Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Jul 5;103(10):104064. doi: 10.1016/j.psj.2024.104064

Trifolium pratense as a novel phytogenic supplement, is an anticoccidial agent in chickens

Yi-Yang Lien *,1, Lie-Fen Shyur †,‡,§,1, Yuan-Bin Cheng #, Meng-Ting Chang †, Chi-Ting Chang †, Yu-Hsin Chen ||, Guan-Hua Lai *, Hsing-Yu Liao *, Ming-Chu Cheng *,2
PMCID: PMC11347856  PMID: 39106704

Abstract

Coccidiosis, caused by a protozoan parasite of the genus Eimeria, is one of the most severe contagious parasite diseases affecting the poultry industry worldwide. Using phytogenics to prevent chicken coccidiosis is a strategy aimed at combating the increasing issue of drug-resistant strains of Eimeria spp. This study demonstrates the anticoccidial activities of a medicinal herb, Trifolium pratense (TP) powder, and its ethanolic extract (designated TPE) against Eimeria spp. TPE exhibited significant suppressive activity against E. maxima oocyst sporulation and E. tenella sporozoite invasion and reproduction in Madin-Darby bovine kidney cells. Furthermore, administration of basal chicken diets containing TP powder or TPE to Eimeria-infected chickens significantly reduced the output of oocysts and severity of intestinal lesions. Dietary supplementation with TP significantly improved relative weight gain in E. tenella- and E. acervulina-infected chickens, while there was no significant improvement in E. maxima-infected chickens. The anticoccidial activities of TP and TPE on E. acervulina, E. tenella and E. maxima were further supported by anticoccidial index scores, which showed greater efficacy than those of amprolium, a commercial coccidiostat used in poultry. TP supplementation positively impacted the primary metabolism of chickens challenged with E. tenella or E. acervulina. The chemical fingerprints of TPE were established using liquid column chromatography; TPE contained 4 major compounds: ononin, sissotrin, formononetin, and biochanin A. In addition, various spectrometric methods were used to ensure the batch-to-batch consistency of TP/TPE. In conclusion, T. pratense is demonstrated to be a novel phytogenic supplement that can be used to control Eimeria-induced coccidiosis in chickens.

Key words: Trifolium pratense, Eimeria spp., coccidiosis, anticoccidial index, phytogenic supplement

INTRODUCTION

Coccidiosis, caused by a protozoan parasite of the genus Eimeria, is a challenging intestinal disease in the poultry industry. Currently, 7 species of Eimeria with different pathogenicities have been identified from chickens (Tewari and Maharana, 2011). Chicken Eimeria invade and multiply in the epithelial cells of the intestinal mucosa. As a result, chickens show symptoms such as reduced feed intake, digestive disorders, growth retardation, hemorrhagic diarrhea, and in severe cases, even death (Deplazes et al., 2016). Coccidiosis costs the global poultry industry more than US$13 billion annually, including losses during production and costs for prophylaxis and treatment (Blake et al., 2020). Chicken Eimeria also increases the susceptibility of the host to other pathogens. For instance, Clostridium perfringens is commonly co-infected with some Eimeria spp. causing necrotic enteritis (Shane et al., 1985; Baba et al., 1997; Williams et al., 2003). This disturbs the normal balance of the gut microbiota, leading to the proliferation of pathogenic bacteria and inhibiting the growth of chickens (Huang et al., 2018). Many commercially available anticoccidial drugs and vaccines have been used to prevent and control coccidiosis; however, they are still inadequate for curbing the disease (Qaid et al., 2021; Lee et al., 2022).

