Skip to main content
NCBI home page
Mitochondrial DNA. Part B, Resources logoLink to Mitochondrial DNA. Part B, Resources
. 2024 Aug 16;9(8):1081–1092. doi: 10.1080/23802359.2024.2389920

Structures and genetic information of control region in mitogenomes of Odonata

Bin Jiang a,✉, Yu Yao a, Jia Li b, Jiang Zhang a, Yang Sun a, Shulin He c,✉
PMCID: PMC11332297  PMID: 39161787

Abstract

Mitogenome data of Odonata is accumulating and widely used in phylogenetic analysis. However, noncoding regions, especially control region, were usually omitted from the phylogenetic reconstruction. In an effort to uncover the phylogenetic insights offered by the control region, we have amassed 65 Odonata mitogenomes and conducted an examination of their control regions. Our analysis discovered that species belonging to Anisoptera and Anisozygoptera exhibited a stem-loop structure, which was formed by a conserved polyC-polyG stretch located near the rrns gene (encoding 12S rRNA). Conversely, the polyC-polyG region was not a conserved fragment in Zygoptera. The length and number of repetitions within the control region were identified as the primary determinants of its overall length. Further, sibling species within Odonata, particularly those in the genus Euphaea, displayed similar patterns of repetition in their control region. Collectively, our research delineates the structural variations within the control region of Odonata and suggests the potential utility of this region in elucidating phylogenetic relationships among closely related species.

Keywords: Mitogenomes, Odonata, A + T rich region, phylogenetic implication, repetitive sequence

1. Introduction

Odonata is comprised three suborders, Anisoptera (dragonflies), Zygoptera (damselflies), and Anisozygoptera (including just two species of Epiophlebiidae). Odonates are exemplary of non-model organisms, extensively employed for probing pivotal issues in ecology and evolution (Bybee et al. 2016, 2021; Cordobaaguilar 2008; Jiang and Mikolajewski 2018; Stoks et al. 2003). Notably, odonates are among the most ancient of insect groups, occupying a pivotal role in the evolutionary narrative of winged insects (Lin et al. 2010). Furthermore, the diversity within the Odonata group, encompassing a multitude of species that inhabit a wide array of environmental niches, renders them invaluable as bioindicators for environmental health and the impacts of climate change (Benchalel et al. 2017; Golfieri et al. 2016; Hassall 2015; Herzog and Hadrys 2017).

To date, complete mitochondrial genomes of various animal groups have been extensively sequenced (Cameron 2014; Kenechukwu et al. 2018; Wang, Zhang, et al. 2019). Complete mitochondrial genomes provide a common and easy way for phylogeny reconstruction and population genetic analyses (Boore and Fuerstenberg 2008; Jiang et al. 2023; Saccone et al. 1999). In odonates, protein-coding genes of mitogenomes were commonly chosen for determining phylogeny reconstructions (Feindt, Osigus, et al. 2016; Yong et al. 2016). During phylogenetic analysis, the intergenic sequences were discarded in most cases, however, because of great variation, this region has gradually drawn attentions in solving phylogeny among closely related species (Barbosa et al. 2020; Bondarenko et al. 2019; Bronstein et al. 2018; Vila and Björklund 2004). Among the intergenic regions, the control region is the longest non-coding region in mitochondrial genome. In early studies, with limited number of insect species (15 species from Lepidopteran, Orthopteran, Dipteran, Hymenopteran, and Coleopteran), control regions were classified into two groups based on their structures (Zhang and Hewitt 1997). Group 1 structure contains a conserved G + A-rich sequence close to the rrns (encoding 12S rRNA) and another conserved domain, including a poly-A stretch, [TA(A)]n-like stretch and a stem-loop structure, close to trnI (tRNAile). Group 2 contains no distinct conserved sequence block. With the accumulation of mitochondrial genomes, structural elements shared among certain group of species were characterized (Amaral et al. 2016; Li and Liang 2018). A prominent character of control region is the common occurrence of poly-T stretch and tandem repetition (Amaral et al. 2016), which could vary the length of control region via various copy number and different length of repeats. For example, among 12 Caliscelidae planthoppers, 1–4 repeat regions are present and the largest repeat unit is 186 bp (Gong et al. 2021). Variation in the number of repeat units could happen among species (Omote et al. 2013) and populations (Dueñas et al. 2006; Wang, Liu, et al. 2015).

In Odonata, control regions were studied sporadically. Control regions from Ephemera orientalis and Davidius lunatus exhibit different tandem repeat sequences, within which stem-loop structures may potentially form (Lee et al. 2009). Comparisons of mitogenomes from seven Zygoptera species indicates that control regions contain two conserved elements, poly-A stretches and microsatellite-like elements (TTA)3 (Juen et al. 2023). However, structural and characteristic diversity within control regions is notable and the presence of shared features across the extensive range of Odonata species is yet to be thoroughly investigated and substantiated.

Variations in the control region have been applied in evolutionary analyses, especially in intraspecific genetic variation and fast-evolving genera (Vila and Björklund 2004). The control region is widely used in studying population genetic structures (Lai et al. 2006; Robalo et al. 2021; Wang et al. 2014). Researches indicate that the combination of control region and COX1 gene is effective in elucidating the phylogeny of fast-evolving lepidopteran genera (Vila and Björklund 2004). In the damselfly genus Euphaea, the control region exhibits a relatively high substitution rate, offering a wealth of informative sites that enhance the resolution of phylogenetic analyses (Cheng et al. 2018). Utilizing the control region as a genetic marker, Parnassius glacialis has been found to possess 239 distinct haplotypes across 13 geographical populations, indicating that this region can serve as a valuable source of evidence for assessing population genetic differentiation and conducting phylogeographical studies (Wang, Pan, et al. 2019).

Conserved structural elements of control region may reflect the shared evolutionary history among species (Schultheis et al. 2002). Our study is focused on exploring the structural attributes of the control region both within and across genera of Odonata order. Thus, we have examined the structure patterns of control regions from the downloaded Odonata mitogenomes. Further, tandem repeat patterns of control regions in Zygoptera and Anisoptera were compared and analyzed.

