Formation of ovarian organoid by co-culture of human endometrial mesenchymal stem cells and mouse oocyte in 3-dimensional culture system

Abstract

The purpose of this study was to compare the formation of organoid structures by co-culturing of human endometrial mesenchymal stem cells (hEnMSCs) and mouse germinal vesicle (GV) oocytes in hanging drop and sodium alginate hydrogel co-culture methods. Following the preparation of hEnMSCs and partially denuded mouse germinal vesicle oocytes, they were co-cultured in hanging drop and sodium alginate hydrogel systems as two experimental groups. In respected control groups the hEnMSCs were cultured without oocytes. The organoid formation was evaluated under the inverted microscope in all studied groups during the culture period. The hematoxylin and eosin, alcian blue, periodic acid Schiff, and Masson's trichrome methods, were applied for morphological evaluation and extracellular matrix components staining such as glycosaminoglycan, carbohydrate, and collagen fibers. In addition, the germ cell-like characteristics within the organoid structures were investigated via alkaline phosphatase activity immunocytochemistry for DEAD-box polypeptide 4 (DDX4), and the expression of octamer-binding transcription factor 4 (OCT4), DDX4, and synaptonemal complex protein 3 (SYCP3) genes by real-time RT-PCR. The culturing of hEnMSCs in the hanging drop method led to the formation of organoid structures while this structure was not seen in sodium alginate hydrogel culture. The mean diameter of organoid structures was increased during 4 days of culture in both the experimental and control groups in the hanging drop method, reaching 675.50 ± 18.55 µm and 670.25 ± 21.40 µm, respectively (P < 0.05). Morphological staining indicated some large ovoid cells with euchromatin nuclei in the experimental group, whereas, in the control group cells showed dark and dense nuclei. The extracellular matrix components were deposited in organoid structures in both control and experimental groups. The positive alkaline phosphatase activity and immunocytochemistry for DDX4 confirmed the presence of germ cell-like in the experimental group. Real-time RT-PCR showed a significant increase in the expression of DDX4 and SYCP3 genes and a decrease in the level of OCT4 expression in the experimental group compared with its controls. This study successfully generated organoid structures by co-culture of hEnMSCs and oocytes in the hanging drop method and the hEnMSCs could be differentiated into germ cell-like. This organoid structure has potential applications in regenerative medicine and reproductive biology.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10616-024-00639-w.

Introduction

Advancing in three-dimensional (3-D) cell culture methods creates a new approach in tissue engineering and regenerative medicine (Kim et al. 2023). Spheroids are one of the 3-D models that first developed into functional cell aggregates (Rezaei et al. 2023). This strategy has improved by using several cell types including stem cells and somatic cells to construct the more complex structure named organoid (Urzì et al. 2023). The organoid constructs are similar to the structure and functions of the native organs and for their generation, a variety of 3-D culture techniques have been applied including scaffold-free systems or scaffold-based systems (Urzì et al. 2023). In scaffold-free systems, the cell aggregations can be formed based on the physical conditions that prevent cell attachment. In contrast, in scaffold-based systems, several natural or synthetic scaffolds are used to provide the essential nutrients and requirements for cell attachments, proliferation, growth, and differentiation (Frances-Herrero et al. 2022).

Sodium alginate is the most widely extensively utilized hydrogel in tissue engineering with minimal cytotoxicity, facile processing, and rapid gelation time (Ghanbari et al. 2022). It has been applied as a highly hydrated 3-D scaffold-based system for cell and follicle encapsulation (Wei et al. 2023). Its beneficial effect for in vitro follicular development and maturation was shown in several research (Wang et al. 2023a, b; Jalili et al. 2021; Jamalzaei et al. 2020). Sodium alginate hydrogel also facilitates cell–cell interactions, nutrient exchange, and signal transduction, which are essential for the formation and development of organoids in laboratory settings (Zhao et al. 2022).

The hanging drop method is a sample scaffold-free system in which the cells are suspended within the media in the dish's lid's inner surface, allowing the cells to form the aggregate at the interface between liquid and air. The main advantages of this technique are its simplicity, consistent outcomes, absence of matrix requirements, and high efficacy in generating spheroids from a limited cell population (Wang et al. 2023a, b).

