fig. 1D), and IL-6 (Fig. 1E). Moreover, the investigations extended to ELISA assays, which revealed a significant attenuation in LPS-induced production levels of the aforementioned pro-inflammatory cytokines, IL-1β (Fig. 1F), TNF-α (Fig. 1G), and IL-6 (Fig. 1H), upon treatment with the ORC6-targeting shRNAs. LPS single treatment failed to alter ORC6 mRNA and protein expression (Data not shown). Importantly, ORC6 silencing via targeted shRNAs did not impact cell viability (reflected by CCK-8 OD, Fig. 1I) or induce cell death (Fig. 1J) in THP-1 human macrophages, irrespective of LPS treatment. Notably, treatment with LPS (100 ng/mL) failed to significantly alter ORC6 mRNA (Fig. 1K) and protein (Fig. 1L) expression in THP-1 cells. These findings collectively underscore the regulatory role of ORC6 in modulating LPS-induced pro-inflammatory response in macrophages.

ORC6 silencing inhibits LPS-induced pro-inflammatory response in PBMCs and BMDMs

Subsequently, we investigated whether the suppression of ORC6 expression could induce a similar anti-inflammatory response in other macrophages/monocytes. PBMCs obtained from healthy donors were subjected to infection with murine shORC6-6 lentivirus, followed by the formation of stable cell populations after puromycin selection. Importantly, shORC6-6 led to a marked decrease in ORC6 mRNA and protein levels in PBMCs (Fig. 2A and B), while leaving the control gene ORC1 unaffected (Fig. 2A and B). Consistent with our findings in THP-1 macrophages, the shRNA-mediated silencing of ORC6 in PBMCs substantially inhibited the LPS-induced mRNA expression of pro-inflammatory cytokines, including IL-1β (Fig. 2C), TNF-α (Fig. 2D), and IL-6 (Fig. 2E). Furthermore, ELISA assays demonstrated a remarkable reduction in the LPS-induced production levels of these pro-inflammatory cytokines, as shown in Fig. 2F-H. Conversely, no significant changes in cell viability (Fig. 2I) and cell death (Fig. 2J) were observed in the aforementioned PBMCs, regardless of LPS treatment.

Fig. 2.

ORC6 silencing inhibits LPS-induced pro-inflammatory response in PBMCs and BMDMs. Expression levels of both ORC6 and ORC1 in stable peripheral blood mononuclear cells (PBMCs) with the specific ORC6 shRNA (“shORC6-6”) or a scramble control non-sense shRNA (“shC”) were shown (A, B). Cells were exposed to LPS (100 ng/mL) for specified time intervals, mRNA expression and protein secretion (to the medium) of pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, were evaluated using qPCR (C-E) and ELISA assays (F-H), respectively. Additionally, assessments of cell viability and death were conducted via CCK-8 assay (I) and medium LDH release (J) assays, respectively. Expression levels of both ORC6 and ORC1 in stable bone marrow-derived macrophages (BMDMs) with the specific murine ORC6 shRNA (“sh-mORC6”) or shC were shown (K and L). The BMDMs were exposed to LPS (100 ng/mL) for specified time intervals, protein secretion (to the medium) of pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, were tested (M-O); Cell viability (CCK-8 OD, P) and death (medium LDH release, Q) were tested similarly. The designation “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “shC” cells. ^#P < 0.05 compared to “shC” (A, B, K and L).Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

In primary murine bone marrow-derived macrophages (BMDMs), lentiviral shRNA specifically targeting the murine ORC6 (“sh-mORC6”) was introduced, leading to significant downregulation of ORC6 mRNA (Fig. 2K) and protein (Fig. 2L) levels. The expression of ORC1 mRNA and protein remained unaffected by this treatment (Fig. 2K and L). Furthermore, ELISA assays revealed that sh-mORC6 effectively suppressed the LPS-induced production of key pro-inflammatory cytokines, including IL-1β (Fig. 2M), TNF-α (Fig. 2N), and IL-6 (Fig. 2O). The cell viability (Fig. 2P) and medium LDH release (Fig. 2Q) were again unchanged by the treatment.