2. Material and methods

Mitogenomes of Odonata (65 mitogenomes in total) were downloaded from GenBank (Table 1). Mitogenomes of Cordulia aenea, Tanypteryx hageni, and Orthetrum melania were excluded from further analyses because they are partial genomes without control regions. Control regions were initially identified based on mitogenome annotations, and the range of control regions was further confirmed based on the neighboring genes (rrns and trnI). More specifically, control regions in this study were extracted fragments from the end of rrns to the beginning of trnI in each mitogenomes.

Table 1.

Collected species, GenBank accession number, and their AT content.

Family Species GenBank Acc. No. AT (%) References
Epiophlebiidae Epiophlebia superstes JX050223 87.78 Wang, Chen, et al. (2015)
Aeshnidae Anax imperator KX161841 93.53 Feindt, Osigus, et al. (2016)
Asiagomphus coreanus MN812523 81.32 Park et al. (2022)
Asiagomphus septimus OM928415 83.94 Liao et al. (2023)
Anax parthenope MT408029 91.78 Ma et al. (2020)
Gomphidae Davidius lunatus EU591677 85.18 Lee et al. (2009)
Davidius fruhstorferi OM928418 88.24 Liao et al. (2023)
Gomphus vulgatissimus MT584114 83.05 Unpublished
Trigomphus carus MH751436 83.74 Guan et al. (2019)
Ictinogomphus sp. KM244673 80.68 Tang et al. (2014)
Chlorogomphidae Chlorogomphus shanicus OP572413 88.70 Wang et al. (2023)
Cordulegastridae Cordulegaster boltonii MT874487 85.55 Unpublished
Macromiidae Macromia daimoji MF990748 86.38 Kim et al. (2018)
Macromia manchurica MZ504972 89.19 An et al. (2023)
Macromia amphigena MZ504971 88.59 An et al. (2022)
Corduliidae Somatochlora hineana MG594801 85.90 Jackson et al. (2018)
Epophthalmia elegans MK522522 91.91 Wang, Wang, et al. (2019)
Libellulidae Brachythemis contaminata KM658172 83.28 Yu et al. (2016)
Hydrobasileus croceus KM244659 85.93 Tang et al. (2014)
Nannophya pygmaea KY402222 84.58 Jeong et al. (2018)
Orthetrum chrysis KU361233 82.93 Yong et al. (2016)
Orthetrum glaucum KU361232 83.57 Yong et al. (2016)
Orthetrum sabina KU361234 83.16 Yong et al. (2016)
Orthetrum testaceum KU361235 89.25 Yong et al. (2016)
Orthetrum melania MH751437 84.30 Guan et al. (2019)
Leucorrhinia albifrons OM993514 83.18 Ožana et al. (2022)
Pantala flavescens MW256717 80.70 David et al. (2021)
Trithemis aurora MW789008 84.79 Unpublished
Sympetrum striolatum MT075809 82.09 Feng et al. (2020)
Nihonogomphus lieftincki OM928417 89.00 Liao et al. (2023)
Nihonogomphus semanticus OM928416 87.84 Liao et al. (2023)
Libellula quadrimaculata MT584123 85.05 Unpublished
Neurothemis fulvia MT371046 84.72 Peng et al. (2021)
Pseudothemis zonata MT371043 88.67 Peng et al. (2021)
Tramea virginia MH751440 87.71 Guan et al. (2019)
Acisoma panorpoides MH751435 91.78 Guan et al. (2019)
Deielia phaon MH751441 89.06 Guan et al. (2019)
Libellula angelina MG189907 82.99 Kim et al. (2019)
Pseudolestidae Pseudolestes mirabilis FJ606784 74.20 Unpublished
Euphaeidae Euphaea decorata KF718294 83.03 Cheng et al. (2018)
Euphaea formosa HM126547 81.28 Lin et al. (2010)
Euphaea ornata KF718295 83.16 Cheng et al. (2018)
Euphaea yayeyamana KF718293 80.06 Cheng et al. (2018)
Euphaea ochracea ON165247 80.03 Miga et al. (2023)
Megapodagrionidae Mesopodagrion tibetanum MK951671 79.27 Song et al. (2019)
Calopterygidae Atrocalopteryx atrata KP233805 87.14 Unpublished
Atrocalopteryx melli MG011692 77.86 Xu et al. (2018)
Psolodesmus mandarinus MF150044 74.20 Wang, Lin, et al. (2019)
Vestalis melania JX050224 74.31 Chen et al. (2015)
Mnais tenuis MK951660 78.03 Song et al. (2019)
Mnais costalis AP017642 79.11 Okuyama and Takahashi (2017)
Neurobasis chinensis ON165246 80.59 Unpublished
Matrona basilaris MK722304 77.45 Lan et al. (2019)
Platycnemididae Platycnemis foliacea KP233804 81.76 Guan et al. (2019)
Platycnemis phyllopoda MK951661 80.74 Song et al. (2019)
Coeliccia cyanomelas MK951666 65.71 Song et al. 92019)
Coenagrionidae Ischnura elegans KU958378 83.78 Feindt, Herzog, et al. (2016)
Ischnura pumilio KC878732 86.30 Lorenzo-Carballa et al. (2014)
Ischnura asiatica OM310774 85.44 Jeong et al. (2023)
Ischnura senegalensis MT787567 81.78 Jiang et al. (2021)
Agriocnemis femina MT787566 88.40 Jiang et al. (2021)
Paracercion v-nigrum MK951669 88.12 Song et al. (2019)
Ceriagrion fallax MW092110 85.38 Shao et al. (2021)
Enallagma cyathigerum MF716899 84.99 Zhang et al. (2017)
Pseudostigmatidae Megaloprepus caerulatus KU958377 87.65 Feindt, Osigus, et al. (2016)
Open in a new tab

In order to investigate conserved sequence blocks of control region in Odonata mitogenome, we aligned the control region in clustal X v2.1 with default setting (Gap opening penalty is 15 and gap extension penalty is 6.66) (Ramu et al. 2003). We explored the tandem repeats in control region by using Tandem Repeat Finder web service (Benson 1999). The distribution of AT and GC content were calculated using the online GC content calculator from VectorBuilder Tools, applying the segment window size of 70 base pairs (Lahn et al. 2023).

