Oxidative damage and cell cycle delay induced by vanadium(III) in human peripheral blood cells

Abstract

Vanadium (V) is a metal that can enter the environment through natural routes or anthropogenic activity. In the atmosphere, V is present as V oxides, among which vanadium(III) oxide (V₂O₃) stands out. Cytogenetic studies have shown that V₂O₃ is genotoxic and cytostatic and induces DNA damage; however, the molecular mechanisms leading to these effects have not been fully explored. Therefore, we treated human peripheral blood lymphocytes in vitro, evaluated the effects of V₂O₃ on the phases of the cell cycle and the expression of molecules that control the cell cycle and examined DNA damage and the induction of oxidative stress. The results revealed that V₂O₃ did not affect cell viability at the different concentrations (2, 4, 8 or 16 μg/mL) or exposure times (24 h) used. However, V₂O₃ affected the percentage of G₁- and S-phase cells in the cell cycle, decreased the expression of mRNAs encoding related proteins (cyclin D, cyclin E, CDK2 and CDK4) and increased the expression of γH2AX and the levels of reactive oxygen species. The ability of V₂O₃ to cause a cell cycle delay in G₁-S phase may be associated with a decrease in the mRNA and protein expression of the cyclins/CDKs and with intracellular oxidative stress, which may cause DNA double-strand damage and H2AX phosphorylation.

Graphical Abstract

Highlights

• •Effects of vanadium(III) oxide on the cell cycle; the expression of both mRNAs to generate their respective proteins.
• •The different treatments with V₂O₃ did not affect the viability of lymphocytes.
• •We observed a trend in which the percentage of cells in the G₁ phase decreased.
• •The expression levels of γH2AX, a concentration-related increase was observed.
• •Vanadium(III) oxide in lymphocyte cultures increases oxidative stress.

1. Introduction

Vanadium (V) is a transition metal found in nature in approximately 65 minerals; it ranks fifth among the most abundant metals in the Earth's crust and first in the ocean [1]. V has various oxidation states, and its +3, +4, and +5 oxides are an environmental problem. It is estimated that 130,000 to 260,000 tons of V are released per year, including approximately 65,000 tons from forest fires, volcanic eruptions and mineral erosion; the remainder of V is of anthropogenic origin [2]. The main sources of emissions are the burning of fossil fuels, metallurgical mining, chemical, agricultural, energy and other industrial activities 1, 3, 4. The chemical species released into the environment include vanadium oxides, among which vanadium(V) oxide, a pentoxide, is the most abundant (V₂O₅), followed by oxides in oxidation states IV and III (V₂O₄ and V₂O_3, respectively) 5, 6. In recent years, some companies have attempted to reduce V₂O₅ emissions, as V₂O₅ is corrosive to the metal parts of machinery and causes other oxides to be released (such as V₂O₃) by manufacturing catalysts that prevent the formation of V₂O₅ 7, 8. The effects of occupational and environmental exposure to V are well documented, and environmental exposure can cause respiratory distress, organ damage, and possibly death 9, 10.

Previous studies have investigated the in vitro and in vivo effects of vanadium oxides. In animals, exposure to 1.56 mg/m³ V₂O₅ via inhalation caused neuronal death in Wistar rats, whereas 0.02 M V₂O₅ in CD-1 mice led to hyperplasia of the bronchiolar epithelium, small inflammatory foci, and sloughing of nonciliated bronchiolar cells. Additionally, intraperitoneal administration of 4.7, 9.4, or 18.7 mg/kg V₂O₃ induced chromosomal aberrations and altered cell division in the bone marrow cells of CD-1 mice, as well as in Chinese hamster ovary cells (24.9 μg/mL) 11, 12, 13, 14, 15, 16, 17. However, the degree of toxicity depends on the oxidation state of the metal, with each oxide exerting its own effects. Cytogenetic assays revealed that V₂O₃ is cytotoxic and genotoxic in leukocytes and lymphocytes (1–16 μg/mL). Metal decreases the mitotic index and the cell proliferation index, increases premature centromere separation and produces single-strand breaks in DNA 16, 17, 18, 19, 20. The results of chromosomal damage are inconclusive; in vivo structural chromosomal aberrations are increased 16, 19, but this effect is not observed in human leukocyte and lymphocyte cultures 16, 17, 18, 19, 20.

