Abstract
ATP-binding cassette (ABC) transporters, including P-glycoproteins (PGP), have been implicated in drug resistance in different organisms including Haemonchus contortus. This study confirmed the resistance status of H. contortus isolates selected for ivermectin (IVM) and oxfendazole (OXF) resistances using the fecal egg count reduction test and evaluated the gene expression of seven ABC transporters using RT-qPCR for two biological scenarios: the effect of selection for anthelmintic resistance and the effect of drug exposure on gene expression. Gene expression results showed that selection for IVM resistance led to the significant upregulation of Hco-pgp-9a (1.5-fold), Hco-pgp-11 (3-fold) and Hco-haf-9 (1.5-fold) (p < 0.05). Similarly, selection for OXF resistance led to the significant upregulation of Hco-pgp-9a (3-fold), Hco-pgp-11 (4-fold) and Hco-haf-9 (2-fold) when comparing with the unselected ISE isolate (p < 0.05). Exposure of selected isolates to anthelmintics lead to no significant upregulation of the studied transporter genes. We also observed instances where there was strong intragroup variation regarding samples originating from parasites obtained from different individual hosts pointing that the interactions of the animal host with the tested anthelmintics may also play a role in the expression of the studied nematode genes.
Keywords: Nematode, benzimidazoles, macrocycle lactones, P-glycoproteins, resistance mechanisms
Introduction
Parasitism by gastrointestinal nematodes is one of the main causes of losses in small ruminant production systems (Shakya et al., 2017; Khan, et al., 2021). Control of these parasites can be carried out with the use of commercial anthelmintics, vaccination (Barbevax®) and through non-chemical control that concerns different management protocols (Arsenopoulos et al., 2021). However, control with anthelmintics such as benzimidazoles and macrocyclic lactones are still the main choice and the use of these drugs leads to the inevitable emergence of anthelmintic resistance (Geurden et al., 2014; Herrera-Manzanilla et al., 2017; Santos et al., 2017). Haemonchus contortus is an important trichostrongylid parasite due to the quick development of resistance to the main anthelmintic classes, significant economic losses in high prevalence regions worldwide, and aspects in its biology and physiology such as the high biotic potential and high pathogenicity (Gilleard, 2006, 2013). Anthelmintic resistance mechanisms are multifactorial and involve genetic alterations such as changes in the drug target, in its expression, and in drug distribution which prevent it from reaching its target. It is thought that resistance to ivermectin is polygenic (Lespine et al., 2012; Redman et al., 2012) while benzimidazole resistance is associated with polymorphisms in the beta-tubulin isotype 1 (Ghisi et al., 2007; Prichard, 2001; Silvestre and Cabaret, 2002) gene but it may also be associated with drug efflux transporters (Blackhall et al., 2008) thus being also polygenic.
ABC transporters are membrane proteins grouped into subclasses according to their structure and biological function. These proteins obtain energy from ATP hydrolysis to move a variety of compounds across biological membranes (Locher, 2016). The full structure of an ABC transporter consists of two nucleotide binding domains (NBD) and two transmembrane domains (TMD) while the structure of a half transporter is composed of only one NBD and one TMD and form dimers to become functional (Xiong et al., 2015). The P-glycoprotein transporters are of particular interest as they have been generally implicated in cases of drug resistance (Lespine et al., 2012; Ardelli and Prichard, 2013; Bygarski et al., 2014). In total, the H. contortus genome contains ten functional genes coding for P-glycoprotein transporters (pgp). Gene duplications in C. elegans (pgp-3 and pgp-4; pgp-12, pgp-13 and pgp-14) correspond to single genes in H. contortus (pgp-3 and pgp-13). Two paralogue copies of Cel-pgp-9 are present in the H. contortus genome (pgp-9a and pgp-9b) (Laing et al., 2013). Four pgp genes (pgp-5, pgp-6, pgp-7 and pgp-8) are absent in H. contortus and, in addition, the parasite genome encodes Hco-pgp-16, which is absent in C. elegans (Laing et al., 2013). The HALF transporters, which are PGP-related, can also participate in anthelmintic resistance (Yan et al., 2012). In C. elegans, eight haf genes are found and only five of them are present in the H. contortus genome (haf-2, haf-3, haf-4, haf-6 and haf-9). Generally, many anthelmintics actively bind PGPs and, therefore, are amenable to removal through increased expression of this efflux pump (Kerboeuf et al., 2003; Godoy et al., 2015 b ; 2016; Kotze and Prichard, 2016; Gerhard et al., 2020). This study aimed to evaluate the expression levels of 6 PGP transporters and 1 half transporter in H. contortus isolates previously selected for oxfendazole (OXF) and ivermectin (IVM) resistance in comparison to the susceptible isolate ISE (pre-selection) as well as evaluating changes in gene expression of the same genes after exposure to these anthelmintics in comparison to non-exposed isolates.
Material and Methods
Animal welfare
The use of animals in this experiment was in accordance with internationally accepted guidelines for the experimental use of animals and was approved by the Embrapa Caprinos e Ovinos Local Ethics Committee Authorization Protocol number 010/2015. Animal maintenance and confinement conditions were as previously described (Santos et al., 2017). Before experimental infections, all lambs were treated with ivermectin (200 μg/kg) (Ivomec, Boehringer Ingelheim, Germany), oxfendazole (5 mg/kg) (Oxfaden, Biovet, Brazil), monepantel (2.5 mg/kg) (Zolvix, Novartis, Switzerland) and levamisole (7.5 mg/kg) (Ripercoll, Zoetis, U.S.A.) to become worm-free. Confirmation that the animals were free of gastrointestinal nematodes was done by eggs per gram (EPG) counts and fecal cultures.
Isolates of Haemonchus contortus
The resistant H. contortus isolates used here were one selected for IVM resistance (IVM-ISE) and another selected for OXF resistance (OXF-ISE). The IVM-ISE isolate is resistant to both ivermectin and oxfendazole while the OXF-ISE isolate is resistant to oxfendazole only. These isolates were independently selected starting from the Inbred Strain Edinburgh (ISE) isolate as previously described (Santos et al., 2017). The Haemonchus contortus ISE isolate (Roos et al., 2004) was used for comparisons against the resistant isolates in the gene expression section of the study.
Faecal egg count reduction test (FECRT)
The FECRT was performed to confirm the resistance status of the isolates used here. Two groups of worm-free six-month-old male lambs (n = 18 per group) were infected orally with 3,000 L3 larvae of IVM-ISE isolate for one group and with 3,000 L3 larvae of OXF-ISE isolate for the other. Two additional worm-free lambs were not infected in order to monitor any possible contamination from outside sources using weekly EPG counts and fecal cultures. Infection was monitored by EPG counts using the modified McMaster technique (Ueno and Gonçalves, 1998) and a multiplication factor of x25. Infected animals were further divided into four groups (n = 9 per group) according to anthelmintic treatments: groups A1 and A3 were treated with OXF (5 mg/kg) (Oxfaden, Biovet, Brazil) and groups A2 and A4 were treated with ivermectin (200 µg/kg) (Ivomec, Boehringer Ingelheim, Germany) (Table 1). Groups were placed in individual stalls with raised slatted floors. Feces for EPG counts and efficacy calculations were collected before and after treatment on days eight for groups treated with OXF and fourteen for groups treated with IVM (Coles et al., 2006).