ORC6 KO inhibits LPS-induced pro-inflammatory response in THP-1 human macrophages

To further substantiate the involvement of ORC6 in the LPS-induced pro-inflammatory response, THP-1 macrophages expressing Cas9 were exposed to a lentiviral CRISPR-ORC6-KO construct encoding sgRNA targeting human ORC6. Following selection with puromycin, two distinct single stable colonies, koORC6-Clo1 and koORC6-Clo2, with confirmed ORC6 KO were established. Protein analysis revealed a marked depletion of ORC6 expression in koORC6-Clo1/2 THP-1 macrophages (Fig. 3A and B), while ORC1 protein level remained unaffected (Fig. 3A and B). In these ORC6 KO cells, a significant suppression was observed in the LPS-induced mRNA expression of pro-inflammatory mediators, including IL-1β (Fig. 3C), TNF-α (Fig. 3D), and IL-6 (Fig. 3E). Moreover, further validation through ELISA assays provided additional evidence supporting the significant reduction in LPS-induced production levels of these cytokines specifically within the koORC6-Clo1 and koORC6-Clo2 THP-1 macrophages (Fig. 3F-H). It is worth highlighting that despite the effective KO of ORC6, there was no discernible impact observed on the viability (Fig. 3I) or induction of cell death (Fig. 3J) in the THP-1 human macrophages, with or without LPS stimulation.

Fig. 3.

ORC6 KO inhibits LPS-induced pro-inflammatory response in THP-1 human macrophages. The Cas9-expressing THP-1 cells with the lentiviral CRISPR-ORC6-KO construct (“koORC6-Clo1” or “koORC6-Clo2”, representing two clones) or cells with control construct (“koC”) were established and expression of ORC1/ORC6 protein was tested (A and B). Following this, the THP-1 macrophages were exposed to LPS (100 ng/mL) for specified time intervals, mRNA expression and protein secretion (to the medium) of pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, were evaluated using qPCR (C-E) and ELISA assays (F-H), respectively. Additionally, assessments of cell viability and death were conducted via CCK-8 assay (I) and medium LDH release (J) assays, respectively. “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “koC” cells. ^#P < 0.05 compared to “koC” cells (B). Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

Ectopic overexpression of ORC6 potentiates LPS-induced pro-inflammatory response in THP-1 human macrophages

Next, we speculated that the ectopic overexpression of ORC6 could enhance the pro-inflammatory response induced by LPS. To test this hypothesis, we introduced a lentiviral construct overexpressing ORC6 into THP-1 human macrophages. Following puromycin selection, we obtained two stable cell lines, named “oeORC6-Slc1” and “oeORC6-Slc2”. In these cells, both the mRNA (Fig. 4A) and protein (Fig. 4B) levels of ORC6 were significantly elevated, while the expression of ORC1 remained unchanged (Fig. 4A and B). Subsequently, we observed that LPS-induced mRNA expression of pro-inflammatory cytokines IL-1β (Fig. 4C), TNF-α (Fig. 4D), and IL-6 (Fig. 4E) was markedly potentiated in oeORC6-Slc1 and oeORC6-Slc2 THP-1 macrophages. This enhancement was further confirmed by ELISA assay, which revealed increased production levels of IL-1β (Fig. 4F), TNF-α (Fig. 4G), and IL-6 (Fig. 4H) upon LPS stimulation. ORC6 overexpression did not significantly affect cell viability (Fig. 4I) or induce cell death (Fig. 4J) in THP-1 macrophages. These results further supported the essential role of ORC6 in LPS-induced pro-inflammatory response.

Fig. 4.