DNA damage is known to activate several cellular responses through complex protein networks, including cell cycle control and DNA repair proteins [21]. Single- and double-strand breaks in DNA are detected by proteins such as ataxia-telangiectasia mutated Rad3-related (ATR) and ataxia-telangiectasia mutated (ATM); both signaling pathways converge on the phosphorylation of histone H2AX 22, 23, and H2AX expression provides an indicator of DNA damage due to xenobiotic exposure 22, 24, 25. γH2AX recruits Brca1 and 53BP1 (p53) 26, 27, the latter of which is responsible for cell cycle sensing, to repair DNA damage (cell survival) or to activate cell death signals, such as those for apoptosis [28]. V₂O₃ induces genotoxicity; however, DNA damage sensor proteins, such as p53, do not change (2–16 μg/mL) in human lymphocyte cultures [12], so damage may be sensed by other proteins, such as γH2AX. Therefore, in the present study, we focused on the effects of vanadium(III) oxide on the cell cycle; the expression of both mRNAs to generate their proteins, which control the cell cycle; the expression of a DNA damage sensor protein (γH2AX); and the assessment of oxidative stress in human peripheral blood cells in vitro.

Hence, we investigated whether exposure to this compound induces cell cycle arrest due to decreased mRNA and protein levels triggered by DNA damage through oxidative stress. To achieve this goal, we treated isolated cells with V₂O_3, and the DNA content was determined for analysis of the cell cycle and reactive oxygen species (ROS) production via flow cytometry; moreover, the protein levels of cyclins, and γH2AX were evaluated via Western blotting, and the mRNA expression levels of cyclins and were assessed via PCR. In this way, we helped elucidate the genotoxic and cytostatic mechanism of V₂O₃.

2. Materials and methods

2.1. Reagents

The following reagents were used for the development of the protocols: vanadium(III) oxide (V₂O₃, CAS 1314–34–7 with 99.99 % purity), which was macerated and dissolved in distilled water; Histopaque®-1077; 5(6)-carboxyfluorescein diacetate mixed isomers (CFDA); ethidium bromide (BE); phosphate-buffered saline (PBS); and propidium iodide from Sigma—Aldrich, Inc. (MO, USA). PB-MAXTM Karyotyping Medium was from Gibco BRL-Invitrogen Corporation (NY, USA). Acrylamide, N,N-methylene-bis-acrylamide, glycine, sodium dodecylsulfate (SDS), `N,`N,`N,`N,`N-tetra-methyl-ethylenediamine (TEMED), tris hydroxymethyl-aminomethane (Tris), ammonium persulfate, and the Bio-Rad protein assay mixture were obtained from Bio-Rad Laboratories (CA, USA).

The protease inhibitors aprotinin and leupeptin, the primary antibodies anti-cyclin D (sc-246), anti-cyclin E (sc-248), anti-CDK 2 (sc- 6248), anti-CDK 4 (sc-53636), anti-actin (sc-8432), and anti-γH2AX (sc-517348), the horseradish peroxidase-conjugated secondary antibody m-IgGk BP-HRP (sc-516102), the goat anti-mouse IgG-HRP, Tween-20, the Luminol Reagent sc-2048 for western blotting and dihydrorhodamine 123 (sc-203027) were obtained from Santa Cruz Biotechnology, Inc. (CA, USA). Ethylenediaminetetraacetic acid (EDTA) was obtained from BD Diagnostics Mexico. TRIzol Reagent, ReverAid First Strand cDNA (K-1622) and Maxima SYBR Green/ROX qPCR Master Mix (K-0221) were obtained from Thermo Fisher Scientific (MA, USA).