Table 1 - . Experimental design for the fecal egg count reduction test showing the H. contortus isolates used and anthelmintic treatments with ivermectin and oxfendazole.
| Treatment groups for FECRT (n = 9 animals per group) | |
|---|---|
| Animals infected with the IVM-ISE isolate | Animals infected with the OXF-ISE isolate |
| A1: OXF Treatment (5 mg/kg) | A3: OXF Treatment (5 mg/kg) |
| A2: IVM Treatment (200 µg/kg) | A4: IVM Treatment (200 µg/kg) |
Experimental design for gene expression study
Nine male lambs infected with IVM-ISE (3,000 L3 larvae per animal) were divided into three groups (n = 3) and six male lambs infected with OXF-ISE (3,000 L3 larvae per animal) were divided into two groups (n = 3). These groups were treated with IVM (Ivomec, Boehringer Ingelheim, Germany) or OXF (Oxfaden, Biovet, Brazil) as shown in Table 2, with controls without treatment for each isolate. Another group with 3 male lambs was infected with the ISE isolate (3,000 L3 larvae per animal). Two animals from each group were euthanized between 12 to 14 hours after dosing with anthelmintics. This timing was selected in order to expose the parasites to concentrations close to the peak plasma levels (Alvinerie et al., 2008; Viviani et al., 2019). Two additional worm-free lambs were not infected in order to monitor any possible contamination from outside sources using weekly EPG counts and fecal cultures. All parasites were collected from the abomasum of each animal, stored in RNAlater (Invitrogen, Carlsbad, CA, USA) and counted. The parasites were separated in males and females using optic microscopy and stored in RNAlater (Invitrogen, Carlsbad, CA, USA) at -80 °C until total RNA extraction. Thus, this experiment analyzes two biological events: selection for resistance comparing the untreated groups with the ISE group and drug exposure comparing treated groups with untreated ones (Table 2). It must be noted that the ISE infected group, euthanasia and parasite collection were done three months before the remaining groups due to infrastructure limitations. However, the entire study occurred during the same season of the year (dry season) in order to minimize environmental effects that may affect gene expression in this experiment.
Table 2. Haemonchus contortus isolates used in the experimental groups for gene expression analysis and the anthelmintic treatments used.
| Susceptible isolate. | Selected for anthelmintic resistance. | Resistant isolates exposed to anthelmintics. |
|---|---|---|
| ISE (Inbred Strain Edinburgh). | B1: IVM-ISE isolate no treatment. | B2: IVM-ISE isolate exposed to IVM (200 µg/host kg). |
| B3: IVM-ISE isolate exposed to OXF (5 mg/host kg). | ||
| C1: OXF-ISE isolate no treatment. | C2: OXF-ISE isolate exposed to OXF (5 mg/host kg). |
Nucleic acids extraction
Genomic DNA was extracted from 20,000 ISE L3 larvae as previously described (Santos et al., 2014). Total RNA was extracted from three pools of approximately 20 males of H. contortus from each euthanized animal from each experimental group (2 lambs/group). The RNA extraction was performed with the Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions with the following modifications in material disruption: adult males were suspended in Trizol and physically disrupted by shaking with 1 mm zirconia/silica beads in a Mini-BeadBeater-16 (Biospec Products, Bartlesville, OK, USA) for four 20 second runs. The integrity of the RNA samples was confirmed by visualization of 28S and 18S ribosomal bands under an UV light source after electrophoresis in 1.5% agarose gel stained with ethidium bromide. Samples concentration and purity were determined by UV spectrophotometry at 260 and 280 nm (i-Quant, Loccus, Brazil) and stored at -80 °C.
Primers and establishment of RT-qPCR
The NCBI nucleotide database and the literature were searched in order to identify all gene sequences of interest, including the available H. contortus six pgps and one haf transporter which may be involved in anthelmintic resistance (Yan et al., 2012). GenBank accession numbers for all studied genes were obtained, and the BLASTN tool (Altschul et al., 1990) available at the H. contortus genome database (WormBase ParaSite BioProject PRJEB506) was used to find the genomic sequences for the studied genes. At least one primer from each pair was designed to anneal across the border of adjacent exons to prevent amplification of DNA that may have been extracted along with RNA (Primer3Plus) (Untergasser et al., 2007). Glyceraldehyde-3-phosphate dehydrogenase (Hco-gapdh), actin 1 (Hco-act-1), ribosomal protein L9 (Hco-prl9) and tyrosine-3-monoxygenase (Hco-ftt-2) were selected as candidate reference genes and primers for these were designed in the same manner as described above (Lecová et al., 2015; Toscano et al., 2018) with the exception of the actin gene where the primer sequences were obtained from the literature (Maté et al., 2018).
Efficiency curves were assembled to test the designed primers. Complementary DNA samples from the ISE isolated were synthesized with the SuperScript ™ IV VILO ™ Master Mix two-step kit according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA) on a Mastercycler ep Gradient S Realplex4 (Eppendorf, Germany) thermocycler. Datapoints consisted of reactions containing serial dilutions based in the amount of total RNA used in cDNA synthesis (0.8-500 ng/rxn in five-fold increments). The percentage amplification efficiency of each target was determined according to equation E = 10(-1/S)-1, where S was the slope of the standard curve generated from quantification cycle (Cq) values of each reaction for a given primer pair. In addition, primers were tested with H. contortus gDNA to confirm its specificity, and reaction products were visualized under an UV light source, after electrophoresis, on ethidium bromide stained 1.5% agarose gels. Polymerase chain reactions using gDNA were assembled as follows: 12.5 μL 2x Fast Start Universal SYBR Green Master Mix (Roche, West Sussex, UK), 100 nM of each primer (forward and reverse), 25 ng of total DNA and water for final volume of 25 μL. Amplification conditions were: 95 °C for 10 min and 35 cycles at 95 °C for 10 s, 58 °C for 30 s and extension at 72 °C for 30 s. Melting curve analysis was applied to detect primer dimers.
Gene expression analysis
All RT-qPCR tests were performed in triplicate using the GoTaq® 1-Step RT-qPCR System reverse transcriptase kit (Promega, Madison, Wisconsin, USA) following the manufacturer’s protocol. Reactions contained 2X GoTaq® qPCR Master Mix, 50X GoScript™ RT Mix for 1-Step RT-qPCR, 100 nM of each primer (forward and reverse), 100 ng of total RNA and water for a final volume of 25 μL. Negative controls used water instead of RNA. Amplification conditions were: 37 °C for 15 min, 95 °C for 10 min and 35 cycles at 95 °C for 10 s, 58 °C for 30 s and extension at 72 °C for 30 s. Melting curve analysis was applied to detect primer dimers. Amplified product lengths were confirmed on ethidium bromide stained 1.5% agarose gels after electrophoresis and visualized on an UV light source.
Data analysis
Anthelmintic efficiency was calculated based on EPG data before and after treatment using a Bayesian hierarchical model in the egg counts software available at http://shiny.math.uzh.ch/user/furrer/shinyas/shiny-eggCounts/ (Torgerson et al., 2014).