In recent years, issues such as slowing chemical drug discovery, drug resistance, and drug residues have led to the development of herbal anticoccidial medicines and phytochemicals, which are generally considered to be safer and more effective (Muthamilselvan et al., 2016). Herbal medicines and phytochemicals act through coccidiosis inhibition or impairment of invasion andasexual and/or sexual reproduction of Eimeria spp. in the intestinal tissue of chickens (El-Shall et al., 2022). Although numerous herbs or their extracts, as well as bioactive compounds with specific anticoccidial properties, have been reported in different review articles (Muthamilselvan et al., 2016; El-Shall et al., 2022), to the best of our knowledge, none have included Trifolium pratense.

Trifolium pratense L. (Leguminosae), also known as red clover, is an herbaceous, short-lived perennial plant, that is distributed all over the world. With characteristics that lend themselves to easy environmental adaptation like rapid growth and resistance to acidic and humid conditions, T. pratense can grow in many different habitats and climates. Therefore, red clover is considered to be an important highly productive forage legume for cattle and sheep in Europe and the United States. Red clover is used in some traditional medicine systems to treat menopausal symptoms and asthma and even lower the risk of cancer and heart disease. In previous natural product studies, coumarins, isoflavones, phenylpropanoids, and pterocarpans were identified in T. pratense (Booth et al., 2006); among them, isoflavones, a group of highly oxygenated natural products, are the most characteristic and abundant constituents of the plant. This study reveals that the T. pratense plant and its extract can effectively inhibit the activities of three chicken coccidia, E. acervulina, E. tenella, and E. maxima.

MATERIALS AND METHODS

Preparation of T. pratense Plant Samples and Extracts

The above-ground parts of T. pratense plants grown in Changhua County, Taiwan, were harvested, dried at room temperature, and crushed into an appropriate size for supplementing the basal diet of chickens. This preparation was designated TP. The total crude extracts of TP plants were prepared from dried plant materials using 70% ethanol at ambient temperature for 3 d, and the extraction was repeated 3 to 4 times. A rotary evaporator concentrated the collected extracts to obtain dry extracts. These extracts were designated TPE. HPLC was used to monitor the quality of batch-to-batch TP and TPE.

Establishment of Chemical Fingerprints of TPE

The chemical fingerprint of TPE was established using a Shimadzu LC-40AD prominence liquid chromatograph containing an auto-injector (SIL-40AD VP), column oven (CTO-40S), and a VP diode array detector HPLC system (SPD-M40A) (Shimadzu Corporation, Kyoto, Japan). Samples were separated using a Luna C18 (2) 100 Å, (250 mm × 4.6 mm, 5 μm) column (Phenomenex, CA). The mobile phase consisted of distilled water (A) and acetonitrile (ACN) (B) with the following 3 gradient steps: 0 to 35 min, 20 to 37% B; 35 to 45 min, 37 to 100% B; 45 to 50 min, 100% B, with a flow rate of 1 mL/min. The UV absorption was measured at 254 nm, and the column temperature was maintained at 40°C.

The 4 major compounds, ononin, sissotrin, formononetin, and biochanin A present in TPE were purified using preparative reverse phase HPLC using a C18 column (250 mm × 10 mm; 5 μm, YMC-Triart C18; YMC, Kyoto, Japan) and the chemical purity and structure were confirmed by mass spectrometry and 1H and 13C NMR spectrometry, and compared with the spectral data in the literature. The percentages of the 4 compounds in TPE were determined using their respective calibration curves established by the measured peak area intensity of the specific compound in the chromatogram versus a serial dilution of the compound with the corresponding concentrations injected into the column for analysis.

Cell Culture

Madin-Darby bovine kidney (MDBK) cells were a gift from Dr. Ming-Chu Cheng (Department of Veterinary Medicine, National Pingtung University of Science and Technology, Taiwan). They were routinely maintained in growth medium consisting of Dulbecco's modified Eagle's medium (DMEM) supplemented with 25 mM D-glucose and 4 mM L-glutamine (Gibco, Grand Island, NY), 10% fetal bovine serum (Gibco, Grand Island, NY) and 100 U/mL penicillin/100 μg/mL streptomycin antibiotic (Gibco, Grand Island, NY) at 37℃ in 5% CO2.