2.2. Lymphocyte cultures and treatments

Peripheral blood samples were collected from three volunteers via the Vacutainer® system. Lymphocytes were isolated with Histopaque®-1077 and incubated at 1×10⁷ in 5 mL of culture medium for 48 h at 37 °C. Twenty-four hours after culture initiation, V₂O₃ treatments were administered at concentrations of 2, 4, 8 or 16 μg/mL, and the mixture was incubated for 24 h; an untreated group (0 μg/mL) was established. The concentrations used were selected according to previous reports. To ensure that the added vanadium dissolved in the medium, we assessed all the cell cultures at the end of each test and ensured that there were no particles or precipitates. The procedures involving human volunteers who provided written informed consent were obtained from each blood donor, adhered to the guidelines of the Helsinki and Tokyo Declarations and were approved by the Committee of Ethics and Biosecurity of the FES-Zaragoza, UNAM (registration number FESZ-CE/21–118–01).

2.3. Cell viability

Cell viability was assessed at the beginning and end of the exposure time to V₂O₃ via dual staining with fluorochromes (0.125 μg/μL CFDA and 0.025 μg/μL BE). Ten microliters of the cell sample was placed in 10 μL of the fluorochrome mixture (1:1) and incubated for 15 min. Subsequently, under a fluorescence microscope (Nikon HFX-DX Optiphot-2 with Filter G-2A), 100 cells per culture were sorted by separating viable cells (emitting green fluorescence) from nonviable cells (nuclei fluorescing red).

2.4. Cell cycle analysis of DNA content

After 24 h of exposure to V₂O₃, the DNA content in the different phases of the cell cycle was analyzed via flow cytometry. The cells were fixed, permeabilized and incubated in staining solution (0.1 % Triton X-100/PBS, 200 μg/mL RNase A and 50 μg/mL propidium iodide). A total of 1×10⁴ cells were acquired on a BD FACSAriaTM II cytometer (Becton Dickinson and Company, CA, USA.) Histograms were constructed via WinMDI 2.9 software developed by Joseph Trotter. The number of nuclei in each phase of the cell cycle (G₁, S and G₂/M) was estimated via the free software Cylchred developed by T. Hoy, Cardiff University.

2.5. Analysis of protein expression levels

At the end of the treatments, proteins were obtained by lysing the cells with RIPA buffer (150 mM NaCl, 5 mM EDTA, 1 % Nonidet P-40, 0.1 % SDS, 1 mM DTT, 1 mM NaVO₄, 1 mM Na₂HPO₄, 5 mM Na₂HPO₄ and 10 mM NaH₂PO₄) and protease inhibitors. The protein concentration was determined via the use of the Bio-Rad protein assay reagent.

The proteins were subsequently separated via 12 % polyacrylamide gel electrophoresis (SDS—PAGE) by applying a constant current of 100 V, transferred to a Bio-Rad PVDF membrane by electroblotting with a constant current of 145 mA, blocked with 5 % TBST fat-free milk powder (0.05 % Tween 20 in Tris-buffered saline) and then incubated overnight at 4 °C with one of the following primary antibodies: anti-cyclin D, anti-cyclin E, anti-CDK4, anti-CDK2, anti-γH2AX or anti-actin (the latter as a loading marker).

The membrane was incubated with the secondary antibody for 90 min, washed and subsequently incubated with luminol Western reagent. Proteins of interest were visualized as bands. The relative intensity of the proteins was assessed via ImageJ 1.45 software (NIH, USA; available at http://rsb.info.nih.gov/ij).

2.6. RNA extraction and cDNA synthesis

Total RNA was isolated from 1×10⁷ cells via the standard TRIzol extraction method and recovered in 40 μL of molecular biology grade water, after which its purity and quantity were determined via a biophotometer (Eppendorf AG 22331). In addition, the integrity of the total RNA was determined via horizontal agarose gel electrophoresis (1 %).