The Cq values for RT-qPCR reactions were determined by the software Realplex 2.2 (Eppendorf, Hamburg, Germany). The stability of the four candidate reference genes was tested using pair-wise correlation analysis by the Bestkeeper software version 1 (Pfaffl et al., 2004). Normalized relative expression was calculated per animal and then per experimental group as previously described (Taylor et al., 2019).
Data normality was verified using the Shapiro-Wilk test (Shapiro and Wilk, 1965). Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE with B1 and C1 and the exposure experiment comparing B1 with B2 and B3. Student’s t-test was used for the exposure experiment comparing C1 and C2 (Graphpad Prism Software 6.05, La Jolla, CA, USA) (Table 2). A value of p < 0.05 was considered for statistical significance.
Results
Faecal egg count reduction test (FECRT)
The results of the FECRT are shown in Table 3. Group A1 showed an increase in egg counts. In contrast, the other groups showed a decrease in egg counts, especially the group A4, which showed a high decrease (97%).
Table 3 - . Fecal egg count reduction test results, EPG count means before and after treatment, efficacy and 95% confidence interval in parentheses.
| Groups | EPG Means | % Efficacy (95% CI) FECRT | ||
|---|---|---|---|---|
| Day 0 | Day 8 | Day 14 | ||
| A1¹ | 2525 | 4758.3 | - | 0 (-8 : -228) |
| A2¹ | 2338.9 | - | 1877.7 | 21 (-52 : -59) |
| A3 ¹ | 7603.1 | 5718.8 | - | 25 (-51 : 63) |
| A4 ¹ | 7482.1 | - | 200 | 97 (89 : -99) |
A1: IVM-ISE infected lambs treated with OXF (5 mg/kg); A2: IVM-ISE infected lambs treated with IVM (200 µg/kg); A3: OXF-ISE infected lambs treated with OXF (5 mg/kg); A4: OXF-ISE infected lambs treated with IVM (200 µg/kg).
RT-qPCR evaluation
Accession numbers for the Haemonchus contortus complete genes used in primer design are shown in Table S1. All used primer pairs showed amplification efficiencies above 90% (Table 4) and PCR reactions using gDNA showed no amplification, confirming their specificity for RNA. Only one band was visualized after agarose gel electrophoresis of all reverse transcribed amplified products, demonstrating the specificity of the assays (Figures S1, S2, S3, S4 and S5).
Table 4 - . Primer sequences used in the RT-qPCR assays, predicted product lengths and validation results. F: foward and R: reverse.
| Gene | Primer sequences (5’ to 3’) | Product size (bp¹) | Reaction efficiency | Linear dynamic range | r2 |
|---|---|---|---|---|---|
| Hco-pgp-2 | F: AGGATGGTGTCACGAAGAAAAT | 172 | 100% | 26.91-34.89 | 0.965 |
| R: GCCATCACAGTGCTTTTTCC | |||||
| Hco-pgp-3 | F: TCAAAGTCGTGCAGATCGAG | 107 | 99% | 23.05-32.50 | 0.993 |
| R: AGTTGTCACGAGCACTTTCA | |||||
| Hco-pgp-9a | F: ACGTGAAGTGAACCCAACTC | 197 | 91% | 24.13-32.16 | 0.989 |
| R: TGTTGTAACCATCTGGCAGG | |||||
| Hco-pgp-10 | F: CAGAAAGATTATGCGCCACG | 199 | 104% | 26.55-31.94 | 0.954 |
| R: GAGTGCCATCTTCCAGTTGA | |||||
| Hco-pgp-11 | F: GTTTTGGTGGATGGTCAGGT | 166 | 95% | 22.63-32.78 | 0.996 |
| R: TCGAGACACGCTTGAACATC | |||||
| Hco-pgp-16 | F: TTGAATCCTTGAACACCGCG | 164 | 91% | 23.32-30.92 | 0.994 |
| R: TCCGCGTAACTTAGTTTGCA | |||||
| Hco-haf-9 | F: CAGGTCTGTCACGGAAAACA | 170 | 94% | 20.78-30.67 | 0.991 |
| R: GTTGCTTTTGTCCACCTGAC | |||||
| Hco-gapdh | F: GAGCACTCACAGGATCAAGG | 163 | 95% | 15.40-25.32 | 0.993 |
| R: AGCAGAGATGACGACCTTCT | |||||
| Hco-act | F: GCTCCCAGCACGATGAAAA | 100 | 96% | 18.20-28.06 | 0.985 |
| R: CACCAATCCAGACAGAGTATTTGC | |||||
| Hco-prl9 | F: TCAAGGGTGTCACTAAGGGT | 115 | 91% | 16.20-26.22 | 0.985 |
| R: CCGAGGAAGTTACGAATCTCA | |||||
| Hco-ftt-2 | F: CGATTGAGCAGAAGACGGAA | 113 | 98% | 14.24-23.99 | 0.995 |
| R: GAGCAGGTTCAAAACGTCCT |
base pairs
Gene expression
BestKeeper analysis results determined Hco-gapdh, Hco-prl9 and Hco-ftt-2 as the most stable genes with low coefficients of variation, unlike Hco-act-1 which presented a high coefficient of variation (CV = 5.59%). Therefore, Hco-gapdh, Hco-prl9 and Hco-ftt-2 were considered as the reference genes for relative gene expression calculations in this study. All used primers were evaluated by melting curve analysis resulting in single defined peaks at the expected melting temperature of the PCR products (data not shown).
The results obtained by the normality test indicated that the data followed a normal distribution (p < 0.05). The comparison between groups B1 (IVM-ISE) and C1 (OXF-ISE) with the ISE isolate addresses the selection process for anthelmintic resistance (Table 2). Relative profiles of gene expression in adult male parasites in groups B1 and C1 showed significant changes compared to the ISE control (p < 0.05). Hco-haf-9, Hco-pgp-9a and Hco-pgp-11 were upregulated in both selection groups (Figures 1 a , 2a and 3a). Hco-haf-9 about 1.5-fold in B1 and 2-fold in C1, Hco-pgp-9a about 1.5-fold in B1 and 3-fold in C1 and Hco-pgp-11 about 3-fold in B1 and ~4-fold in C1. On the other hand, Hco-act-1 and Hco-pgp-10 were downregulated more than 2-fold in both selection groups (Figures 4 a and 5a). Hco-pgp-16 was downregulated ~1.5-fold in the ivermectin selection group (Figure 6 a ). Direct comparison between the selected groups B1 and C1 showed statistically significant differences in the expression of Hco-act-1, Hco-pgp-9a and Hco-pgp-16 (p < 0.05 ) (Figures 2 a , 4a and 6a).