Ectopic overexpression of ORC6 potentiates LPS-induced pro-inflammatory response in THP-1 human macrophages. Stable THP-1 macrophages with the ORC6-expressing lentiviral construct (“oeORC6-Slc1” or “oeORC6-Slc2”, two stable cell clones) or the empty vector (“Vec”) were established, ORC6 and ORC1 mRNA and protein levels were tested (A and B). Cells were exposed to LPS (100 ng/mL) for specified time intervals, mRNA expression and protein secretion (to the medium) of pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, were evaluated using qPCR (C-E) and ELISA assays (F-H), respectively. Additionally, assessments of cell viability and death were conducted via CCK-8 assay (I) and medium LDH release assay (J), respectively. “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “Vec” cells. ^#P < 0.05 compared to “Vec” cells (A and B). Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

ORC6 is important for LPS-induced NFκB activation in macrophages/monocytes

The activation of the NFκB signaling pathway is crucial for the LPS-induced pro-inflammatory response in macrophages and monocytes [30]. Consequently, we investigated the impact of altering ORC6 expression on LPS-induced NFκB signaling. In THP-1 macrophages, silencing ORC6 with shORC6-1, shORC6-4, and shORC6-6 significantly suppressed the activation of NFκB and reduced p65-DNA binding activity (Fig. 5A). Furthermore, in ORC6 KO THP-1 macrophages, identified as koORC6-Clo1 and koORC6-Clo2, the activation of NFκB signaling in response to LPS was substantially inhibited, as shown in Fig. 5B. Conversely, in ORC6-overexpressed THP-1 macrophages, labeled as oeORC6-Slc1 and oeORC6-Slc2, there was a significant enhancement in LPS-induced NFκB signaling activation (Fig. 5C). Similarly, shRNA-mediated silencing of ORC6 in both PBMCs (by shORC6-6, Fig. 5D) and BMDMs (by sh-mORC6, Fig. 5E) also markedly reduced the activation of NFκB by LPS. These findings underscore the critical role of ORC6 in regulating LPS-induced NFκB activation in macrophages and monocytes.

Fig. 5.

ORC6 is important for LPS-induced NFκB activation in macrophages/monocytes. Stable THP-1 human macrophages with the specific ORC6 shRNAs (“shORC6-1/-4/-6”, encompassing three distinct sequences) or a scramble control non-sense shRNA (“shC”), the Cas9-expressing THP-1 macrophages with the lentiviral CRISPR-ORC6-KO construct (koORC6-Clo1 or koORC6-Clo2, representing two clones) or the control cells with the control construct (“koC”) as well as THP-1 macrophages with the ORC6-expressing lentiviral construct (oeORC6-Slc1 or oeORC6-Slc2, two stable clones) or the empty vector (“Vec”) were treated with or without LPS (100 ng/mL) for 2 h, NFκB activation was tested by p65 DNA-binding assay (A-C). The stable peripheral blood mononuclear cells (PBMCs) or bone marrow-derived macrophages (BMDMs) with the specific ORC6 shRNA or a scramble control non-sense shRNA (“shC”) were treated with or without LPS (100 ng/mL) for 2 h, NFκB activation was tested by p65 DNA-binding assay (D and E). The koC, koORC6Clo2, Vec or oeORC6-Slc1 THP-1 macrophages were treated with LPS (100 ng/mL) for 1 h, expression levels of listed proteins in total cell lysates were tested (F, H, I and K), and the AP-1 luciferase activity was also tested (G and J). The designation “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “shC”/“Vec”/“koC” cells. Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

Importantly, LPS-induced IκBα degradation and p65 phosphorylation remained unaffected by ORC6 KO in THP-1 cells (Fig. 5F). LPS-mediated phosphorylation of STAT6 (Fig. 5F) and increased AP-1 luciferase activity (Fig. 5G) remained unchanged by ORC6 ablation (koORC6-Clo2).The expression levels of TLR4 and CD14 remained consistent in ORC6 KO THP-1 macrophages, as shown in Fig. 5H. Additionally, the phosphorylation levels of Akt and MAPK pathways (p38, JNK1/2, and Erk1/2) in response to LPS stimulation were not significantly altered, with total protein levels of Akt1/2, p38, JNK1/2, and Erk1/2 also remaining consistent (Fig. 5H).