To date, investigators have provided several in vitro models for ovarian organoids by using various cellular lineages including stem cells, precursor cells, surface epithelial cells of the ovary, granulosa cells, and even tumor cell lines (Alzamil et al. 2021; Maenhoudt et al. 2020; Kwong et al. 2009; Kruk and Auersperg 1992; Kopper et al. 2019; Del Valle et al. 2023). Ovarian epithelial organoid was first established by Kruk and Auersperg in 1992 and is useful for the studying of early events of ovarian cancer and testing the various therapeutic agents (Kruk and Auersperg 1992).

In the preclinical studies, the ovarian organoids serve as a model, to estimate how patients will respond to therapeutic agents and medicine as personalized therapies (Chitrangi et al. 2023; Hu et al. 2024). Despite these tumor-derived organoids could serve as an excellent 3-D tool for cancer research they showed some somatic mutations and amplifications/deletions and, therefore there are some limitations in their usage (Kopper et al. 2019; Nishimura and Takebe 2024).

Krotz et al. introduced spheroid and complex 3-D microtissues that resemble the ovary by isolation of theca and granulosa cells and seeded them into micro-molded gels. The function of this reconstructed ovary was evaluated by in vitro maturation of cumulus-oocyte complexes and polar body extrusion (Krotz et al. 2010). Jeon et al., assessed the endocrine function of engineered ovarian multi-layered cell spheroids by encapsulation of granulosa and ovarian theca cells in collagen gel, successfully creating ovarian-like spheroids which are capable of producing 17β-estradiol, and progesterone hormones over 30 days (Jeon et al. 2021). Li et al. established an ovarian organoid model using female germline stem cells in a 3-D culture system (Li et al. 2021). The results exhibited the reproductive and endocrine functions in this reconstruction and a variety of ovarian cell types were detected within this organoid. Also, the successful production of offspring from these ovarian organoids confirmed that this organoid could produce functional oocytes. This model had the potential for studying unknown factors that impact follicular growth and development (Li et al. 2021). Similarly, Luo et al. demonstrate the successful production of offspring from transdifferentiation of spermatogonial stem cells into functional oocytes in ovarian organoids (Luo et al. 2021).

The differentiation of mouse and human pluripotent stem cells into germline cells was discussed previously (Wu et al 2023). Moreover, the ovarian organoid is suitable for understanding the mechanisms of the differentiation of human stem cells into primordial germ cells, oocyte-like cells, and ovarian follicles (Jung et al. 2017). Human endometrial mesenchymal stem cells (hEnMSCs) as a type of adult stem cells have unique characteristics such as high proliferation capacity, and a wide range of differentiation into several lineages. They have very similar properties to other types of mesenchymal cells, in addition, they showed some characteristics such as low immunogenicity which is crucial for successful engraftment and long-term viability, the low tumorigenic potential that reduces the risk of abnormal cell growth, immunomodulatory capabilities that they can regulate immune responses, expanded in culture without losing their stemness and differentiation potentials, hormonal independence (Bozorgmehr et al. 2020). Recently hEnMSCs were applied for endometrial reconstruction and organoid formation in 3-D culture using natural scaffolds (Domnina et al. 2021; Luddi et al. 2020; Francés-Herrero et al. 2021, Sargazi et al. 2023).

Based on the importance of ovarian organoid technology in clinical research and ovarian biology the objective of this study was to compare the efficiency of ovarian organoid formation by co-culture of mouse GV oocyte and hEnMSCs in hanging drop and sodium alginate hydrogel 3-D culture systems.

Materials and methods

All applied materials were obtained from Sigma-Aldrich (London, UK) except for the others mentioned within the text.