Figure 1 - . Scatter plot showing relative expression of the gene Hco-haf-9 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 2 - . Scatter plot showing relative expression of the gene Hco-pgp-9a of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 3 - . Scatter plot showing relative expression of the gene Hco-pgp-11 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 4 - . Scatter plot showing relative expression of the gene Hco-act-1 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 5 - . Scatter plot showing relative expression of the gene Hco-pgp-10 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 6 - . Scatter plot showing relative expression of the gene Hco-pgp-16 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Comparisons between groups B2 (ivermectin treated IVM-ISE) and B3 (oxfendazole treated IVM-ISE) with B1 (untreated IVM-ISE) and C2 (oxfendazole treated OXF-ISE) with C1 (untreated OXF-ISE) reflect exposure to anthelmintics. In general, gene expression levels did not show significant upregulation due to exposure to anthelmintics with the exception of Hco-act-1. This gene showed significant upregulation upon exposure of B1 to anthelmintics, with a ~4-fold increase in expression in the B2 group and a 2-fold increase in expression in the B3 group (Figure 4 b and 4c). Hco-haf-9 also showed significant changes in expression in all groups exposed to anthelmintics, ranging from a 1.5 drop in expression in group C2 to a 2.3 drop in expression in group B2 (Figures 1 b and 1c). Hco-pgp-3 showed changes in B2 and B3 with a drop in expression of ~1.5 fold (Figures 7 b and 7c). Hco-pgp-2, Hco-pgp-9a, Hco-pgp-10 and Hco-pgp-11 showed a significant drop in expression in B2 and C2 (Figures 2, 3, 5 and 8). We also observed a strong variation in results when analyzing gene expression in H. contortus males obtained from different hosts from the same groups which can be seen in the Figures as very wide standard deviation intervals.
Figure 7 - . Scatter plot showing relative expression of the gene Hco-pgp-3 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Figure 8 - . Scatter plot showing relative expression of the gene Hco-pgp-2 of Haemonchus contortus adult males. Relative gene expression values are shown on the Y axis. The X axis contains the different groups studied: a) the Inbred Strain Edinburgh (ISE) isolate is the unselected control, isolate ISE selected for IVM resistance (IVM-ISE), isolate ISE selected for OXF resistance (OXF-ISE); b) IVM-ISE isolate treated with IVM (200 µg/host kg) (IVM-ISE-IVM), IVM-ISE isolate treated with OXF (5 mg/host kg) (IVM-ISE-OXF); c) OXF-ISE isolate treated with OXF (5 mg/host kg) (OXF-ISE-OXF). All treated groups were sampled at 12-14 hours after the hosts received the anthelmintic. Relative gene expression statistical analysis consisted of a one-way ANOVA test with Bonferroni’s correction for multiple comparisons for the selection experiment comparing ISE, IVM-ISE and OXF-ISE and the exposure experiment comparing IVM-ISE, IVM-ISE-IVM and IVM-ISE-OXF. Student’s t-test was used for the exposure experiment comparing OXF-ISE and OXF-ISE-OXF. Asterisks represent significant differential gene expression levels between compared groups (p < 0.05).

Discussion
Fecal egg count reduction results confirmed in vivo the resistance status of the isolates resulting from the selection process carried out previously (Santos et al., 2017). The selection of H. contortus ISE for IVM resistance led to the development of OXF and IVM resistance. However, the selection of H. contortus ISE for OXF led to OXF resistance only. It has been shown that ivermectin can bind tubulin and affect cytoskeleton dynamics (Ashraf et al., 2015). In addition, the SNP F200Y has been detected in macrociclic lactone resistant individuals that have never been exposed to benzimidazoles (Mottier and Prichard, 2008). Benzimidazoles and macrocyclic lactones are commonly used in the field in Brazil and alternations between these two classes can contribute to the maintenance of high levels of BZ resistance seen in populations of H. contortus (Santos et al., 2017).
In our study, the Hco-act-1 gene was not suitable as a control gene due to a high coefficient of variation among different groups. In this context, another study of p-glycoprotein gene expression in H. contortus also showed actin as a least stable candidate reference gene (Giglioti et al., 2022). In our case, this is not surprising as the anthelmintics studied here are known to interact with the microtubular component of the cytoskeleton. It should be expected that disturbances in the microtubules may impact microfilament dynamics as well since it has been shown that microtubules interact with microfilaments with impacts in three-dimensional cell structure among other cellular activities (Griffith and Pollard, 1982; Dugina et al., 2016). While these studies describe interactions at the protein level, it may be possible that interactions between the tested anthelmintics and tubulin microtubules will disrupt the microtubular cytoskeleton (Lacey, 1988; Kohler, 2001) and lead to gene expression changes in other genes coding for cytoskeletal proteins such as actin. In addition, gene expression changes in actin have been reported in different life stages of Teladorsagia circumcincta albeit not between ivermectin resistant and susceptible isolates (Dicker et al., 2011). We observed significant changes in actin gene expression both due to selection (downregulation) and anthelmintic exposure (upregulation) which suggest that cytoskeleton protein coding genes may not be the best controls when analyzing gene expression changes induced by compounds that interact with cytoskeleton components.
The interaction of PGPs with ivermectin have been previously demonstrated in Haemonchus contortus (Prichard and Roulet, 2007; Godoy et al., 2015 b ) in addition to their upregulation in ivermectin resistant field strains (Xu et al., 1998). The role of PGPs in benzimidazole resistance has also been considered in multidrug-resistant cells as interactions were detected between BZs and PGPs (Nare et al., 1994). Furthermore, the linker domain present in many ABC transporters was also shown to bind α- and β-tubulin in drug-resistant tumor cell lines (Georges, 2007). BZs are known to target β-tubulin in helminths and resistance to this class of drugs is associated with aminoacid changes in this protein (Robinson et al., 2004; Kotze and Prichard, 2016). In H. contortus specifically, polymorphism selection of P-glycoprotein locus in a cambendazole resistant strain and another thiabendazole resistant strain has been detected (Blackhall et al., 2008). It was also shown, using the egg hatch assay, that the PGP inhibitor verapamil can increase BZ toxicity in BZ resistant H. contortus isolates (Beugnet et al., 1997) suggesting that the involvement of these proteins in benzimidazole resistance is possible. On the other hand, another study using pig kidney epithelial cell lines overexpressing a murine PGP transporter, while detecting some interaction with benzimidazoles, failed to detect specific interactions between PGP and oxfendazole (Dupuy et al., 2010). One last in vitro study using transduced MDCK II cell lines detected interactions between oxfendazole and breast cancer resistant human protein BCRP, another type of ABC transporter (Merino et al., 2005). Thus, the role of PGP in BZ resistance cannot be totally discarded.
Hco-pgp-2 was the first PGP associated with IVM resistance in H. contortus eggs using isolates selected (MKIR) and unselected (MKIS) for resistance (Xu et al., 1998). Hco-pgp-2 is expressed in the pharynx and adjacent nervous tissue, suggesting an important role in protecting nematode tissues against the effects of anthelmintics (Godoy et al., 2015 a ). Recently, it has been shown in an isolate resistant to anthelmintics, including ivermectin, that Hco-pgp-2 expression is slightly higher in eggs and L1 larvae than other life stages of this parasite in comparison with the susceptible isolate (Giglioti et al., 2022). Adult females selected for IVM resistance in Argentina showed upregulation of Hco-pgp-2 when compared to a local susceptible isolate and that gene expression was upregulated in resistant females after IVM exposure (Lloberas et al., 2013). On the other hand, ivermectin exposure of resistant adult H. contortus females in Argentina showed an increase in Hco-pgp-2 expression but the results were not significant (Maté et al., 2018). Both mentioned studies used whole adult females including eggs, which may have influenced their results, in addition to the high genetic variability found in H. contortus populations (Gilleard and Redman, 2016). In the case of L3 larvae, there were no differences in expression between ISE-derived resistant and ISE susceptible isolates (Williamson and Wolstenholme, 2012). Hco-pgp-2 expression in adult males presented here showed high intragroup variation especially from samples from different host animals. Although we observed a significant drop in expression after exposure to IVM and OXF in their own selection groups, we did not find significant changes caused by IVM and OXF selection (Figure 8). Likewise, Hco-pgp-3 was downregulated by exposure to anthelmintics but only in the IVM-selected isolate, showing wide variation between samples from different host animals (Figure 7). Hco-pgp-3 was downregulated at 12 and 24 hours in resistant adult H. contortus females from Argentina after exposure to IVM (Maté et al., 2018) but these results were not significant. In C. elegans this protein localizes in the gut and appears to be involved in resistance against heavy metals, chloroquine, colchicine and pyocyanin-dependent killing by Pseudomonas aeruginosa (Lincke et al., 1993; Broeks et al., 1995; Broeks et al., 1996; Lindblom et al., 2001). Indeed, increased levels of Hco-pgp-3 have been observed in four different resistant isolates in first-stage larvae (Sarai et al., 2013; Giglioti et al., 2022). Clearly, this protein has more important roles in H. contortus free-living stages where it may come in contact with adverse compounds and toxin producing microorganisms.