The RNA samples were reverse transcribed into cDNA in a total volume of 20 µl with 5 µl of total RNA, 1 µl of oligo primer (dT) and a RevertAid First Strand cDNA Synthesis Kit containing 5X reagent buffer, an RNase inhibitor, dNTPs and RevertAid M-MuLV RT, following the supplier's instructions. The reaction was carried out at 42 °C for 60 min and finally for 5 min at 70 °C. The reaction tubes containing the reverse transcription (RT) preparations were subsequently cooled in an ice chamber for PCR amplification of the cDNA.

2.7. Polymerase chain reaction (PCR)

The specific primer sequences and product sizes are listed in Table 1. GAPDH was used as a constitutively expressed gene to normalize the expression levels of the target genes. The reaction mixture for RT—PCR (10 mM dNTPs, 50 mM MgCl₂, 10x PCR buffer (50 mM KCl, 20 mM Tris-HCl at pH 8.3) and RNase-free water) was placed in a thermal cycler under the following conditions: 95 °C for 120 s, 95 °C for 15 s, 64 °C for 30 s, and 72 °C for 60 s. The last three steps were repeated for 30 cycles, followed by a step of 72 °C for 5 min. The PCR products were loaded onto an agarose gel (1 %) together with the GAPDH-derived PCR products from the different samples. With the help of the Bio-Rad program of the ChemiDoc™ kit, the relative intensity of gene expression was obtained.

Table 1.

Primer sequence. A reference gene (GAPDH) was used to evaluate the expression of P53, P21, CYCLIN D, CYCLIN E, CDK2 and CDK4.

Gen	Forward	Reverse	pb
GAPDH	5 ´GGAGCGAGATCCCTCCAAAAT 3 ´	5 ´GGCTGTTGTCATACTTCTCATGG 3 ´	197
P53	5 ´CTGGCCCCTGTCATCTTCTG 3 ´	5 ´ CCGTCATGTGCTGTGACTGC 3 ´	242
P21	5 ´ TGAGCGATGGAACTTCGACT 3 ´	5 ´ GACAGTGACAGGTCCACATGG 3 ´	210
CICLINA D	5 ´TACTTCAAGTGCGTGCAGAAGGAC 3 ´	5 ´ TCCCACACTTCCAGTTGCGATCAT 3 ´	498
CICLINA E	5 ´ TCCTGGATGTTGACTGCCTT 3 ´	5 ´ CACCACTGATACCCTGAAACCT 3 ´	109
CDK 2	5 ´ CCTGGATGAAGATGGACGGA 3 ´	5 ´ TGGAAGAAAGGGTGAGCCA 3 ´	99
CDK 4	5 ´ CAGATGGCACTTACACCCGT 3 ´	5 ´ GTTTCCACAGAAGAGAGGCTTTC 3 ´	150

The genes were purchased from Alpha DNA, PROBIOTEK.

2.8. Assessment of ROS

Dihydrorhodamine 123 (DHR) dye was used to assess the level of intracellular ROS in the form of hydrogen peroxide (H₂O₂). The cells were incubated with 10 μM DHR for 30 min in the dark at 37 °C, and the excess dye was removed with PBS. Samples were assessed by flow cytometry (BD FACSAria II from BDBiosciences®) to acquire 2×10⁴ cells at 505 nm excitation and 529 nm emission, and analyses were performed on a Floreada.io. system (2022) (https://floreada.io/).

2.9. Statistical analyses

The data obtained were analyzed via Prism 9.0.1 software for Mac and are presented as the means ± standard deviations (SDs) of three independent experiments performed in duplicate (n = 6). For identification of the significant differences between the treated and untreated groups, ANOVA was applied with Tukey's (equal variances) or Dunnett’s (different variances) post hoc test; p < 0.05 or p < 0.01 was considered a significant value.