3. Results

3.1. polyC-polyG blocks in control region

In Anisoptera and Anisozygoptera species, we found a polyC-polyG block in the control region, which mostly start around 90 bp position near rrns in the control region (28 out of 38 species in Anisoptera, Figure 1). However, we did not find similar polyC-polyG region in Pantala flavescens.

Figure 1.

Figure 1.

Open in a new tab

The polyC-polyG block in the control regions of Anisoptera and Anisozygoptera. the regions with brown background represent the specific polyC-polyG block. The regions with red background indicate the segments from the rrnS coding sequences near control region. Number in front of each sequence indicates the starting position for the polyC-polyG blocks. Phylogenetic relationships were modified from Bybee et al. (2021).

Analogous to the polyC-polyG blocks observed in Anisoptera, we identified a remarkable conservation of a specific fragment (characterized by the sequence GGGGTCA, as depicted in Figure 2) within the polyC-polyG blocks of 13 out of the 28 species belonging to the Zygoptera. This includes notable species such as Pseudolestes mirabilis, Euphaea decorate, E. Formosa, E. ornata, E. yayeyamana, Mesopodagrion tibetanum, Coeliccia cyanomelas, Platycnemis foliacea, Ischnura asiatica, Ischnura elegans, Ischnura senegalensis, Enallagma cyathigerum, and Agriocnemis femina. Although polyC-polyG blocks were not ubiquitous, GC-rich blocks were discovered in the remaining Zygopteran species, as revealed by the GC content distribution across the entire control region (Supplementary materials 1, Figures A1–A65). For example, a (GT)n region was discovered in Atrocalopteryx atrata (Figure 2).

Figure 2.

Figure 2.

Open in a new tab

Highest GC-content blocks in the control region of Zygoptera. Sequences with yellow background indicate the ‘GGGGTCA’ fragments which also occur in polyC-polyG blocks in Anisoptera. G and C were highlighted with different colors (red and blues, respectively) and underlines. Phylogenetic relationships were modified from Bybee et al. (2021).

3.2. Patterns of tandem repeats

Nine species (Trigomphus carus, Ictinogomphus sp., Brachythemis contaminate, Hydrobasileus croceus, Orthetrum chrysis, P. flavescens, P. mirabilis, C. cyanomelas, and Platycnemis phyllopoda,) contain no repeats in their control regions. For the control regions containing tandem repeats, patterns of tandem repeats were examined.

In Coenagrionidea, I. elegans, I. asiatica, I. senegalensis, and E. cyathigerum contain two long (∼190 and ∼180 bp) repetitive elements in their control region (Figure 3, highlighted in greenish brown and purple). A short consensus sequence (ATATAAATATTTAA) in the repetitive elements was identified in P. foliacea, Ischnura species, and E. cyathigerum (Supplementary materials 2, Figure B1). In contrast, for the remaining species in Coenagrionidae (A. femina, Paracercion v-nigrum, and Ceriagrion fallax), only fragments of the consensus sequence were detected (highlighted in orange in Supplementary materials 2, Figure B1). In Calopterygidae, Matrona basilaris, Atracalopteryx melli, and Neurobasis chinensis share a 23 bp consensus sequence (ATTAAACATTTATATATATATAA, Supplementary materials 2, Figure B2); however, A. atrata features only TA or TG repeats in its control region. In Euphaeidae, E. decorata, and E. ornata display identical repeating pattern characterized by 216 bp repetitive elements (highlight in blue in Figure 4), while the other two Euphaea species only possess truncated 156–157 bp repetitive elements (highlight in blue in Figure 4). Furthermore, E. formosa and E. yayeyamana were found to share an additional 159 bp repetitive element (highlighted in purple in Figure 4).

Figure 3.

Figure 3.

Open in a new tab

Tandem repeats in the control region of Coenagrionidae. Repetition elements were showed with colored boxes. Length * copy numbers of each repetitive element were showed.

Figure 4.

Figure 4.

Open in a new tab

Tandem repeats in the control region of Calopterygidae. Repetition elements were showed with colored boxes. Length * copy numbers of each repetitive element were showed.

In Macromiidae, M. manchurica and M. amphigena were notable for their long repetitive elements (184 and 135 bp, respectively). These elements all encompass a 39 bp consensus sequence (Figure 5). Across all three Macromia species, a common sequence (ATAAATAATTTATTATAT) was discernible within the 21 bp repetitive element of M. daimoji, 52 and 64 bp repetitive elements of M. manchurica, and the 19 and 68 bp repetitive elements of M. amphigena (highlighted in red in Supplementary materials 2, Figure B3). In Libellulidae, 11 species were found to share a short sequence (ATATAAATA, highlighted with underline in Supplementary materials 2, Figure B4) in their repetition elements except two species (Trithemis aurora and Leucorrhinia albifrons) exhibiting with only fragments of the above sequence. In genus Orthetrum, O. sabina, and O. testaceum share the same 18 bp repetitive element (Figure 6). Among four Orthetrum species, a shared sequence (ATATAAATA or its complementary sequence TATATTTAT) was found in their repetitive elements (highlighted with underline or double-underline in Supplementary materials 2, Figure B4). In Gomphidae, the long repetitive elements of Davidius lunatus (261 bp*2.8 copies) and Davidius fruhstorferi (260 bp*2.2 copies) share high sequence similarity (Supplementary materials 2, Figure B5).

Figure 5.

Figure 5.

Open in a new tab

Tandem repeats in the control region of Macromiidae. Repetition elements were showed with colored boxes. Length * copy numbers of each repetitive element were showed.

Figure 6.

Figure 6.

Open in a new tab

Tandem repeats in the control region of Libellulidae. Repetition elements were showed with colored boxes. Length * copy numbers of each repetitive element were showed.

4. Discussion

4.1. Universal features in control region

The control region exhibits significant diversity among Odonata species. The total length of control region varies not only within but also across different genera. Therefore, no general pattern of control regions was found in Odonata, which is also true in Lepidoptera (Vila and Björklund 2004) and Hemiptera (Li and Liang 2018). In Ischnura, length of control region differs between Ischnura pumilio (489 bp) and the other two Ischnura species (I. elegans: 1196 bp and I. senegalensis: 1032 bp). Length differences within genus are also found in Euphaea, Macromia, and Orthetrum. Length differences in control regions are mainly due to the various patterns of tandem repeats.