Preparation of human endometrial mesenchymal stem cells

After obtaining the informed written consent, the human endometrial samples were collected from patients undergoing endometrial hysterectomy for non-pathological conditions. This procedure was approved by the Ethics Committee of Tarbiat Modares University, Tehran, Iran (IR.MODARES.REC.1400.210). Subsequently, endometrial stromal cells were isolated and cultured using established methods (Fayazi et al. 2017). In brief, the collected endometrial tissue fragments were digested by using 300 µg/mL collagenase type I and 40 g/mL deoxyribonuclease type I for 90 min, and their cells were isolated and filtered with different size meshes (BD Biosciences, Erembodegem, Belgium). Then the collected cell suspension was centrifuged, washed, and cultured. After four subcultures, the harvested cells underwent flow cytometry analysis to validate the presence of mesenchymal markers (CD90 and CD44) and hematopoietic (CD34) and endothelial (CD31) markers (Tavakol et al. 2018).

Preparation of mouse oocytes

The immature oocytes at the germinal vesicle (GV) stage were collected from adult female Naval Medical Research Institute mice (n = 20). The animals were used following the ethical guidelines of Tarbiat Modares University, Tehran, Iran (IR.MODARES.REC.1400.210). The mice received intraperitoneal injections of pregnant mare serum gonadotropin (7.5 IU; Karma, Iran), 48 h later, their ovaries were dissected and placed in α-minimum essential medium (α-MEM; Gibco, UK) supplemented with 10% fetal bovine serum (FBS), 0.23 mM sodium pyruvate, 75 μg/mL penicillin and 50 μg/mL streptomycin. Under a stereomicroscope, the GV oocytes were mechanically isolated and collected (n = 90).

Study design

To evaluate the formation of cell aggregates or organoid structure, following the preparation of hEnMSCs and GV oocytes, they were co-cultured in hanging drop and sodium alginate hydrogel in two experimental groups. The hEnMSCs were cultured alone in two control groups in the same culture media. The diameter and morphology of the organoid structures were evaluated under inverted and light microscopy. The extracellular materials such as glycosaminoglycans (GAGs), carbohydrates, and collagen fibers were evaluated using alcian blue, periodic acid Schiff (Lonergan et al. 1996), and Masson's trichrome staining respectively. Then alkaline phosphatase histochemistry and immunocytochemistry for germ cell markers were performed. The expression of genes related to the pluripotency, germ cells, and meiosis markers was analyzed using real-time RT-PCR.

Co-culture in hanging drop

The hEnMSCs suspension at a concentration of 5 × 10⁵/mL in α-MEM medium was prepared. Then, 20 μL droplets of cell suspension were placed on the inner surface of the cover culture dish. After that in the experimental group, one GV oocyte was put into each droplet (n = 60 oocytes in all droplets) and incubated in culture media supplemented with 10% of FBS, 0.23 mM of sodium pyruvate, 1% insulin transferrin selenium (Gibco, UK), 50 of μg/mL penicillin, and 75 of μg/mL streptomycin for 4 days at 37 °C in 5% CO₂.

The additional set of droplets containing hEnMSCs suspension (20 μL) without oocytes were considered as the control group and cultured in the same as experimental group.

Co-culture in sodium alginate hydrogel

The sodium alginate solution (0.5%) was prepared based on previous study (Abdi et al. 2013). Then, the hEnMSCs with 5 × 10⁵ concentration were thoroughly mixed with the sodium alginate solution in a 1:1 ratio, resulting in the formation of a homogeneous solution. Subsequently, one oocyte was put into 10 μL of cell suspension (n = 30 oocytes in all droplets). After that, they were immediately immersed in a CaCl₂ solution (140 mM). After 1 min, the formed hydrogel was washed and then incubated in α-MEM medium containing 10% of FBS, 0.23 mM of sodium pyruvate, 1% insulin transferrin selenium, 50 of μg/mL penicillin, and 75 of μg/mL streptomycin for 4 days at 37 °C in 5% CO₂ (Bagheri et al. 2023). The same condition was applied for the control group except for putting the oocyte.

Inverted microscope observation

The formation of cell aggregation and organoid structure were evaluated daily under an inverted microscope for 4 days. During this time the figures of these structures were captured and their diameter was measured using Image J software. According to our observation, the organoid structures only were formed in the hanging drop culture method thus the following assessments were done for this method.