Similarly, overexpression of ORC6 in THP-1 cells (oeORC6-Slc1) did not affect LPS-induced IκBα degradation, p65 phosphorylation, STAT6 phosphorylation (Fig. 5I), or AP-1 luciferase activity increase (Fig. 5J). There was no significant change in the protein levels of TLR4 and CD14 (Fig. 5K). Overexpression of ORC6 did not significantly change the activation of the Akt and MAPK signaling cascades following LPS stimulation in these macrophages, as demonstrated in Fig. 5K. In these signaling experiments, macrophages and monocytes were pre-incubated in warm PBS for 25 min prior to LPS stimulation to eliminate any basal signaling activation.

ORC6 associates with p65, required for LPS-induced NFκB activation in macrophages/monocytes

LPS activates the NFκB signaling pathway by binding to TLR4 and CD14, thereby recruiting adaptor proteins to activate the IKK complex. This complex phosphorylates IκB proteins, causing them for degradation and releasing NFκB subunits (p65, RelB, c-Rel etc.) to translocate into the nucleus [11, 31, 32]. In the nucleus, NFκB binds to DNA and recruits co-activators to initiate the transcription of genes involved in immune and inflammatory responses [11, 31, 32]. A co-immunoprecipitation (Co-IP) assay of nuclear fraction proteins showed that, following LPS stimulation, ORC6 associated with nuclear-entering p65 in THP-1 macrophages (Fig. 6A). The “Input” results confirmed p65 nuclear translocation after LPS stimulation in THP-1 macrophages, with ORC6 protein expression remaining unchanged (Fig. 6A). We did not detect a strong association of ORC6 with other nuclear components (RelB, c-Rel, and p50) in the NFκB signaling cascade (data not shown) in LPS-treated THP-1 macrophages.

Fig. 6.

ORC6 associates with p65, required for LPS-induced NFκB activation in macrophages/monocytes. THP-1 human macrophages were treated with or without LPS (100 ng/mL) for 1 h, p65-ORC6 association and their expression levels in the nuclear lysates was tested (A). Stable THP-1 human macrophages with the lentiviral p65 shRNA (“shp65”) were further transduced with the ORC6-expressing lentiviral construct (oeORC6), and stable cells formed; Control cells were with a scramble control non-sense shRNA (“shC”), expression of the listed proteins was shown (B). Cells were exposed to LPS (100 ng/mL) for specified time intervals, NFκB activation was tested by p65 DNA-binding assay (C), mRNA expression and protein secretion (to the medium) of IL-1βwere evaluated using qPCR (D) and ELISA (E) assays, respectively. Additionally, assessments of cell viability was conducted via CCK-8 assay (F). Stable THP-1 macrophages with the ORC6-expressing lentiviral construct (oeORC6-Slc1) were treated with 10 µM of BMS-345,541, followed by LPS (100 ng/mL) stimulation for specified time intervals, control cells with vector (“Vec”) were left untreated, NFκB activation was tested by p65 DNA-binding assay (G), mRNA expression and protein secretion (to the medium) of IL-1βwere evaluated using qPCR (H) and ELISA (I) assays, respectively, with cell viability analyzed by CCK-8 assay (J). The designation “C” denotes vehicle control treatment. Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “C” and ^#P < 0.05 compared to LPS treatment in “shC” cells (B-E). ^#P < 0.05 (G-I). Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

We further analyzed whether p65 association was the primary mechanism of ORC6-promoted NFκB activation and pro-inflammatory response. To this end, a p65 shRNA-expressing lentivirus was used to establish stable p65-silenced THP-1 macrophages (“shp65”) (Fig. 6B). As expected, p65 silencing significantly inhibited LPS-induced NFκB activation (Fig. 6C), IL-1 mRNA expression (Fig. 6C), and production (Fig. 6D) in THP-1 macrophages. Importantly, ORC6 overexpression using the aforementioned lentiviral construct (Fig. 6B) failed to rescue the LPS-induced pro-inflammatory response in shp65 THP-1 macrophages (Fig. 6C-E) and did not affect p65 protein expression (Fig. 6B). No significant viability change was detected in these above THP-1 macrophages (Fig. 6F). These data suggest that the interaction between ORC6 and p65 is crucial for LPS-induced NFκB activation and the subsequent pro-inflammatory response in THP-1 macrophages.