Within the control region, a polyC-polyG block was found in most of the species in our study. This block is much conserved in Anisoptera, which could form stem-loop structures (Figure 7). In mosquito and Heteroptera, a GC-rich block was also found (Duenas et al. 2006; Li and Liang 2018). A GC-rich segment was also identified as one of conserved areas in five Callitettixini species (Liu et al. 2014). Whether this kind of GC-rich blocks is widely distributed among species is still need to be investigated. GC-rich sequence element in yeast was thought to contain an origin of replication (Chen and Clark-Walker 2018). However, the role of this GC-rich block in Odonata is still unknown. However, the polyC-polyG block was not well conserved in Zygoptera. This distinctive feature between Anisoptera and Zygoptera likely reflects their divergent evolutionary histories.

Figure 7.

Figure 7.

Open in a new tab

Predicted stem-loop structures in the polyC-polyG blocks of Anisoptera and Anisozygoptera. Phylogenetic relationships were modified from Bybee et al. (2021).

4.2. Tandem repeats in control region

Tandem repetitive patterns were extensively found in control regions of insect species (Zhang and Hewitt 1997). This is also true in Odonata. However, no overall repetitive pattern across Odonata species was found. Closely related species did show similar repetitive patterns. For example, in Ischnura, a highly similar repetitive pattern was found in I. asiatica, I. elegans, and I. senegalensis (all contain two long repeats), while I. pumilio did not have any of these long repetitive units. Actually, I. elegans and I. senegalensis are very closely related species on phylogeny, which was corroborated by their interspecific hybridization in the lab (Okude et al. 2020). Based on divergence age estimates, I. pumilio diverged earliest among those four Ischnura species (Blow et al. 2021). This suggested that Ischnura species have undergone length expansion in control region after separation of I. pumilio. Surprisingly, E. cyathigerum has the similar repetitive pattern as the above three Ischnura species. E. cyathigerum has overlapped distribution with I. elegans; both species contain several subspecies (Boudot and Kalkman 2015), which indicated that the radiation between these two genera was quite recent.

In Euphaea, five species showed three different repetitive patterns. One long repeat (216 bp in length) was found in E. decorata and E. ornata only; while two long repeats (159 and 156 bp in length) were found in both E. formosa and E. yayeyamana; a 157 bp repeat (similar to both E. formosa and E. yayeyamana) and another 113 bp repeat was found in E. orchracea. E. formosa, and E. yayeyamana, two island-dwelling species in east Asia, are sibling species in subtropical islands (Lee and Lin 2012b). E. decorata and E. ornata are two tropical siblings, which inhabit southeast Asian mainland and Hainan Island, respectively (Lee and Lin 2012a). Therefore, the similar pattern in control region could indicate a very close relationship on phylogeny (Jiang et al. 2021). Contrastingly, our findings revealed minimal resemblance in the tandem repeat patterns among species within the genus Orthetrum. Prior phylogenetic analyses have demonstrated that the Orthetrum species studied herein are distributed across disparate clades within phylogenetic trees (Yong et al. 2014), potentially suggesting a divergence in their evolutionary histories.

In conclusion, our findings contribute to the growing understanding of the complexity and diversity of control regions in insects, particularly in Odonata. The unique patterns and conservation levels of tandem repeats and GC-rich blocks within and across species offer valuable insights into their potential functional roles in evolutionary analysis. Future studies exploring the functional significance of these sequences and their application in phylogenetic reconstructions will further elucidate the intricate relationships within the diverse world of insects. However, the accuracy of mitogenome sequences is influenced by various methodological factors. Discrepancies are often observed in the noncoding control region due to the use of different sequencing, assembly, and annotation techniques (Velozo Timbó et al. 2017). Consequently, it is essential to prioritize the verification of mitogenome sequences in future research.

Supplementary Material

Supplimentary materials 1.pdf
TMDN_A_2389920_SM0517.pdf (4.1MB, pdf)
Supplimentary materials 2.pdf
TMDN_A_2389920_SM0516.pdf (6.6MB, pdf)

Funding Statement

This work is supported by the University Synergy Innovation Program of Anhui Province [GXXT-2022-067], Special Funds for Supporting Innovation and Entrepreneurship for Returned Oversea-students in Anhui Province [2020LCX035], Anhui Provincial Natural Science Foundation [Youth project, 2008085QC148], the Outstanding Innovative Research Team for Molecular Enzymology and Detection in Anhui Provincial Universities [2022AH010012], Anhui Provincial Key Laboratory for Conservation and Utilization of Important Biological Resources.

Author contributions

The original concept was developed by BJ and SH. The mitochondrial genome data was collected and analyzed by JL, YY, and JZ. Original figures preparation was done by YY, YS, and JZ. The data interpretation and manuscript drafting were done by BJ, SH, and YS. All authors contributed to manuscript edits and finalization.

Disclosure statement

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this article.

Data availability statement

All data used in this study are available in NCBI. The accession numbers were shown in Table 1.