Anthelmintic resistance selection led to Hco-pgp-9a upregulation with stronger effects for OXF resistance selection (Figure 2 a ). In terms of exposure to anthelmintics, expression levels did not show statistically significant differences except in the IVM-exposed IVM-selected isolate, where it showed a drop in expression (Figure 2 b ). Similarly, it has been shown that Hco-pgp-9a was downregulated in adult females from Argentina after IVM dosing (Maté et al., 2018) but in another study drug exposure did not significantly alter gene expression (Maté et al., 2022). In Teladorsagia circumcincta this gene was shown to be upregulated in a multidrug resistant isolate (Dicker et al., 2011) which matches our observations when comparing selected and non-selected isolates (Figure 2 a ).
Little is known about pgp-10 gene expression in H. contortus and what is known addresses its expression changes along the parasite life cycle. It was shown that this gene is overexpressed in Weybridge isolate L3 larvae in relation to its expression in eggs (Issouf et al., 2014). Simlarly, it is also shown to be upregulated in dauer stages in C. elegans (https://wormbase.org/species/c_elegans/gene/WBGene00004004#0c1-9gb6-10). In addition, an increase in the expression of this gene was observed in first-stage larvae in IVM-resistant isolates (Giglioti et al., 2022). In this work, we observed a significant downregulation of this gene in the selection groups versus the unselected ISE isolate. Exposure to anthelmintics caused a drop in gene expression (Figure 5). This indicates that the contribution of this gene to OXF and IVM resistance in adults could be rather small and that its roles may be more important in life stages where metabolic activity is rather decreased.
Like Hco-pgp-9a, Hco-pgp-11 showed positive regulation in terms of selection, but we observed a variation in expression results between samples originating from nematodes from different animals, except for the ISE isolate (Figure 3 a ). In terms of exposure to anthelmintics, negative regulation was observed in the same way as in Hco-pgp-2 (Figures 3 b and 3c). Parascaris equorum exposed in vitro to IVM showed no changes in the expression of this gene but SNPs potentially associated with IVM resistance were identified (Janssen et al., 2013). Thus, we cannot completely discard pgps showing little or no change in gene expression both for selection or exposure such as Hco-pgp-2, and Hco-pgp-3 from participating in anthelmintic resistance as no sequencing was done in this study in order to detect resistance associated polymorphisms in the analyzed genes.
Hco-pgp-16 was ~1.5-fold downregulated as a result of IVM resistance selection, and we observed strong intragroup variation in expression for this gene when looking at samples from different animals. This gene was shown to be overexpressed in Weybridge isolate adult males in response to eosinophil granule proteins and it was also shown to be involved with macrocyclic lactone transport in the PF 23 susceptible strain (Issouf et al., 2014; Godoy et al., 2015 b ). We believe that further characterization is necessary in order to clarify the real association of this gene and anthelmintic resistance.
Hco-haf-9 transporter was upregulated by anthelmintic selection while exposure led to downregulation (Figure 1). In contrast, the role of different ABC transporters, including haf-9, was evaluated in a C. elegans strain selected for IVM resistance. While several ABC transporters were overexpressed in the IVM resistant strain, it was not the case for haf-9. Downregulation of haf-9 reduced egg production, but increased motility, at the highest IVM concentrations tested. However, haf transporters 1, 2 and 3 were over-expressed in an IVM resistant isolate (Yan et al., 2012). Thus, it is possible that haf transporters could be involved in anthelmintic resistance.
Most of the tested genes showed strong intragroup variation associated with samples from different hosts. This is expected as it is known that in sheep and goats drug exposure varies among different individual animals (Scott et al., 1990; Cerkvenik et al., 2002). Overall, selection for resistance led to upregulation only in the Hco-pgp-9a, Hco-pgp-11 and Hco-haf-9 genes. In terms of exposure, no significant upregulations in expression were observed in any of the genes studied. The high expression of pgps resulting from the selection process may imply that a greater amount of ABC transporters are available in the cells and this would assist in the survival of the parasite once exposed to the anthelmintic. On the other hand, we only studied one time point and it is possible that further changes in gene expression could occur as time passes as previously described for some PGP genes in H. contortus (Maté et al., 2018).
In conclusion, we showed that different ABC transporters may present expression variations in both selection and exposure scenarios consistent with the literature in general. While Hco-pgp-9a is generally well-studied, Hco-pgp-11 and Hco-haf-9 are interesting additional candidates for further studies and the search for inhibitors. ABC transporter studies offer an opportunity to develop control strategies against nematodes as the inhibition of transporter activity may be carried out using multidrug resistance inhibitors in combination with commercial anthelmintics such as macrocyclic lactones. This combined use can lead to higher exposure of the parasite to the anthelmintic and increased drug efficacy (Raza et al., 2023). While the interaction of PGPs and benzimidazoles has been studied previously and the specific interaction of oxfendazole and PGPs being rather unlikely, it cannot be totally excluded due to the expression results for Hco-pgp-9a obtained in this study. The wide variety of binding sites present in these proteins and that selection for benzimidazole resistance in H. contortus resulted in increased allelic frequencies for specific PGP allelic variants. Finally, while the interaction of IVM and PGPs is well documented, the wide variation found in our results, and other studies, regarding parasites obtained from different host animals points toward the importance of the host-parasite relationship which should be the subject of future studies. The positive regulation of cellular efflux mechanisms such as PGPs is one of the mechanisms of anthelmintic resistance and understanding how they function is important to managing this problem. Viable P-glycoprotein inhibitors, once identified, may further add to the toolbox available to mitigate the consequences of anthelmintic resistance together with other known resistance management strategies.
Acknowledgements
This work was financially supported by CAPES (projects 1750956 and 88882.365164/2019-01), FUNCAP (projects 0008-01351.01.09/19 and BP2_0107-00246.01.00/15) and CNPq (Project 135873/2018-5) and we also acknowledge Embrapa Caprinos e Ovinos for infrastructure support.
Supplementary material.