3. Results and discussion

3.1. Cell viability

An important mechanism of metal toxicity is delivery to the inside of the cell. Substances that are poorly soluble may be absorbed; vanadium compounds can enter through ionic channels, undergo passive diffusion, and undergo endocytosis. Notably, vanadium ions preferentially use receptor-mediated endocytosis by binding to transferrin. Additionally, entry into the cell is not altered by amino acids, phosphate, or other possible vanadium binders present in the cell culture medium 18, 29, 30, 31, 32.

The viability test with CFDA-BE is an indicator of metabolic activity and death due to cell membrane damage. The different treatments with V₂O₃ did not affect the viability of lymphocytes (Table 2). In untreated cultures, viability was greater than 97 %, whereas in treated cultures, viability was greater than 95 %. Treatment with V₂O₃ did not change the percentage of viable lymphocytes after 24 h of treatment, and the results correspond with previous reports for this compound 12, 20 and for other vanadium oxides 18, 33 in human lymphocytes and leukocytes. However, V and its compounds are known to induce cell toxicity at concentrations ≥ 200 µM and exposure times of 48 h or more 34, 35.

Table 2.

Viability of human lymphocyte cultures before treatment (0 h) and 24 h after exposure to V₂O₃.

V2O3 treatment in μg/mL	Viability (%)
	0 h	24 h
0 (without)	99.5 ± 0.5	97.7 ± 2.6
2	98.7 ± 1.5	95.5 ± 4.7
4	99.1 ± 0.5	95.5 ± 1.9
8	99.0 ± 0.8	96.2 ± 1.7
16	98.5 ± 1.7	97.0 ± 3.4

Data are presented as the mean ± SD, from three independent experiments performed in duplicate (n = 6).

3.2. Cell cycle

For the analysis of DNA content to determine the different phases of the cell cycle, we observed a trend in which the percentage of cells in the G₁ phase decreased while the proportion of cells in the S phase increased, mainly in cultures treated with 8 and 16 μg/mL V₂O₃. (45.57 ± 9.26 G₁ phase of the control group vs. 33.08 ± 2.98 and 34.27 ± 10.23 at concentrations of 8 and 16 μg/mL vanadium, respectively). Although these results are not statistically significant, we concluded that there is a cell cycle delay in the G₁ to S transition (Fig. 1). Vanadium oxides are cytostatic, as they reduce the proportion of cells entering mitosis and decrease the number of times a cell divides 17, 36, 37. Cytogenetic studies of human lymphocyte cultures have shown that V₂O₃ increases the average generation time by 26–32 h [20], indicating disturbances in cell cycle progression. In this study, we detected a decrease in the number of cells in the G₁ phase and an increase in the number of cells in the S phase of the cell cycle. Although our results are not statistically significant, physiological delays in the transition from G₁ to S were observed, which may be related to the decrease in the expression of proteins that control the progression from one phase to the next. Previous reports support our results, in which V salts have been found to induce delays in the G₁/S transition, in S, and in G₂/M in different human cell lines, such as C141, MCF7, EC109, and AsPC-1 30, 38, 39, 40, 41.

Fig. 1.

Estimation of the percentage of cells in G₁, S and G₂/M phase of human lymphocytes treated with 0 (untreated), 2, 4, 6, 8 and 16 µg/mL V₂O₃ for 24 h. Data are presented as the means ± SDs of three independent experiments performed in duplicate (n = 6).

3.3. Protein and mRNA expression levels

Data on protein expression levels revealed that the exposure of lymphocytes to V₂O₃ decreases the relative intensities of cyclins and CDKs. In relation to cyclins, differences were observed at a concentration of 16 μg/mL for cyclin D and at 8 and 16 μg/mL vanadium(III) for cyclin E, whereas for CDK2 (2 and 16 μg/mL) and CDK4 (2, 8 and 16 μg/mL), a decrease was observed at various concentrations (Fig. 2).

Fig. 2.

The relative intensity of cyclin D, cyclin E, CDK4 and CDK2 proteins from human lymphocyte cultures treated with 0 (untreated), 2, 4, 8 and 16 µg/mL V₂O₃ for 24 h. Data are presented as the means ± SDs to three independent experiments with their duplicates (n = 6). * p < 0.05, ** p < 0.01 compared to the untreated group (ANOVA-Tukey).