References

  1. An CH, Cheon KS, Jang JE, Choi JK, Lee HG.. 2022. Complete mitochondrial genome of large dragonfly (Macromia amphigena). Mitochondrial DNA B Resour. 7(2):377–378. doi: 10.1080/23802359.2022.2039082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. An CH, Cheon KS, Jang JE, Lee HG.. 2023. Complete mitochondrial genome of Macromia manchurica Asahina, 1964 (Odonata: macromiidae). Mitochondrial DNA B Resour. 8(1):10–12. doi: 10.1080/23802359.2022.2157197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Amaral, DT, Mitani, Y, Oliveira, G, Ohmiya, Y, Viviani, VR. 2016. Revisiting Coleoptera a + T-rich region: structural conservation, phylogenetic and phylogeographic approaches in mitochondrial control region of bioluminescent Elateridae species (Coleoptera). Mitochondrial DNA Part A, 28: 671–680. [DOI] [PubMed] [Google Scholar]
  4. Barbosa JTV, Barbosa MS, Morais S, Santana AEG, Almeida C.. 2020. Mitochondrial genomes of genus Atta (Formicidae: myrmicinae) reveal high gene organization and giant intergenic spacers. Genet Mol Biol. 42(4):e20180055. doi: 10.1590/1678-4685-GMB-2018-0055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Benchalel W, Merah S, Bouslama Z, Ramdani M, Elmsellem H, Flower R.. 2017. Odonata as indicators of environmental impacts in rivers, case of wadi El-Kébir-East (northeastern Algeria). Moroccan J Chem. 5(2017):610–621. [Google Scholar]
  6. Benson G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27(2):573–580. doi: 10.1093/nar/27.2.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Blow R, Willink B, Svensson EI.. 2021. A molecularphylogeny offorktail damselflies (genus Ischnura) reveals a dynamic macroevolutionary history of female colour polymorphisms. Mol Phylogenet Evol. 160:107134. doi: 10.1016/j.ympev.2021.107134. [DOI] [PubMed] [Google Scholar]
  8. Bondarenko N, Bondarenko A, Starunov V, Slyusarev G.. 2019. Comparative analysis of the mitochondrial genomes of Orthonectida: insights into the evolution of an invertebrate parasite species. Mol Genet Genomics. 294(3):715–727. doi: 10.1007/s00438-019-01543-1. [DOI] [PubMed] [Google Scholar]
  9. Boore JL, Fuerstenberg SI.. 2008. Beyond linear sequence comparisons: the use of genome-level characters for phylogenetic reconstruction. Philos Trans R Soc Lond B Biol Sci. 363(1496):1445–1451. doi: 10.1098/rstb.2007.2234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Boudot JP, Kalkman VJ.. 2015. Atlas of the European dragonflies and damselflies. Amersfoot, Netherlands: KNNV Publishing. [Google Scholar]
  11. Bronstein O, Kroh A, Haring E.. 2018. Mind the gap! The mitochondrial control region and its power as a phylogenetic marker in echinoids. BMC Evol Biol. 18(1):80. doi: 10.1186/s12862-018-1198-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bybee S, Córdoba-Aguilar A, Duryea MC, Futahashi R, Hansson B, Lorenzo-Carballa MO, Schilder R, Stoks R, Suvorov A, Svensson EI, et al. 2016. Odonata (dragonflies and damselflies) as a bridge between ecology and evolutionary genomics. Front Zool. 13(1):46. doi: 10.1186/s12983-016-0176-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Bybee SM, Kalkman VJ, Erickson RJ, Frandsen PB, Breinholt JW, Suvorov A, Dijkstra KB, Cordero-Rivera A, Skevington JH, Abbott JC, et al. 2021. Phylogeny and classification of Odonata using targeted genomics. Mol Phylogenet Evol. 160:107115. doi: 10.1016/j.ympev.2021.107115. [DOI] [PubMed] [Google Scholar]
  14. Cameron SL. 2014. Insect mitochondrial genomics: implications for evolution and phylogeny. Annu Rev Entomol. 59(1):95–117. doi: 10.1146/annurev-ento-011613-162007. [DOI] [PubMed] [Google Scholar]
  15. Chen MY, Chaw SM, Wang JF, Villanueva RJT, Nuñeza OM, Lin CP.. 2015. Mitochondrial genome of a flashwing demoiselle, Vestalis melania from the Philippine Archipelago. Mitochondrial DNA. 26(5):720–721. doi: 10.3109/19401736.2013.845757. [DOI] [PubMed] [Google Scholar]
  16. Chen XJ, Clark-Walker GD.. 2018. Unveiling the mystery of mitochondrial DNA replication in yeasts. Mitochondrion. 38:17–22. doi: 10.1016/j.mito.2017.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Cheng YC, Chen MY, Wang JF, Liang AP, Lin CP.. 2018. Some mitochondrial genes perform better for damselfly phylogenetics: species- and population-level analyses of four complete mitogenomes of Euphaea sibling species. Syst Entomol. 43(4):702–715. doi: 10.1111/syen.12299. [DOI] [Google Scholar]
  18. Cordobaaguilar A. 2008. Dragonflies and damselflies. Oxford: Oxford University Press. [Google Scholar]
  19. David FJ, Herzog R, Bielke A, Bergjürgen N, Osigus HJ, Hadrys H.. 2021. The first complete mitochondrial genome of the migratory dragonfly Pantala flavescens Fabricius, 1798 (Libellulidae: odonata). Mitochondrial DNA B Resour. 6(3):808–810. doi: 10.1080/23802359.2021.1882914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dueñas JCR, Gardenal CN, Llinás GA, Panzetta-Dutari GM.. 2006. Structural organization of the mitochondrial DNA control region in Aedes aegypti. Genome. 49(8):931–937. doi: 10.1139/g06-053. [DOI] [PubMed] [Google Scholar]
  21. Feindt W, Herzog R, Osigus HJ, Schierwater B, Hadrys H.. 2016. Short read sequencing assembly revealed the complete mitochondrial genome of Ischnura elegans Vander Linden, 1820 (Odonata: zygoptera). Mitochondrial DNA B Resour. 1(1):574–576. doi: 10.1080/23802359.2016.1192510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Feindt W, Osigus HJ, Herzog R, Mason CE, Hadrys H.. 2016. The complete mitochondrial genome of the neotropical helicopter damselfly Megaloprepus caerulatus (Odonata: zygoptera) assembled from next generation sequencing data. Mitochondrial DNA B Resour. 1(1):497–499. doi: 10.1080/23802359.2016.1192504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Feng RQ, Luo FZ, Zhang LJ, Li M, Cao Y, Yuan ML.. 2020. The complete mitochondrial genome of Sympetrum striolatum (Odonata: libellulidae) and phylogenetic analysis. Mitochondrial DNA Part B. 5(2):1677–1678. doi: 10.1080/23802359.2020.1745103. [DOI] [Google Scholar]