The following online material is available for this article:
References
- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- Alvinerie M, Dupuy J, Kiki-Mvouaka S, Sutra JF, Lespine A. Ketoconazole increases the plasma levels of ivermectin in sheep. Vet Parasitol. 2008;157:117–122. doi: 10.1016/j.vetpar.2008.06.017. [DOI] [PubMed] [Google Scholar]
- Ardelli BF, Prichard RK. Inhibition of P-glycoprotein enhances sensitivity of Caenorhabditis elegans to ivermectin. Vet Parasitol. 2013;191:264–275. doi: 10.1016/j.vetpar.2012.09.021. [DOI] [PubMed] [Google Scholar]
- Arsenopoulos KV, Fthenakis GC, Katsarou EI, Papadopoulos E. Haemonchosis: A challenging parasitic infection of sheep and goats. Animals. 2021;11:363. doi: 10.3390/ani11020363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ashraf S, Beech RN, Hancock MA, Prichard RK. Ivermectin binds to Haemonchus contortus tubulins and promotes stability of microtubules. Int J Parasitol. 2015;45:647–654. doi: 10.1016/j.ijpara.2015.03.010. [DOI] [PubMed] [Google Scholar]
- Beugnet F, Gauthey M, Kerboeuf D. Partial in vitro reversal of benzimidazole resistance by the free-living stages of Haemonchus contortus with verapamil. Vet Rec. 1997;141:575–576. doi: 10.1136/vr.141.22.575. [DOI] [PubMed] [Google Scholar]
- Blackhall WJ, Prichard RK, Beech RN. P-glycoprotein selection in strains of Haemonchus contortus resistant to benzimidazoles. Vet Parasitol. 2008;152:101–107. doi: 10.1016/j.vetpar.2007.12.001. [DOI] [PubMed] [Google Scholar]
- Broeks A, Janssen HW, Calafat J, Plasterk RH. A P-glycoprotein protects Caenorhabditis elegans against natural toxins. EMBO J. 1995;14:1858–1866. doi: 10.1002/j.1460-2075.1995.tb07178.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Broeks A, Gerrard B, Allikmets R, Dean M, Plasterk RH. Homologues of the human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in the soil nematode Caenorhabditis elegans. EMBO J. 1996;15:6132–6143. [PMC free article] [PubMed] [Google Scholar]
- Bygarski EE, Prichard RK, Ardelli BF. Resistance to the macrocyclic lactone moxidectin is mediated in part by membrane transporter P-glycoproteins: Implications for control of drug resistant parasitic nematodes. Int J Parasitol Drugs Drug Resist. 2014;4:143–151. doi: 10.1016/j.ijpddr.2014.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cerkvenik V, Grabnar I, Skubic V, Doganoc DZ, Beek WM, Keukens HJ, Kosorok MD, Pogacnik M. Ivermectin pharmacokinetics in lactating sheep. Vet Parasitol. 2002;104:175–185. doi: 10.1016/s0304-4017(01)00612-4. [DOI] [PubMed] [Google Scholar]
- Coles GC, Jackson F, Pomroy WE, Prichard RK, Von Samson-Himmelstjerna G, Silvestre A, Taylor MA, Vercruysse J. The detection of anthelmintic resistance in nematodes of veterinary importance. Vet Parasitol. 2006;136:167–185. doi: 10.1016/j.vetpar.2005.11.019. [DOI] [PubMed] [Google Scholar]
- Dicker AJ, Nisbet AJ, Skuce PJ. Gene expression changes in a P-glycoprotein (Tci-pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int J Parasitol. 2011;41:935–942. doi: 10.1016/j.ijpara.2011.03.015. [DOI] [PubMed] [Google Scholar]
- Dugina V, Alieva I, Khromova N, Kireev I, Gunning PW, Kopnin P. Interaction of microtubules with the actin cytoskeleton via cross-talk of EB1-containing+ TIPs and γ-actin in epithelial cells. Oncotarget. 2016;7:72699. doi: 10.18632/oncotarget.12236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dupuy J, Alvinerie M, Ménez C, Lespine A. Interaction of anthelmintic drugs with P-glycoprotein in recombinant LLC-PK1-mdr1a cells. Chem Biol Interact. 2010;186:280–286. doi: 10.1016/j.cbi.2010.05.013. [DOI] [PubMed] [Google Scholar]
- Georges E. The P-glycoprotein (ABCB1) linker domain encodes high-affinity binding sequences to α-and β-tubulins. Biochemistry. 2007;46:7337–7342. doi: 10.1021/bi7006228. [DOI] [PubMed] [Google Scholar]
- Gerhard AP, Krücken J, Heitlinger E, Janssen IJI, Basiaga M, Kornaś S, Beier C, Nielsen MK, Davis RE, Wang J, et al. The P-glycoprotein repertoire of the equine parasitic nematode Parascaris univalens. Sci Rep. 2020;10:13586. doi: 10.1038/s41598-020-70529-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Geurden T, Hoste H, Jacquiet P, Traversa D, Sotiraki S, Regalbono AF, Tzanidakis N, Kostopoulou D, Gaillac C, Privat S. Anthelmintic resistance and multidrug resistance in sheep gastrointestinal nematodes in France, Greece and Italy. Vet Parasitol. 2014;201:59–66. doi: 10.1016/j.vetpar.2014.01.016. [DOI] [PubMed] [Google Scholar]
- Ghisi M, Kaminsky R, Mäser P. Phenotyping and genotyping of Haemonchus contortus isolates reveals a new putative candidate mutation for benzimidazole resistance in nematodes. Vet Parasitol. 2007;144:313–320. doi: 10.1016/j.vetpar.2006.10.003. [DOI] [PubMed] [Google Scholar]
- Giglioti R, Ferreira JFS, Luciani GF, Louvandini H, Okino CH, Niciura SCM, Oliveira MCS, Amarante AFT, Katiki LM. Potential of Haemonchus contortus first-stage larvae to characterize anthelmintic resistance through P-glycoprotein gene expression. Small Rumin Res. 2022;217:106864 [Google Scholar]
- Gilleard JS. Understanding anthelmintic resistance: The need for genomics and genetics. Int J Parasitol. 2006;36:1227–1239. doi: 10.1016/j.ijpara.2006.06.010. [DOI] [PubMed] [Google Scholar]
- Gilleard JS. Haemonchus contortus as a paradigm and model to study anthelmintic drug resistance. Parasitology. 2013;140:1506–1522. doi: 10.1017/S0031182013001145. [DOI] [PubMed] [Google Scholar]
- Gilleard JS, Redman E. In: Haemonchus contortus and Haemonchosis Past, Present and Future Trends. Gasser R, Von Samson- Himmelstjerna G, editors. Science Direct; 2016. Genetic diversity and population structure of Haemonchus contortus; pp. 31–68. [DOI] [PubMed] [Google Scholar]
- Godoy P, Lian J, Beech RN, Prichard RK. Haemonchus contortus P-glycoprotein-2: In situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol. 2015;45:85–93. doi: 10.1016/j.ijpara.2014.09.008. [DOI] [PubMed] [Google Scholar]
- Godoy P, Che H, Beech RN, Prichard RK. Characterization of Haemonchus contortus P-glycoprotein-16 and its interaction with the macrocyclic lactone anthelmintics. Mol Biochem Parasitol. 2015;204:11–15. doi: 10.1016/j.molbiopara.2015.12.001. [DOI] [PubMed] [Google Scholar]