In contrast, the mRNA expression levels of cyclin D remained unchanged; however, a decrease in PCR products for cyclin E was observed at low concentrations (2 and 4 μg/mL), and a significant decrease was observed at various concentrations for CDK4 (8 and 16 μg/mL) and CDK2 (2, 8 and 16 μg/mL) (Fig. 3).

Fig. 3.

Relative mRNA intensity of cyclin D, cyclin E, CDK4 and CDK2 in human lymphocyte cultures treated with 0 (untreated), 2, 4, 8 and 16 µg/mL V₂O₃ for 24 h. Data are presented as the means ± SDs from three independent experiments with duplicate samples (n = 6). * p < 0.05, ** p < 0.01 compared to the untreated group (ANOVA-Tukey).

Cell cycle progression depends on the association of cyclins/CDKs. The cyclin D/CDK4 complex is necessary for the cell to exit the G₀ phase, whereas the cyclin E/CDK2 complex keeps pRb phosphorylated and allows the cell to complete the G₁ phase and enter the S phase [42]. In this study, the mRNA and protein expression levels of cyclin D, cyclin E, CDK2 and CDK4 decreased upon administration of V₂O₃; as a result, the cycle is momentarily arrested by lymphocytes, as the protein expression levels needed to form cyclin/CDK complexes are not reached.

V compounds have been shown to modify the expression levels of some RNAs [43], as well as cyclin and CDK proteins involved in cell cycle regulation 12, 31, 41, 44. V compounds have been shown to inhibit mRNA synthesis by reacting with nucleotides; in addition, these compounds activate protein phosphatases, kinases, or enzymes involved in the degradation of these polymers 45, 46, 47, which can subsequently lead to decreased expression of RNAs as gene products. Notably, the delay we observed may also be related to vanadium(III)-induced DNA damage, as cells that incur damage stop their cycle to repair DNA lesions.

3.4. DNA damage sensor protein γH2AX

With respect to the results obtained for the expression levels of γH2AX, a concentration-related increase was observed, with significant differences at concentrations of 8 and 16 μg/mL V₂O₃ (Fig. 4). γH2AX is a sensor of the DNA damage response and is indicative of double-strand breaks.

Fig. 4.

Normalized data on the relative intensity of γH2AX (DNA damage sensor) protein from human lymphocyte cultures treated with 0 (untreated), 2, 4, 8 and 16 µg/mL V₂O₃ for 24 h are presented. Data are presented as the means ± SDs of three independent experiments with duplicate samples (n = 6). * p < 0.05, ** p < 0.01 compared to no treatment (ANOVA-Tukey).

Our results show that the relative intensity of γH2AX increases. V₂O₃ induces single-strand breaks in DNA in peripheral blood leukocytes in vitro (1, 2, 4 or 8 μg/mL) [18] and chromosomal damage in in vivo experimental models 16, 19, effects that have been observed with other V compounds (VCl₃, V₂O₄ and V₂O₅) 19, 20, 30, 48. Double-strand breaks in DNA are the most damaging effects to the cell because they are related to the formation of structural chromosomal aberrations 16, 19, and vanadium(IV) has been demonstrated to induce this type of damage in human lymphocytes 18, 37. V₂O₃ treatment induces H2AX phosphorylation, revealing that this chemical species can induce double-chain injury, directly or indirectly (by intracellularly changing the oxidation state from III to IV).

γH2AX regulates repair pathways such as p53, which is responsible for cell cycle arrest, among other functions; however, V₂O₃ does not modify p53 expression levels and does modify H2AX phosphorylation. Therefore, this alternative pathway may be responsible for the cell cycle delays observed in response to V₂O₃ treatment.