Morphological staining

For morphological evaluation of organoid structure at the end of the culture period, the specimens from both studied groups (n = 10 for each group) in hanging drop were fixed in Bouin’s solution and underwent a dehydration process with a series of ethanol concentrations (70%, 80%, 90%, 96%, and 100%). After clearing in xylene and embedding in paraffin wax, the sections at 5 µm thickness were prepared and stained with hematoxylin and eosin (H&E) procedure.

Extracellular matrix staining

Additional sets of paraffin sections of organoid structures were prepared as previously described and applied for alcian blue, PAS, and Masson’s trichrome staining for extracellular matrix components including GAGs, carbohydrate and collagen fiber respectively (n = 3 in each group for each staining). The stained sections were observed under a light microscope.

Alkaline phosphatase activity

The collected organoid structures from both studied groups in hanging drop (n = 3 in each group) were embedded in optimal cutting temperature (OCT; Gentour, UK), then these samples were sectioned at 5 µm thickness by using a cryostat (Leica 1860, Germany). Then, the alkaline phosphatase activity of these structures was determined using a commercial kit (Sigma, USA). Briefly, the slides were fixed with a citrate-buffered-acetone solution for 30 s. Then, they were washed in deionized water and subsequently incubated with an alkaline-dye mixture (consisting of Fast Violet B Salt, Naphthol AS-MX Phosphate Alkaline Solution) at room temperature for 30 min. For nuclear counterstaining, a hematoxylin solution was applied for 10 min. Finally, the slides were washed in distilled water and examined under a light microscope.

Immunocytochemistry

For DEAD-box polypeptide 4 (DDX4) immunocytochemistry as a germ cell marker, other sets of paraffin-embedded tissue sections were obtained from organoid structures in both studied groups (n = 3 in each group). Briefly, the slides were deparaffinized using xylene for 20 min with two changes and followed by hydration through a descending ethanol concentration series and distilled water. Subsequently, they were subjected to antigen retrieval using Tris-EDTA buffer (pH: 9). The endogenous peroxidase activity was quenched by incubating the slides in a 3% H₂O₂ solution for 10 min at room temperature. The samples were then blocked with a blocking buffer for 1 h, followed by incubation with an anti-human primary antibody DDX4 (Elabscience, USA; 1:200 diluted) for 1.5 h at room temperature. The slides were washed three times with Tris buffer for 3 min. Subsequently, the tissue sections were incubated with an appropriate horse radish peroxidase-conjugated secondary antibody (Master Diagnostica, Spain) for 30 min at room temperature, followed by another round of Tris buffer washes for 1 min. Finally, the slides were incubated with diaminobenzidine solution for 5 min at room temperature to visualize immunostaining. For negative controls, the primary antibody was omitted. The slides were examined under a light microscope.

Molecular analysis

The ratio expression of target genes including OCT4, DDX4, and SYCP3 as pluripotency and germ cell markers along with β-actin as a housekeeping gene, were assessed and compared in the collected samples from the control and experimental groups in the hanging drop method using real-time RT-PCR. Also, the hEnMSCs at the beginning of co-culture were considered as an additional control group.

In brief, the collected organoid structures (n = 30 organoids in 3 repeats in each group) were treated with TRIzol^© reagent (Thermo Fisher Scientific, Germany) following the manufacturer’s guidelines. For RNA extraction, after the samples were homogenized, 200 µl of chloroform solution was added to the samples centrifuged at 13,000 rpm for 15 min, and transferred to a new microtube. Then, 1 mL of isopropanol was added and centrifuged after 10 min mixed with 70% ethanol at a ratio of 1:1, and centrifuged at 8000 rpm for 5 min. RNA deposition was mixed with 20 µl of water and placed on a dry plate device for 10 min. Quantification of RNA was determined via spectrophotometric measurement at a wavelength of 260 nm. Subsequently, the RNA samples were subjected to reverse transcription into complementary DNA (cDNA) using a cDNA synthesis kit (Thermo Fisher Scientific, Germany), according to the manufacturer’s protocols. The generated cDNA samples were stored at − 20 °C until further analysis using real-time RT-PCR. Primers were designed using primer 3 software and confirmed via NCBI-Blast, the specific primer sequences are presented in Table 1.