- Godoy P, Che H, Beech RN, Prichard RK. Characterisation of P-glycoprotein-9.1 in Haemonchus contortus. Parasit Vectors. 2016;9:52. doi: 10.1186/s13071-016-1317-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Griffith LM, Pollard TD. The interaction of actin filaments with microtubules and microtubule-associated proteins. J Biol Chem. 1982;257:9143–9151. [PubMed] [Google Scholar]
- Herrera-Manzanilla FA, Ojeda-Robertos NF, González-Garduño R, Cámara-Sarmiento R, Torres-Acosta JFJ. Gastrointestinal nematode populations with multiple anthelmintic resistance in sheep farms from the hot humid tropics of Mexico. Vet Parasitol Reg Stud Reports. 2017;9:29–33. doi: 10.1016/j.vprsr.2017.04.007. [DOI] [PubMed] [Google Scholar]
- Issouf M, Guegnard F, Koch C, Le Vern Y, Blanchard-Letort A, Che H, Beech RN, Kerboeuf D, Neveu C. Haemonchus contortus P-glycoproteins interact with host eosinophil granules: A novel insight into the role of ABC transporters in host-parasite interaction. PLoS One. 2014;9:e87802. doi: 10.1371/journal.pone.0087802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Janssen IJI, Krücken J, Demeler J, Basiaga M, Kornaś S, Von Samson-Himmelstjerna G. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-11 in populations with decreased ivermectin susceptibility. PLoS One. 2013;8:e61635. doi: 10.1371/journal.pone.0061635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kerboeuf D, Blackhall W, Kaminsky R, Von Samson-Himmelstjerna G. P-glycoprotein in helminths: Function and perspectives for anthelmintic treatment and reversal of resistance. Int J Antimicrob Agents. 2003;22:332–346. doi: 10.1016/s0924-8579(03)00221-8. [DOI] [PubMed] [Google Scholar]
- Khan W, Al-Jabr OA, Khan T, Khan A, El-Ghareeb WR, Aguilar-Marcelino L, Hussein EOS, Alhimaidi AR, Swelum AA. Prevalence of gastrointestinal parasite in small ruminants of District Dir Upper Khyber Pakhtunkhwa Province of Pakistan. Braz J Biol. 2021;83:e248978. doi: 10.1590/1519-6984.248978. [DOI] [PubMed] [Google Scholar]
- Kohler P. The biochemical basis of anthelmintic action and resistance. Int J Parasitol. 2001;31:336–345. doi: 10.1016/s0020-7519(01)00131-x. [DOI] [PubMed] [Google Scholar]
- Kotze AC, Prichard RK. In: Haemonchus contortus and Haemonchosis: Past, present and future trends. Gasser R, Von Samson-Himmelstjerna G, editors. Science Direct; 2016. Anthelmintic resistance in Haemonchus contortus: History, mechanisms and diagnosis; pp. 397–428. [DOI] [PubMed] [Google Scholar]
- Lacey E. The role of the cytoskeletal protein, tubulin, in the mode of action and mechanism of drug resistance to benzimidazoles. Int J Parasitol. 1988;18:885–936. doi: 10.1016/0020-7519(88)90175-0. [DOI] [PubMed] [Google Scholar]
- Laing R, Kikuchi T, Martinelli A, Tsai IJ, Beech RN, Redman E, Holroyd N, Bartley DJ, Beasley H, Britton C, et al. The genome and transcriptome of Haemonchus contortus, a key model parasite for drug and vaccine discovery. Genome Biol. 2013;14:R88. doi: 10.1186/gb-2013-14-8-r88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lecová L, Růžičková M, Laing R, Vogel H, Szotáková B, Prchal L, Lamka J, Vokral I, Skalová L, Matoušková P. Reliable reference gene selection for quantitative real time PCR in Haemonchus contortus. Mol Biochem Parasitol. 2015;201:123–127. doi: 10.1016/j.molbiopara.2015.08.001. [DOI] [PubMed] [Google Scholar]
- Lespine A, Ménez C, Bourguinat C, Prichard RK. P-glycoproteins and other multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist. 2012;2:58–75. doi: 10.1016/j.ijpddr.2011.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lincke CR, Broeks A, The I, Plasterk RH, Borst P. The expression of two P-glycoprotein (pgp) genes in transgenic Caenorhabditis elegans is confined to intestinal cells. EMBO J. 1993;12:1615–1620. doi: 10.1002/j.1460-2075.1993.tb05806.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lindblom TH, Pierce GJ, Sluder AE. A C. elegans orphan nuclear receptor contributes to xenobiotic resistance. Curr Biol. 2001;11:864–868. doi: 10.1016/s0960-9822(01)00236-6. [DOI] [PubMed] [Google Scholar]
- Lloberas M, Alvarez L, Entrocasso C, Virkel G, Ballent M, Mate L, Lifschitz A. Comparative tissue pharmacokinetics and efficacy of moxidectin, abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist. 2013;3:20–27. doi: 10.1016/j.ijpddr.2012.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Locher KP. Mechanistic diversity in ATP-binding cassette (ABC) transportes. Nat Struct Mol Biol. 2016;23:487. doi: 10.1038/nsmb.3216. [DOI] [PubMed] [Google Scholar]
- Maté L, Ballent M, Cantón C, Ceballos L, Lifschitz A, Lanusse C, Alvarez L, Liron JP. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus contortus in vivo exposed to ivermectin. Vet Parasitol. 2018;264:1–7. doi: 10.1016/j.vetpar.2018.10.011. [DOI] [PubMed] [Google Scholar]
- Maté L, Ballent M, Cantón C, Lanusse C, Ceballos L, Alvarez L, Liron JP. ABC-transporter gene expression in ivermectin-susceptible and resistant Haemonchus contortus isolates. Vet Parasitol. 2022;302:109647. doi: 10.1016/j.vetpar.2022.109647. [DOI] [PubMed] [Google Scholar]
- Merino G, Jonker JW, Wagenaar E, Pulido MM, Molina AJ, Alvarez AI, Schinkel AH. Transport of anthelmintic benzimidazole drugs by breast cancer resistance protein (BCRP/ABCG2) Drug Metab Dispos. 2005;33:614–618. doi: 10.1124/dmd.104.003319. [DOI] [PubMed] [Google Scholar]
- Mottier ML, Prichard RK. Genetic analysis of a relationship between macrocyclic lactone and benzimidazole anthelmintic selection on Haemonchus contortus. Pharmacogenet Genomics. 2008;18:129–140. doi: 10.1097/FPC.0b013e3282f4711d. [DOI] [PubMed] [Google Scholar]
- Nare B, Liu Z, Prichard RK, Georges E. Benzimidazoles, potent anti-mitotic drugs: Substrates for the P-glycoprotein transporter in multidrug-resistant cells. Biochem Pharmacol. 1994;48:2215–2222. doi: 10.1016/0006-2952(94)00427-7. [DOI] [PubMed] [Google Scholar]
- Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol Lett. 2004;26:509–515. doi: 10.1023/b:bile.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]
- Prichard RK. Genetic variability following selection of Haemonchus contortus with anthelmintics. Trends Parasitol. 2001;17:445–453. doi: 10.1016/s1471-4922(01)01983-3. [DOI] [PubMed] [Google Scholar]