4. ROS

The induction of DHR oxidation was obtained by FSC/SSC dot plots, in which V₂O₃ treatment increased the fluorescence intensity at all concentrations, with significant differences at 2 (p < 0.01) and 4 μg/mL (p < 0.01) (Fig. 5). Although significant differences were not observed for some concentrations (for 8 and 16 μg/mL, they are at the limit of significance), the increase in these concentrations was at least 0.6 times greater than that of the control; therefore, this increase is important enough to discuss.

Fig. 5.

Estimation of the percentage of cells fluorescing by DHR oxidation in human lymphocytes treated with 0 (untreated), 2, 4, 8 and 16 µg/mL V₂O₃ for 24 h. Data are presented as the means ± SDs of three independent experiments performed in duplicate (n = 6). * p < 0.05 compared to the untreated group (ANOVA-Dunnett).

In addition, vanadium(III) oxide in lymphocyte cultures increases oxidative stress. DNA damage is linked to ROS, and V^V has been shown to promote the production of H₂O₂ 32, 49 and V^III the formation of radicals, such as ·OH 50, 51, 52, which can lead to the oxidation of nitrogenous bases. As previously determined, when multiple lesions occur continuously on both strands of DNA, double-strand breaks can occur in this molecule 52, 53. Although increased H₂O₂ was observed in this work, H₂O₂ cannot directly damage DNA; the products of H₂O₂ are the causative agents, such as ·OH, which may be generated through the reaction of H₂O₂ with V₂O₃ (V^III + H₂O₂ → VO²⁺ + ·OH + H⁺ or 2 V^III + H₂O₂ → 2VO²⁺ + 2 H⁺). In this reaction, VO²⁺ (V^IV) can enter the redox, Fenton or Haber-Weiss reactions and increase the effects 3, 50, 54, 55.

Finally, in this work, we found that V₂O₃ does not affect cell viability; however, it delays the cell cycle in the G1-S phase. This delay is associated with a decrease in the mRNA levels of cyclins/CDKs, as well as their protein levels, in addition to causing intracellular oxidative stress, which may cause DNA double-strand damage and H2AX phosphorylation (Fig. 6). These effects may explain the induction of chromosome damage observed in other experimental models. Further studies are needed to specify the type of DNA damage, elucidate the pathway that detects DNA damage, and identify the repair mechanisms induced by V₂O₃.

Fig. 6.

Mode of action of V₂O₃. Within cells, V₂O₃ can exist as a compound or ion, and its presence modifies the structure or function of biomolecules, including the phospholipids of lysosomes and mitochondria. This modification leads to the release of their contents and an increase in ROS. H₂O₂ reacts with V³⁺ to produce ·OH, contributing to DNA damage. In this case, either ROS or vanadium in the form of a cation or compound promotes single-strand breaks (SSBs) and double-strand breaks (DSBs) in DNA, as demonstrated by H2AX phosphorylation. This process leads to cell cycle arrest by decreasing the gene expression of mRNAs and the protein expression of cyclins and CDKs.

Funding

This wok was supported by Universidad Nacional Autónoma de México project PAPIIT IN229220 and IN210324.

CRediT authorship contribution statement

Juan José Rodríguez: Writing – review & editing, Writing – original draft, Project administration, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Víctor Alan Alcántara-Mejía: Writing – review & editing, Writing – original draft, Software, Resources, Methodology, Investigation, Formal analysis, Data curation. Rodrigo Mateos-Nava: Visualization, Validation, Supervision, Resources, Methodology, Investigation. Lucila Álvarez-Barrera: Visualization, Validation, Supervision, Resources, Methodology. Edelmiro Santiago-Osorio: Visualization, Validation, Supervision, Conceptualization. Edmundo Bonilla-González: Visualization, Validation, Supervision, Methodology, Formal analysis. Mario Altamirano-Lozano: Project administration, Methodology, Investigation, Funding acquisition, Conceptualization.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper

Handling Editor: L.H. Lash

Appendix A. Supplementary material

Supplementary material.

Data Availability

Data will be made available on request.