Table 1.

Sequences of primers in studied groups

Product size (bp)	Accession number	Primer pair sequence	Gene
181	NM_153694.5	F: TTACGAGAGCCTATGACTTTGAG R: ATGTCAACTCCAACTCCTTCC	SYCP3
129	NM_001166533.2	F: TGAAATTCTGCGAAACATAGGG R: TCCCGATCACCATGAATACTTG	VASA (DDX4)
119	NM_002701.6	F: CCCTTCGCAAGCCCTCATTTCAC R: GCCCATCACCTCCACCACCTG	OCT4 (POU5F1)
90	NM_001101.5	F: CAAGATCATTGCTCCTCCTG R: ATCCACATCTGCTGGAAGG	β-ACTIN

Real time RT-PCR reactions were conducted using the StepOnePlus Real-Time PCR System (Applied Biosystems, USA) in conjunction with the QuantiTect SYBR Green RT-PCR kit (Qiagen, Hilden, Germany). Each reaction mixture consisted of a final volume of 10 µl, containing 4 µl cDNA, 0.5 µl forward primer, 0.5 µl reverse primer, and 5 µl SYBER Green. The initial denaturation period involved incubation at 94 °C for 10 min, followed by subsequent annealing steps at 94 °C for 30 s, 59 °C for 45 s, and 72 °C for 45 s. A final extension phase was performed at 72 °C for 10 min. A total of 38 cycles were executed. The validity of the reactions was confirmed through both melting and amplification curve analyses. To determine the relative expression of the studied genes about the reference gene, ₂^−(ΔΔCT) formula was employed. The confirmation of real-time RT-PCR products was verified by gel electrophoresis.

Statistical analysis

Statistical analyses and graphical representations were performed using Prism GraphPad software (version 9). Each experiment was repeated at least three times. The normal distribution of the data was assessed using the Shapiro–Wilk test and the Brown–Forsythe test. All data were presented as mean and standard deviation (mean ± SD). For comparisons between groups, two-tailed unpaired Student’s t-tests were employed. P-value less than 0.05 was considered statistically significant.

Results

Human endometrial mesenchymal stem cells characteristics

The morphology of hEnMSCs under an inverted microscope at the fourth passage is shown in Fig. 1. The flow cytometry analysis showed that 98.13 ± 1.62% and 98.78 ± 1.56% of the cultured cells expressed the CD90 and CD44 proteins respectively as specific surface markers of mesenchymal stem cells. Whereas 0.58 ± 0.38% and 0.57 ± 0.23% of these cells expressed the CD 34 and CD31 proteins respectively, which are specific markers of hematopoietic and endothelial cells.

Fig. 1.

The morphology of human endometrial mesenchymal stem cells at the fourth passage under an inverted microscope (A). The summary of their flow cytometry analysis for CD90, CD44, CD34, and CD31 is shown in part B

Morphological observation of organoid structures under an inverted microscopy

The representative figures of organoid formation during four days of cultivation time in the control and experimental groups in hanging drop and sodium alginate hydrogel were demonstrated in Figs. 2 and 3 respectively. At the beginning of the culture in hanging drop, the hEnMSCs tended to form cell aggregation. After 18 h, these cells had begun forming recognizable one organoid structure in each droplet and these structures had shown a distinctive spherical form with well-defined borders. Their size was increased during the culture period. Their diameters were 612.45 ± 18.51 and 610.81 ± 20.45 µm after 24 h and reached 670.25 ± 21.40 and 675.50 ± 18.55 µm in the control and experimental groups respectively, and it was significantly increased in both groups (P < 0.05) but there was no significant difference between these two groups (P > 0.05).

Fig. 2.