BMS-345,541 is a highly selective inhibitor of IκB kinase that binds to an allosteric site on the enzyme, thereby blocking NFκB-dependent transcription [33, 34]. The application of BMS-345,541 almost completely nullified the ORC6 overexpression-promoted inflammatory response to LPS in THP-1 macrophages (Fig. 6G-I). In oeORC6-Slc1 THP-1 cells, LPS-induced NFκB activation (Fig. 6G), IL-1 mRNA expression (Fig. 6H), and production (Fig. 6I) were again significantly increased, but these effects were reversed with BMS-345,541 co-treatment (Fig. 6G-I). Importantly, cell viability was not significantly affected by these treatments (Fig. 6J).

ORC6 depletion inhibits double-stranded RNA- or high mobility group box 1-induced NFκB activation in macrophages/monocytes

Double-stranded RNA (dsRNA) activates the NFκB signaling pathway through TLR3, leading to the activation of the IKK complex and degradation of IκB proteins. This process results in NFκB activation, which initiates pro-inflammatory responses [35]. HMGB1 (High Mobility Group Box 1) can also activate the NFκB signaling pathway by binding to receptors of TLR2 and TLR4, leading to the activation of NFκB and pro-inflammatory response [36]. In THP-1 macrophages, shRNA-induced silencing (shORC6-6) or CRISPR/Cas9-induced knockout (using koORC6Clo2 cells) of ORC6 potently inhibited NFκB activation by dsRNA or HMGB1 (Fig. 7A). Consequently, IL-1 mRNA expression (Fig. 7B) and production (Fig. 7C) in response to dsRNA or HMGB1 were largely inhibited in ORC6-depelted THP-1 macrophages. ORC6 silencing or knockout did not affect the viability of THP-1 macrophages, regardless of dsRNA or HMGB1 stimulation (Fig. 7D). On the contrary, in ORC6-overexpressing THP-1 macrophages, oeORC6-Slc1 and oeORC6-Slc2,dsRNA- or HMGB1-induced NFκB activation (Fig. 7E), IL-1 mRNA expression (Fig. 7F) and production (Fig. 7G) were significantly enhanced. No significant viability reduction was however detected in these THP-1 cells (Fig. 7H).

Fig. 7.

ORC6 depletion inhibits double-stranded RNA- or high mobility group box 1-induced NFκB activation in macrophages/monocytes. Stable THP-1 human macrophages with the specific ORC6 shRNA (“shORC6-6”), the Cas9-expressing THP-1 cells with the lentiviral CRISPR-ORC6-KO construct (koORC6-Clo1), or control THP-1 human macrophages with a scramble control non-sense shRNA plus CRISPR-Cas9 control construct (“shC + koC”), as well as THP-1 macrophages with the ORC6-expressing lentiviral construct (oeORC6-Slc1 or oeORC6-Slc2, two stable clones) or the empty vector (“Vec”) were established, cells were treated with or without HMGB1 (5 µg/mL) or dsRNA [poly(I: C), 10 µg/mL] for designated durations, NFκB activation was tested by p65 DNA-binding assay (A and E), mRNA expression and protein secretion (to the medium) of IL-1βwere evaluated using qPCR (B and F) and ELISA (C and G) assays, respectively, with cell viability analyzed by CCK-8 assay (D and H). Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by ^#P < 0.05 compared to LPS treatment in “shC + koC”/“Vec” cells. Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. These experiments were repeated five times, yielding consistent results across replicates