  24. Golfieri B, Hardersen S, Maiolini B, Surian N.. 2016. Odonates as indicators of the ecological integrity of the river corridor: development and application of the Odonate River Index (ORI) in northern Italy. Ecol Indic. 61:234–247. doi: 10.1016/j.ecolind.2015.09.022. [DOI] [Google Scholar]
  25. Gong N, Yang L, Chen X.. 2021. Comparative analysis of twelve mitogenomes of Caliscelidae (Hemiptera: fulgoromorpha) and their phylogenetic implications. PeerJ. 9:e12465. doi: 10.7717/peerj.12465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Guan DL, Qian ZQ, Ma LB, Bai Y, Xu SQ.. 2019. Different mitogenomic codon usage patterns between damselflies and dragonflies and nine complete mitogenomes for odonates. Sci Rep. 9(1):678. doi: 10.1038/s41598-018-35760-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hassall C. 2015. Odonata as candidate macroecological barometers for global climate change. Freshwater Sci. 34(3):1040–1049. doi: 10.1086/682210. [DOI] [Google Scholar]
  28. Herzog R, Hadrys H.. 2017. Long-term genetic monitoring of a riverine dragonfly, Orthetrum coerulescens (Odonata: libellulidae): direct anthropogenic impact versus climate change effects. PLoS One. 12(5):e0178014. doi: 10.1371/journal.pone.0178014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jackson C, McCalla SG, Amberg J, Soluk D, Britten H.. 2018. The complete mitochondrial genome of Hine’s emerald dragonfly (Somatochlora hineana Williamson) via NGS sequencing. Mitochondrial DNA B Resour. 3(2):562–563. doi: 10.1080/23802359.2018.1463824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jeong KY, Choi JY, Jo H, Jeong KS.. 2023. Complete mitochondrial genome of Ischnura asiatica (Brauer, 1865) assembled from next-generation sequencing data. Mitochondrial DNA B Resour. 8(3):333–335. doi: 10.1080/23802359.2023.2181651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jeong SY, Kim MJ, Wang AR, Kim SS, An J, Kim I.. 2018. Complete mitochondrial genome sequence of the tiny dragonfly, Nannophya pygmaea (Odonata: libellulidae). Conservat Genet Resour. 10(3):355–358. doi: 10.1007/s12686-017-0823-0. [DOI] [Google Scholar]
  32. Jiang B, Li J, Zhang Y, Sun Y, He S, Yu G, Lv G, Mikolajewski DJ.. 2021. Complete mitochondrial genomes of two damselfly species in coenagrionidae and phylogenetic implications. Mitochondrial DNA B Resour. 6(8):2445–2448. doi: 10.1080/23802359.2021.1955635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jiang B, Mikolajewski DJ.. 2018. Shift in predation regime mediates diversification of foraging behaviour in a dragonfly genus. Ecol Entomol. 43(4):525–533. doi: 10.1111/een.12530. [DOI] [Google Scholar]
  34. Jiang B, Zhang J, Bai X, Zhang Y, Yao Y, Li J, Yu G, He S, Sun Y, Mikolajewski DJ.. 2023. Genetic variation and population structure of a widely distributed damselfly (Ischnura senegalensis). Arch Insect Biochem Physiol. 114(2):1–14. doi: 10.1002/arch.22015. [DOI] [PubMed] [Google Scholar]
  35. Juen L, Koroiva R, Geraldo de Carvalho F, Mendoza-Penagos CC, Brito J, Calvão LB, Ferreira VRS, Ribeiro-dos-Santos Â, Silva CS, Guerreiro S, et al. 2023. The first mitochondrial genome of an Odonata endemic to South America, Chalcopteryx rutilans (Rambur, 1842) (Odonata: polythoridae), and its implications for the phylogeny of the Zygoptera. Diversity. 15(8):908. doi: 10.3390/d15080908. [DOI] [Google Scholar]
  36. Kenechukwu NA, Li M, An L, Cui MM, Wang CL, Wang AL, Chen YL, Du SJ, Feng CY, Zhong SJ, et al. 2018. Comparative analysis of the complete mitochondrial genomes for development application. Front Genet. 9:651. doi: 10.3389/fgene.2018.00651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kim I, Jeong SY, Kim MJ.. 2019. Complete mitochondrial genome sequence of Bekko Tombo Libellula angelina Selys, 1883 (Odonata: libellulidae). Mitochondrial DNA B Resour. 4(2):2201–2203. doi: 10.1080/23802359.2019.1624216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kim MJ, Jeong SY, Wang AR, An J, Kim I.. 2018. Complete mitochondrial genome sequence of Macromia daimoji Okumura, 1949 (Odonata: macromiidae). Mitochondrial DNA B Resour. 3(1):365–367. doi: 10.1080/23802359.2018.1450683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lahn B, Mussar K, Ye J, Yu G, Reid T, Wright R, McClure C.. 2023. Vector builder: GC content calculator. https://en.vectorbuilder.com/tool/gc-content-calculator.html
  40. Lai SJ, Liu YP, Liu YX, Li XW, Yao YG.. 2006. Genetic diversity and origin of Chinese cattle revealed by mtDNA D-loop sequence variation. Mol Phylogenet Evol. 38(1):146–154. doi: 10.1016/j.ympev.2005.06.013. [DOI] [PubMed] [Google Scholar]
  41. Lan DY, Shen SQ, Cai YY, Wang J, Zhang JY, Storey KB, Yu DN.. 2019. The characteristics and phylogenetic relationship of two complete mitochondrial genomes of Matrona basilaris (Odonata: zygoptera: calopterygidae). Mitochondrial DNA Part B. 4(1):1745–1747. doi: 10.1080/23802359.2019.1610104. [DOI] [Google Scholar]
  42. Lee EM, Hong MY, Kim MI, Kim MJ, Park HC, Kim KY, Lee IH, Bae CH, Jin BR, Kim I.. 2009. The complete mitogenome sequences of the palaeopteran insects Ephemera orientalis (Ephemeroptera: ephemeridae) and Davidius lunatus (Odonata: gomphidae). Genome. 52(9):810–817. doi: 10.1139/g09-055. [DOI] [PubMed] [Google Scholar]