Morphological observation of co-cultured human endometrial mesenchymal stem cells and mouse oocytes in the hanging drop method under an inverted microscope. Co-culture of hEnMSCs with GV oocyte in the experimental group at the beginning of culture (A), the formation of organoid after four days of the culture period (B), the oocytes were pointed by black arrow. The morphology of hEnMSCs without oocytes in the control group at the beginning of culture (C), and the organoid structure on day four of culture (D). The comparison of the organoid diameters during the culture period in two studied groups (E). *There were significant differences between the diameter of organoids in experimental and control groups on day 4 and their diameter on day 1 of culture (P < 0.05)

Fig. 3.

Inverted microscope observation of co-cultured human endometrial mesenchymal stem cells and mouse oocytes in the sodium alginate hydrogel (A–D). Micrographs of cell culture at the beginning and day five of culture were demonstrated on the first and second columns respectively. The black arrow points to the oocyte

The morphology of cultured hEnMSCs in the sodium alginate hydrogel under the inverted microscope is presented in Fig. 3. As these micrographs showed in both experimental and control groups of this method the organoid was not formed during the culture period (Fig. 3) and the cultured cells dispersed among the hydrogels.

Light microscopy observation

The micrographs of the organoid structures stained by H&E in the hanging drop method are presented in Fig. 4. These figures demonstrate the organoid structure surrounded by a capsular component. In the experimental group, the cells of organoid showed different morphology and size and they had oval or polyhedral shapes, clear cytoplasm, and euchromatin nuclei and some of them had a large size of up to 30 µm (Fig. 4 A, a and B, b). These large cells are surrounded by several small cells such as mouse fetal ovarian nests (Supplementary Fig. 1). The 16-day-old mouse fetal ovary is composed of several clusters of germ cells. They are surrounded by nurse cells. While in the control group cells had uniform morphology, eosinophilic cytoplasm, and heterochromatin nucleus (Fig. 4D, d).

Fig. 4.

Light microscopy observation of organoid structures stained by hematoxylin and eosin. The formed organoid in two samples of the experimental group in low magnification (A, B) and the same samples with high power magnification (a, b). Arrows indicate the large size of cells compared to the surrounding cells. Organoid structure formation in the absence of oocytes in the control group with different magnifications (C, c)

Extracellular staining

Alcian blue staining demonstrated the deposition of GAGs in the organoid structures in both studied groups as a light blue color. The intensity of this staining was more in the periphery of the organoid structure (Fig. 5A, B). Distinct PAS-positive materials that are related to glycogenic components, marked by a pink or red–purple are evident in these structures (Figs. 5C, D). To evaluate the deposition of collagen fiber within the organoid structure, Masson's trichrome staining was employed. By this technique, the presence of secreted collagen fibers was shown as blue staining in both control and experimental groups (Fig. 5E, F).

Fig. 5.

The extracellular matrix staining of the organoid structures in the hanging drop method. The micrographs of the experimental group are demonstrated in the first column and the control group in the second column. Alcian blue staining demonstrated the glycosaminoglycans components as blue color (A and B), periodic acid Schiff staining showed the deposition of carbohydrates as pinkish color (C and D) and Masson’s trichrome staining showed collagen fibers as blue color (E and F)

Alkaline phosphatase activity

Alkaline phosphatase (ALP) activity was evaluated in the studied groups and demonstrated in Fig. 6A and B. This figure showed a positive reaction as the purple color was seen in the organoid structure in the experimental group (Fig. 6A). While, no remarkable positive reaction was seen in the control group (Fig. 6B).

Fig. 6.

Alkaline phosphatase (ALP) activity of the organoid structure is shown in the first row. ALP positive cells in the experimental group (A) pointed by black arrow, ALP negative reaction in the control group (B). Immunocytochemistry for DEAD-box polypeptide 4 (DDX4) in the organoid structures was seen in the second row. In the experimental group (C) and control group (D), the black arrowheads indicate the cells that expressed the DDX4 antibody in the experimental group

Immunocytochemistry of organoid structures

The representative figures of immunocytochemistry of organoid structure in both studied groups were presented in Fig. 6. The protein expression of the DDX4, as a germ cell marker was seen in some of the cells in the experimental group (Fig. 6C). In the control group, no positive reaction for DDX4 was detected (Fig. 6D).