Macrophage knockdown of ORC6 protects mice from LPS-induced septic shock

To silence ORC6 expression in vivo, pAAV-CD68p-EGFP-MIR155(MCS)-WPRE-SV40 PolyA-ORC6 shRNA was intravenously injected into C57/BL6 mice, resulting in ORC6 macrophage knockdown (ORC6-mKD) mice after three weeks due to the CD68 promoter in the vector. Another group of mice was injected with scramble control shRNA AAV (aav-shC). Subsequently, ORC6-mKD mice, aav-shC mice, and control mice (Ctrl) were intraperitoneally injected with 50 mg/kg of LPS. ORC6-mKD C57 mice were protected from LPS-induced septic shock, and mortality was significantly reduced (Fig. 8A). Within 24 h post-LPS injection, 9 out of 10 mice in both the Ctrl and aav-shC groups died, whereas 6 out of 10 ORC6-mKD mice survived (Fig. 8A). These surviving mice were observed for five days without any late-occurring toxic effects. Two hours after LPS administration, ELISA assay results from the mice’s tail veins showed that LPS-induced production of IL-1β (Fig. 8B), TNFα (Fig. 8C), and IL-6 (Fig. 8D) was significantly inhibited in ORC6-mKD mice.

Fig. 8.

Macrophage knockdown of ORC6 protects mice from LPS-induced septic shock. The ORC6-mKD C57/BL6 mice, the aav-shC mice, and control mice (Ctrl) were injected intraperitoneally with LPS (50 mg/kg). Mice mortality (%) was recorded 24 h after LPS administration (A). Tail vein serum samples were collected 2 h after LPS stimulation, and IL-1β, TNFα, and IL-6 levels were determined by ELISA (B-D). Additionally, the murine peripheral blood mononuclear cells (PBMCs) were isolated 2 h after LPS stimulation. The mRNA and protein expression of ORC1 and ORC6 was examined (E and F), and NFκB pathway activation was assessed by p65 DNA-binding assay (G). Data were presented as mean ± standard deviation (SD, n = 5), with statistical significance indicated by *P < 0.05 compared to “Ctrl” group. Non-statistically significant differences (P > 0.05) were denoted as “N. S.“. Ten mice per group (A-D).

To confirm ORC6 knockdown in ORC6-mKD mice, peripheral blood mononuclear cells (PBMCs) were isolated of the above mice and cultured ex vivo two hours after LPS administration. The expression levels of ORC6 mRNA (Fig. 8E) and protein (Fig. 8F) were significantly decreased in PBMCs from ORC6-mKD mice, while ORC1 mRNA (Fig. 8E) and protein (Fig. 8F) levels remained unchanged. Importantly, NFκB activity in PBMCs from ORC6-mKD mice was also significantly reduced (Fig. 8G). These results clearly indicate that macrophage ORC6 plays a crucial role in LPS-induced septic shock in mice.

Discussion

Sepsis is a life-threatening condition characterized by a dysregulated host response to infection, resulting in systemic inflammation, tissue injury, and potential organ failure [1, 2, 5, 37]. Clinically, sepsis presents with signs of systemic inflammatory response syndrome (SIRS) [1, 2, 5, 37]. LPS, components of the outer membrane of Gram-negative bacteria, is pivotal in the pathophysiology of sepsis. LPS triggers an intense immune response by activating TLR4 on immune cells, leading to the release of pro-inflammatory cytokines such as TNF-α, IL-1, and IL-6 [38]. This cascade can result in widespread endothelial damage, increased vascular permeability, and ultimately, septic shock and multi-organ dysfunction [38].

The findings of this study underscore the critical role of ORC6 in mediating LPS-induced pro-inflammatory response. Targeted shRNA-induced silencing of ORC6 markedly attenuated LPS-induced expression and secretion of pro-inflammatory cytokines, IL-1β, TNF-α, and IL-6, in THP-1 human macrophages, PBMCs, and BMDMs. Furthermore, CRISPR/Cas9-mediated ORC6 KO in THP-1 human macrophages resulted in a significant reduction of LPS-induced pro-inflammatory responses. Conversely, ectopic overexpression of ORC6 in THP-1 human macrophages led to a pronounced increase in the expression and production of these cytokines upon LPS stimulation. These results supported that ORC6 is a crucial mediator of LPS-induced pro-inflammatory signaling.