  43. Lee YH, Lin CP.. 2012a. Pleistocene speciation with and without gene flow in Euphaea damselflies of subtropical and tropical East Asian islands. Mol Ecol. 21(15):3739–3756. doi: 10.1111/j.1365-294X.2012.05654.x. [DOI] [PubMed] [Google Scholar]
  44. Lee YH, Lin CP.. 2012b. Morphometric and genetic differentiation of two sibling gossamer-wing damselflies, Euphaea formosa and E. yayeyamana, and adaptive trait divergence in subtropical East Asian islands. J Insect Sci. 12(53):53–17. doi: 10.1673/031.012.5301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Li K, Liang AP.. 2018. Hemiptera mitochondrial control region: new sights into the structural organization, phylogenetic utility, and roles of tandem repetitions of the noncoding segment. Int J Mol Sci. 19(5):1292. doi: 10.3390/ijms19051292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Liao J, Lin BQ, Wang HJ, Wu ZQ.. 2023. Genetic structural variation in mitochondrial genomes of four species of Gomphidae and their phylogenetic implications. Gene Rep. 33:101808. doi: 10.1016/j.genrep.2023.101808. [DOI] [Google Scholar]
  47. Lin CP, Chen MY, Huang JP.. 2010. The complete mitochondrial genome and phylogenomics of a damselfly, Euphaea formosa support a basal Odonata within the Pterygota. Gene. 468(1–2):20–29. doi: 10.1016/j.gene.2010.08.001. [DOI] [PubMed] [Google Scholar]
  48. Liu J, Bu C, Wipfler B, Liang A.. 2014. Comparative analysis of the mitochondrial genomes of Callitettixini Spittlebugs (Hemiptera: cercopidae) confirms the overall high evolutionary speed of the AT-rich region but reveals the presence of short conservative elements at the tribal level. PLoS One. 9(10):e109140. doi: 10.1371/journal.pone.0109140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Lorenzo-Carballa MO, Thompson DJ, Cordero-Rivera A, Watts PC.. 2014. Next generation sequencing yields the complete mitochondrial genome of the scarce blue-tailed damselfly, Ischnura pumilio. Mitochondrial DNA. 25(4):247–248. doi: 10.3109/19401736.2013.796518. [DOI] [PubMed] [Google Scholar]
  50. Ma F, Hu Y, Wu J.. 2020. The complete mitochondrial genome of Anax parthenope (Odonata: anisoptera) assembled from next-generation sequencing data. Mitochondrial DNA B Resour. 5(3):2817–2818. doi: 10.1080/23802359.2020.1789513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Miga M, Jahari PNS, Parimannan S, Rajandas H, Latiff MAB, Jing Wei Y, Shamsir MS, Mohd Salleh F.. 2023. Characterization of the nearly complete mitochondrial genome of ochraceous darkies, Euphaea ochracea Selys, 1859 (Odonata: zygoptera: euphaeidae) and phylogenetic analysis. Mitochondrial DNA B Resour. 8(2):292–296. doi: 10.1080/23802359.2023.2179355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Okude G, Fukatsu T, Futahashi R.. 2020. Interspecific crossing between blue‐tailed damselflies Ischnura elegans and I. senegalensis in the laboratory. Entomol Sci. 23(2):165–172. doi: 10.1111/ens.12408. [DOI] [Google Scholar]
  53. Okuyama H, Takahashi J.. 2017. The complete mitochondrial genome of Mnais costalis Selys (Odonata: calopterygidae) assembled from next generation sequencing data. TOMBO. 59:77–83. [Google Scholar]
  54. Omote K, Nishida C, Dick MH, Masuda R.. 2013. Limited phylogenetic distribution of a long tandem-repeat cluster in the mitochondrial control region in Bubo (Aves, Strigidae) and cluster variation in Blakiston’s fish owl (Bubo blakistoni). Mol Phylogenet Evol. 66(3):889–897. doi: 10.1016/j.ympev.2012.11.015. [DOI] [PubMed] [Google Scholar]
  55. Ožana S, Dolný A, Pánek T.. 2022. Nuclear copies of mitochondrial DNA as a potential problem for phylogenetic and population genetic studies of Odonata. Syst Entomol. 47(4):591–602. doi: 10.1111/syen.12550. [DOI] [Google Scholar]
  56. Park JS, Kim MJ, Kim SS, Kim I.. 2022. Complete mitochondrial genome of Asiagomphus coreanus (Odonata: gomphidae), which is endemic to South Korea. Mitochondrial DNA B Resour. 7(5):791–793. doi: 10.1080/23802359.2022.2072246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Peng X, Gao Y, Song X, Du Y.. 2021. Characterization and phylogenetic analysis of the complete mitochondrial genome of Neurothemis fulvia (Odonata: anisoptera: libellulidae). Mitochondrial DNA B Resour. 6(2):620–621. doi: 10.1080/23802359.2021.1875924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Ramu C, Hideaki S, Tadashi K, Rodrigo L, Gibson TJ, Higgins DG, Thompson JD.. 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31(13):3497–3500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Robalo JI, Farias I, Francisco SM, Avellaneda K, Castilho R, Figueiredo I.. 2021. Genetic population structure of the Blackspot seabream (Pagellus bogaraveo): contribution of mtDNA control region to fisheries management. Mitochondrial DNA A DNA Mapp Seq Anal. 32(4):115–119. doi: 10.1080/24701394.2021.1882445. [DOI] [PubMed] [Google Scholar]
  60. Saccone C, De Giorgi C, Gissi C, Pesole G, Reyes A.. 1999. Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene. 238(1):195–209. doi: 10.1016/s0378-1119(99)00270-x. [DOI] [PubMed] [Google Scholar]
  61. Schultheis AS, Weigt LA, Hendricks AC.. 2002. Arrangement and structural conservation of the mitochondrial control region of two species of Plecoptera: utility of tandem repeat-containing regions in studies of population genetics and evolutionary history. Insect Mol Biol. 11(6):605–610. doi: 10.1046/j.1365-2583.2002.00371.x. [DOI] [PubMed] [Google Scholar]