Gene expression in organoid structures

The relative expression of the target to housekeeping genes was calculated and compared in three groups (Fig. 7A–C). The ratio expression of OCT4 was significantly decreased after culture in the control (4.47 ± 0.51) and experimental (5.64 ± 0.60) groups in comparison with hEnMSCs at the beginning of culture (10.47 ± 0.68; P < 0.001). There was no significant difference between the control and experimental groups (P > 0.05).

Fig. 7.

The relative gene expression in organoid structures was cultured in the hanging drop method. The ratio expression of pluripotency gene octamer-binding transcription factor 4 (OCT4; A), germ cell marker DEAD-box polypeptide 4 (DDX4; B), and meiosis marker synaptonemal complex protein 3 (SYCP3; C) was compared in experimental and control groups with each other and with hEnMSCs at the beginning of culture (*Indicated significant differences between groups; P < 0.05)

The relative expressions of DDX4 as a germ cell-related gene and SYCP3 as a meiosis-related gene in the control group were 1.58 ± 0.31 and 0.48 ± 0.07 and in the experimental group were 2.44 ± 0.09 and 0.69 ± 0.05 respectively. The levels of these gene expressions were significantly higher in the experimental group in comparison with the control group (P < 0.05). Moreover, the level of the mentioned gene expression in the hEnMSCs at the beginning of the culture were 0.14 ± 0.02 and 0.08 ± 0.01 respectively. There was a significant increase in the expression level of these genes in both control and experimental groups in comparison with the hEnMSCs (P < 0.05).

Discussion

Several attempts have focused on establishing ovarian organoids by using epithelial, granulosa, theca, embryonic gonad, or ovarian cancer cells in matrigel, agarose, or other types of 3-D culture conditions (Zhang et al. 2023; Kwong et al. 2009; Frances-Herrero et al. 2022). To understand human oogenesis, the development of an alternative system by differentiating stem cells into oocytes is necessary. This study aimed to compare the generation of organoid structures by co-culturing hEnMSCs and mouse GV oocytes in two 3-D culture systems (hanging drop and sodium alginate hydrogel methods). In the present study, we have to use the mouse oocyte because of some limitations in the usage of the human sample.

Our observation revealed that the organoid structures were formed only in the hanging drop culture method, while in sodium alginate hydrogel it was not formed. There are some suggestions for this observation as the following. The formation of cell aggregation is facilitated in the hanging drop method due to the presence of gravitational force in contrast in a hydrogel the cells were more dispersed and during the short time of culture, they could not establish good contact. The process of forming the organoid structures generally involves the initial cell–cell contacts, leading to the creation of aggregated cells by mediating cadherin-cadherin interactions and integrin binding to extracellular matrix proteins (Egger et al. 2018; Lin et al. 2006). Organoid formation typically occurs within 24 h but may take longer depending on the cell type (Foty 2011) similarly, in the present study, hEnMSCs exhibited a gradual convergence movement due to gravitational forces within the initial hour of co-culture.

The evaluation of cellular behavior within 3-D hydrogel constitutes a multifactorial task that requires consideration of various parameters, among which cell density stands out as particularly crucial. Cell density has a direct impact on cell signaling. The high-density cell culture promotes cell–cell contact for the formation of cell aggregation. (Bogacheva et al. 2021).

Following the formation of these structures, hEnMSCs begin to undergo cell division, leading to an increase in the size of the organoid structures, as our data showed the diameter of the organoid was increased throughout the culture process. Moreover, alcian blue, PAS, and Masson's trichrome staining provided insights into the composition of the extracellular matrix within the formed organoid structures. The deposition of GAGs, collagen fibers, and glycogen in the organoid is indicative of complex tissue-like structures.

The assessment of organoid morphology by H&E exhibited a similar structure between the formed organoid in the experimental group and the 16-day mouse fetal ovary, which contain cluster of germ cells surrounded by several nurse cells (Supplementary Fig. 1). This method of culture leads to the formation of structures that mimic the characteristics of ovarian tissue.