LPS induces the activation of the NFκB signaling cascade in macrophages and monocytes, essential for the subsequent pro-inflammatory response [13–15]. We showed that ORC6 plays a pivotal role in the activation of the NFκB signaling in macrophages and monocytes. Silencing or KO of ORC6 significantly inhibited LPS-induced NFκB activation in monocytes and macrophages, whereas overexpression of ORC6 enhanced the activation. Mechanistically, ORC6 was found to associate with nuclear p65 following LPS stimulation, an interaction essential for NFκB activation. LPS-induced NFκB activation and pro-inflammatory responses were significantly inhibited by p65 shRNA, and ectopic overexpression of ORC6 could not restore this activation. Similarly, LPS-induced NFκB activation in ex vivo cultured murine PBMCs was greatly reduced following macrophage-specific knockdown of ORC6. These findings suggest that ORC6 promotes LPS-induced pro-inflammatory response primarily by mediating NFκB activation through its interaction with p65.

In addition to the NFκB, LPS also triggers the activation of other signaling pathways, such as PI3K-Akt and MAPK (JNK, Erk1/2, and p38) [39–42], which are important for modulating pro-inflammatory responses in macrophages and monocytes. Our findings indicate that neither KO nor overexpression of ORC6 influenced the activation of the LPS-induced PI3K-Akt and MAPK cascades. Moreover, altering ORC6 expression failed to change LPS-induced activation of other transcription factors, including AP-1 and STAT6, in THP-1 cells. These results underscore the ORC6’s specific involvement in regulating NFκB signaling.

Both dsRNA and HMGB1 activate the TLR-NFκB signaling pathway, leading to cytokine production and pro-inflammatory responses [35, 36]. A key discovery of this study is the significance of ORC6 in this process induced by both stimuli. In THP-1 macrophages, silencing or depleting ORC6 inhibited NFκB activation and the subsequent production of pro-inflammatory cytokines triggered by dsRNA or HMGB1. Conversely, overexpression of ORC6 enhanced these responses, indicating its pivotal role in modulating NFκB-mediated inflammatory signaling by other TLR ligands.

In vivo studies demonstrated that macrophage-specific knockdown of ORC6 conferred protection to mice against LPS-induced septic shock and inhibited pro-inflammatory cytokines production. These results provided robust proof of concept for these therapeutic approaches. While these findings are promising, it is imperative to validate them through rigorous other studies.

It should be noted that the pathophysiology of sepsis by LPS involves multiple transcription factors and a complex network of signaling pathways [43]. While our findings indicate that ORC6 is a significant mediator in LPS-induced NF-κB activation and the subsequent pro-inflammatory response, it is possible targeting NF-κB alone may not be sufficient for preventing septic mortality [43]. Further investigation is warranted to elucidate the intricate interplay between ORC6 and other signaling components, as well as transcription factors, within the context of LPS-induced sepsis. This comprehensive understanding is paramount to optimizing the therapeutic potential of ORC6.

In conclusion, the identification of ORC6 as a crucial mediator of LPS-induced NFκB activation and pro-inflammatory responses represents a significant advance in our understanding of inflammatory pathways. This discovery not only enhances our basic understanding of inflammation but also offers promising translational opportunities for developing new treatments for sepsis and other inflammatory diseases.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

ZX, HL, JZ, and KS contributed to designing the study and conducting all experiments. JS, and KS drafted the article, critically reviewed it for significant intellectual contributions, and provided final approval for the version submitted to the journal.

Funding

This work is supported by the Natural Science Foundation of Shanghai (21ZR1456400 and 22ZR1455000). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics statement

This study was approved by Ethics Committee of Fudan University and was in accordance with the Declaration of Helsinki.

Competing interests

The authors declare no competing interests.

Conflict of interest

The authors listed declare no conflicts of interest.