  62. Shao H, Li Q, Liu Y.. 2021. The complete mitochondrial genome of Ceriagrion fallax (Odonata: zygoptera: coenagrionidae) and phylogenetic analysis. Mitochondrial DNA B Resour. 6(2):491–492. doi: 10.1080/23802359.2020.1870891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Song N, Li X, Yin X, Li X, Yin J, Pan P.. 2019. The mitochondrial genomes of palaeopteran insects and insights into the early insect relationships. Sci Rep. 9(1):17765. doi: 10.1038/s41598-019-54391-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Stoks R, McPeek M, Mitchell J.. 2003. Evolution of prey behavior in response to changes in predation regime: damselflies in fish and dragonfly lakes. Evolution. 57(3):574–585. doi: 10.1554/0014-3820(2003)057[0574:EOPBIR[PMC]2.0.CO;2]. [DOI] [PubMed] [Google Scholar]
  65. Tang M, Tan M, Meng G, Yang S, Su X, Liu S, Song W, Li Y, Wu Q, Zhang A, et al. 2014. Multiplex sequencing of pooled mitochondrial genomes-a crucial step toward biodiversity analysis using mito-metagenomics. Nucleic Acids Res. 42(22):e166–e166. doi: 10.1093/nar/gku917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Velozo Timbó R, Coiti Togawa R, Costa MMC, Andow DA, Paula DP.. 2017. Mitogenome sequence accuracy using different elucidation methods. PLoS One. 12(6):e0179971. doi: 10.1371/journal.pone.0179971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Vila M, Björklund M.. 2004. The utility of the neglected mitochondrial control region for evolutionary studies in Lepidoptera (Insecta). J Mol Evol. 58(3):280–290. doi: 10.1007/s00239-003-2550-2. [DOI] [PubMed] [Google Scholar]
  68. Wang H, Wang L, Liao J, Han BP.. 2023. The complete mitochondrial genome of Chlorogomphus shanicus Wilson, 2002 (Anisoptera: chlorogomphidae), an endemic species in South China. Mitochondrial DNA B Resour. 8(11):1192–1195. doi: 10.1080/23802359.2023.2276970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wang JD, Wang CY, Zhao M, He Z, Feng Y.. 2019. The complete mitochondrial genome of an edible aquatic insect Epophthalmia elegans (Odonata: corduliidae) and phylogenetic analysis. Mitochondrial DNA Part B. 4(1):1381–1382. doi: 10.1080/23802359.2019.1598303. [DOI] [Google Scholar]
  70. Wang JF, Chen MY, Chaw SM, Morii Y, Yoshimura M, Sota T, Lin CP.. 2015. Complete mitochondrial genome of an enigmatic dragonfly, Epiophlebia superstes (Odonata, Epiophlebiidae). Mitochondrial DNA. 26(5):718–719. doi: 10.3109/19401736.2013.845756. [DOI] [PubMed] [Google Scholar]
  71. Wang LJ, Lin MY, Shiao SF, Sung CH.. 2019. The complete mitochondrial genome of Psolodesmus mandarinus McLachlan, 1870 (Odonata: calopterygidae). Mitochondrial DNA Part B. 4(1):337–339. doi: 10.1080/23802359.2018.1544045. [DOI] [Google Scholar]
  72. Wang T, Zhang S, Pei T, Yu Z, Liu J.. 2019. Tick mitochondrial genomes: structural characteristics and phylogenetic implications. Parasit Vectors. 12(1):451. doi: 10.1186/s13071-019-3705-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wang W, Li F, Shi F, Meng Z.. 2014. Sequence structure and phylogenetic analysis of the mitochondrial DNA control region of Bombyx mori. (In Chinese). Science of Sericulture. 40:18–25. [Google Scholar]
  74. Wang X, Liu N, Zhang H, Yang XJ, Huang Y, Lei F.. 2015. Extreme variation in patterns of tandem repeats in mitochondrial control region of yellow-browed tits (Sylviparus modestus, Paridae). Sci Rep. 5(1):13227. doi: 10.1038/srep13227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Wang Y, Pan Z, Chen K, Tao R, Su C, Hao J.. 2019. Genetic differentiation and phylogeography of the alpine butterfly Parnassius glacialis (Papilionidae: parnassinae) in China: evidence from mitogenomic AT-rich region (in Chinese). Acta Entomologica Sinica. 62:475–488. [Google Scholar]
  76. Xu S, Guan Z, Huang Q, Xu L, Vierstraete A, Dumont HJ, Lin Q.. 2018. The mitochondrial genome of Atrocalopteryx melli Ris, 1912 (Zygoptera: calopterygidae) via Ion Torrent PGM NGS sequencing. Mitochondrial DNA B Resour. 3(1):115–117. doi: 10.1080/23802359.2017.1413307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Yong HS, Song SL, Suana IW, Eamsobhana P, Lim PE.. 2016. Complete mitochondrial genome of Orthetrum dragonflies and molecular phylogeny of Odonata. Biochem Syst Ecol. 69:124–131. doi: 10.1016/j.bse.2016.09.002. [DOI] [Google Scholar]
  78. Yong HS, Lim PE, Tan J, Ng YF, Eamsobhana P, Suana IW.. 2014. Molecular phylogeny of Orthetrum dragonflies reveals cryptic species of Orthetrum pruinosum. Sci Rep. 4(1):5553. doi: 10.1038/srep05553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Yu P, Cheng X, Ma Y, Yu D, Zhang J.. 2016. The complete mitochondrial genome of Brachythemis contaminata (Odonata: libellulidae). Mitochondrial DNA A DNA Mapp Seq Anal. 27(3):2272–2273. doi: 10.3109/19401736.2014.984176. [DOI] [PubMed] [Google Scholar]
  80. Zhang DX, Hewitt GM.. 1997. Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Ecol. 25(2):99–120. doi: 10.1016/S0305-1978(96)00042-7. [DOI] [Google Scholar]
  81. Zhang L, Wang XT, Wen CL, Wang MY, Yang XZ, Yuan ML.. 2017. The complete mitochondrial genome of Enallagma cyathigerum (Odonata: coenagrionidae) and phylogenetic analysis. Mitochondrial DNA B Resour. 2(2):640–641. doi: 10.1080/23802359.2017.1375879. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplimentary materials 1.pdf
TMDN_A_2389920_SM0517.pdf (4.1MB, pdf)
Supplimentary materials 2.pdf
TMDN_A_2389920_SM0516.pdf (6.6MB, pdf)

Data Availability Statement

All data used in this study are available in NCBI. The accession numbers were shown in Table 1.

Articles from Mitochondrial DNA. Part B, Resources are provided here courtesy of Taylor & Francis

RESOURCES