One of the notable characteristics of hEnMSCs is their ability to proliferate and differentiate under suitable cultural conditions (Mutlu et al. 2015; Hong 2023). In several studies, these cells were used for the reconstruction of endometrial tissue or endometrial organoids by using natural bioscaffold (Pieri et al. 2019; Francés-Herrero et al. 2021; Domnina et al. 2021). In the present study for the first we showed the potential of hEnMSCs to form ovarian organoid structures, under inductive effects of oocytes hEnMSCs underwent alterations in size and phenotype. Some cells exhibited enlarged cytoplasm resembling oocytes, whereas others displayed a distinct appearance characterized by smaller sizes as nurse cells. These results suggest that an inductive effect of oocyte-secreting factors through a paracrine signaling pathway on the hEnMSCs, leading to their differentiation into germ cells or oocyte-like cells (Paulini and Melo 2011). This finding is consistent with previous studies on the generation of oocyte-like cells from mesenchymal stem cells (Taheri et al. 2021). Taheri Moghadam et al., showed that mesenchymal stem cells derived from the follicular fluid can differentiate into oocyte-like cells by the influence of BMP15, a key factor secreted by oocytes (Taheri et al. 2021). Zolfaghar et al., demonstrated the potential of mesenchymal stem cells for differentiation into germ cells or oocyte-like cells (Zolfaghar et al. 2020). In another part of the present study, the immunocytochemistry analysis using the germ cell marker DDX4 revealed the presence of germ-like cells within the organoid structures in the experimental group. However, further investigations are required to fully characterize the nature and potential of these germ-like cells within the organoids.

Our molecular experiments confirmed this suggestion, as co-culturing of hEnMSCs with mouse oocytes led to the reduction in OCT4 gene expression as a pluripotency marker in these cells. Other investigators have revealed that a decline in the expression of the transcription factor OCT4 is correlated with a decrease in the potential of cell differentiation (Zuccotti et al. 2009; Babaie et al. 2007).

The other parts of this study showed the expression ratio of DDX4 and SYCP3 as a germ cell and meiosis marker was significantly increased in hEnMSCs that co-cultured in the presence of oocytes and this finding is in line with others (Taheri et al. 2021; Jung et al. 2017; Zolfaghar et al. 2020). In agreement with this suggestion Grafe et al., revealed that BMP15 promotes the differentiation of hEnMSCs and reduces the expression of pluripotency gene markers (Grafe et al. 2018). In our study, we have used mouse oocytes at the GV stage because the level of BMP15 expression was higher in the germinal vesicle and germinal vesicle breakdown stage (as the early stage of oocyte development), in comparison with mature metaphase oocyte stage (Cadenas et al. 2022).

These results suggested that this organoid technology may have implications in reproductive medicine, such as in vitro modeling of ovarian development, drug screening, and personalized medicine. Moreover, additional studies could focus on optimizing the co-culture conditions, investigating the long-term stability and functionality of the generated organoids, and elucidating the specific mechanisms by which GV oocytes influence hEnMSCs differentiation.

In conclusion, this study successfully generated organoid structures by co-culture of hEnMSCs and GV oocytes in the hanging drop method and the hEnMSCs could differentiated into germ-like. This organoid structure has potential applications in regenerative medicine and reproductive biology.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Mohammad Jafar Bagheri; Performed the experiments, analyzed the data and contributed to writing the manuscript. Mojtaba Rezazadeh Valojerdi involved in protocol development; M. Salehnia; Supervised the study and contributed to writing the manuscript. All authors reviewed and edited the manuscript and approved the final version of the manuscript.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Conflict of interest

The authors clarify there is no conflict of interest.

Ethical approval

This experimental study was endorsed by the Ethics Committee of Faculty of Medical Sciences of Tarbiat Modares University Tehran, Iran (IR.MODARES.REC.1400.210).

Informed consent

The preparation of human and mouse samples was according to the guidelines of the Ethics Committee of the Faculty of Medical Sciences of Tarbiat Modares University and informed consents were obtained for using the human tissues (No. 1400.210).