- Prichard RK, Roulet A. ABC transporters and [beta]-tubulin in macrocyclic lactone resistance: prospects for marker development. Parasitology. 2007;134:1123. doi: 10.1017/S0031182007000091. [DOI] [PubMed] [Google Scholar]
- Raza A, Williams AR, Abeer MM. Importance of ABC transporters in the survival of parasitic nematodes and the prospect for the development of novel control strategies. Pathogens. 2023;12:755. doi: 10.3390/pathogens12060755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Redman E, Sargison N, Whitelaw F, Jackson F, Morrison A, Bartley DJ, Gillerad JS. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing. PLoS Pathog. 2012;8:e1002534. doi: 10.1371/journal.ppat.1002534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robinson MW, McFerran N, Trudgett A, Hoey L, Fairweather I. A possible model of benzimidazole binding to β-tubulin disclosed by invoking an inter-domain movement. J Mol Graph Model. 2004;23:275–284. doi: 10.1016/j.jmgm.2004.08.001. [DOI] [PubMed] [Google Scholar]
- Roos MH, Otsen M, Hoekstra R, Veenstra JG, Lenstra JA. Genetic analysis of inbreeding of two strains of the parasitic nematode Haemonchus contortus. Int J Parasitol. 2004;34:109–115. doi: 10.1016/j.ijpara.2003.10.002. [DOI] [PubMed] [Google Scholar]
- Santos JML, Monteiro JP, Ribeiro WLC, Macedo ITF, Camurça-Vasconcelos ALF, Vieira LS, Bevilaqua CML. Identification and quantification of benzimidazole resistance polymorphisms in Haemonchus contortus isolated in Northeastern Brazil. Vet Parasitol. 2014;199:160–164. doi: 10.1016/j.vetpar.2013.11.006. [DOI] [PubMed] [Google Scholar]
- Santos JML, Vasconcelos JF, Frota GA, Ribeiro WLC, André WPP, Vieira LS, Teixeira M, Bevilaqua CML, Monteiro JP. Haemonchus contortus β-tubulin isotype 1 gene F200Y and F167Y SNPs are both selected by ivermectin and oxfendazole treatments with differing impacts on anthelmintic resistance. Vet Parasitol. 2017;248:90–95. doi: 10.1016/j.vetpar.2017.11.003. [DOI] [PubMed] [Google Scholar]
- Sarai RS, Kopp SR, Coleman GT, Kotze AC. Acetylcholine receptor subunit and P-glycoprotein transcription patterns in levamisole-susceptible and-resistant Haemonchus contortus. Int J Parasitol Drugs Drug Res. 2013;3:51–58. doi: 10.1016/j.ijpddr.2013.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scott EW, Kinabo LD, McKellar QA. Pharmacokinetics of ivermectin after oral or percutaneous administration to adult milking goats. J Vet Pharmacol Ther. 1990;13:432–435. doi: 10.1111/j.1365-2885.1990.tb00800.x. [DOI] [PubMed] [Google Scholar]
- Shakya P, Jayraw AK, Jamra N, Agrawal V, Jatav GP. Incidence of gastrointestinal nematodes in goats in and around Mhow, Madhya Pradesh. J Parasit Dis. 2017;41:963–967. doi: 10.1007/s12639-017-0919-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shapiro S, Wilk MBJB. An analysis of variance test for normality. Biometrika. 1965;52:591–611. [Google Scholar]
- Silvestre A, Cabaret J. Mutation in position 167 of isotype 1 beta-tubulin gene of Trichostrongylid nematodes: Role in benzimidazole resistance? Mol Biochem Parasitol. 2002;120:297–300. doi: 10.1016/s0166-6851(01)00455-8. [DOI] [PubMed] [Google Scholar]
- Taylor SC, Nadeau K, Abbasi M, Lachance C, Nguyen M, Fenrich J. The ultimate qPCR experiment: Producing publication quality, reproducible data the first time. Trends Biotechnol. 2019;37:761–774. doi: 10.1016/j.tibtech.2018.12.002. [DOI] [PubMed] [Google Scholar]
- Torgerson PR, Paul M, Furrer R. Evaluating faecal egg count reduction using a specifically designed package “eggCounts” in R and a user friendly web interface. Int J Parasitol. 2014;44:299–303. doi: 10.1016/j.ijpara.2014.01.005. [DOI] [PubMed] [Google Scholar]
- Toscano JHB, Lopes LG, Giraldelo LA, da Silva MH, Okino CH, Chagas ACS. Identification of appropriate reference genes for local immune-related studies in Morada Nova sheep infected with Haemonchus contortus. Mol Biol Rep. 2018;45:1253–1262. doi: 10.1007/s11033-018-4281-x. [DOI] [PubMed] [Google Scholar]
- Ueno H, Gonçalves PC. Manual para diagnóstico das helmintoses de ruminantes. Japan International Cooperation Agency; Tokyo: 1998. [Google Scholar]
- Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007;35:71–74. doi: 10.1093/nar/gkm306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Viviani P, Lifschitz AL, Luque SE, Lloberas MM, Maté ML, Cardozo PA, Lanusse CE, Virkel GL. Pharmacologic interaction between oxfendazole and triclabendazole: In vitro biotransformation and systemic exposure in sheep. Exp Parasitol. 2019;204:107718. doi: 10.1016/j.exppara.2019.107718. [DOI] [PubMed] [Google Scholar]
- Williamson SM, Wolstenholme AJ. P-glycoproteins of Haemonchus contortus: Development of real-time PCR assays for gene expression studies. J Helminthol. 2012;86:202–208. doi: 10.1017/S0022149X11000216. [DOI] [PubMed] [Google Scholar]
- Xiong J, Feng J, Yuan D, Zhou J, Miao W. Tracing the structural evolution of eukaryotic ATP binding cassette transporter superfamily. Sci Rep. 2015;5:16724. doi: 10.1038/srep16724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu M, Molento M, Blackhall W, Ribeiro P, Beech R, Prichard R. Ivermectin resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol Biochem Parasitol. 1998;91:327–335. doi: 10.1016/s0166-6851(97)00215-6. [DOI] [PubMed] [Google Scholar]
- Yan R, Urdaneta-Marquez L, Keller K, James CE, Davey MW, Prichard RK. The role of several ABC transporter genes in ivermectin resistance in Caenorhabditis elegans. Vet Parasitol. 2012;190:519–529. doi: 10.1016/j.vetpar.2012.06.038. [DOI] [PubMed] [Google Scholar]
Internet Resources
- NCBI, National Library of Medicine. [4 February 2022]. NCBI, National Library of Medicine, https://www.ncbi.nlm.nih.gov/nucleotide/
- Primer3Plus, Pick primers from a DNA sequence. [20 March 2022]. Primer3Plus, Pick primers from a DNA sequence, https://primer3plus.com/
- Prism, GraphPad. [15 September 2022]. Prism, GraphPad, https://www.graphpad.com/scientific-software/prism/
- WormBase ParaSite. [12 January 2022]. WormBase ParaSite, https://parasite.wormbase.org/Haemonchus_contortus_prjeb506/Info/Index/
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