Preparation of Oocysts and Sporozoites

E. tenella (isolate PT-Te002), E. acervulina (isolate TT-Ac003) and E. maxima (isolate TN-Ma005) were isolated from the field in Taiwan. All species of Eimeria were routinely maintained for propagation in healthy 3-wk-old chicks every 2-3 months to obtain the respective oocysts as described (Lien et al., 2007).

Oocysts were obtained from the chickens 7 d postinfection with coccidia; the purification procedure was as previously described with some modifications (Molan et al., 2009). First, feces from the infected host were processed by homogenization with tap water. Then, homogenates (10 mL) were added to saturated sodium chloride solution (20 mL), gently mixed, and centrifugated at 150 to 200 × g for 1 min. After centrifugation, the top layer was collected and washed twice with 30 mL sterile deionized water and centrifuged at 1,200 × g for 2 min to precipitate the oocysts. The partially purified oocysts were resuspended in 2.5% potassium dichromate (w/v) with gentle agitation at room temperature to sporulate for 72 h. All parasites were stored at 4℃ for the subsequent experiments.

The process to recover sporozoites of E. tenella was as described in Lien et al. (2007) with some modifications. Briefly, the walls of the purified sporulated oocysts were broken by vortexing with 1-mm glass beads (Genechain Industrial, Taiwan) to release the contents of the oocysts. After that, the excysted sporozoites were isolated by centrifugation at 750 × g for 1 min in a gradient packing column with Percoll (GE Healthcare, Uppsala, Sweden) solution with concentrations from 50 to 80%. The pelleted sporozoites obtained from the 70% layer were collected and washed 3 times with PBS, then re-suspended with sterile PBS for the following experiments.

Oocyst Sporulation Inhibition Assay

Sporulation-estimated criteria and inhibition assay were according to Molan et al. (2009) with some modifications. Briefly, unsporulated oocysts were prepared as a stock solution (5,000 oocysts/mL), from which 200 μL was added to wells of a 48-well plate, and TPE was added to give a final concentration of 50 µg/mL. The commercial anticoccidial drug amprolium (final concentration 125 μg/mL) (China Chemicals and Pharmaceutical, Taiwan) and PBS were used as reference and vehicle controls, respectively. All inhibition assays were performed in triplicate. The plates were incubated at room temperature with gentle shaking for 48 h. After that, the percentage of sporulation in total oocysts was calculated by using the McMaster egg counting technique.

Cell Viability Assay

The cell viability of tested cells was evaluated according to the method reported by Mosmann (1983). Confluent MDBK cells in 96-well plates were treated with the indicated concentrations of plant extract, compound, or amprolium and incubated at 37℃ in 5% CO2 for 72 h. After that, 25 μL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) reaction reagent (5 mg/mL of stock, Sigma, Germany) was added into each well and incubated for 4 h. The precipitated formazan crystals were dissolved in 100 μL of DMSO (Sigma, France) for 1 min at 37℃. The absorption value of dissolved purple formazan in each assay was recorded using a SPECTROstar Nano spectrophotometer (BMG Labtech, Germany) at 570 nm. Cell survival after treatment was calculated by following formula: viable cell number (%) = OD570 of treated cell culture/OD570 of vehicle control × 100. All assays were performed in quadruplicate.

Sporozoite Invasion and Reproduction Inhibition Assay in MDBK Cells

Sporozoites of E. tenella were used as a model for estimating the invasion and reproduction inhibition activity of TP extract and the two derived compounds, sissotrin and ononin (Taha et al., 2021). Amprolium was used as a reference control, and PBS was used as a vehicle control. Each experiment was performed in quadruplicate. The concentrations of TPE, sissotrin, ononin, and amprolium used in this study were 60 μg/mL, 5 μg/mL, 5 μg/mL, and 125 μg/mL, respectively, which were pre-confirmed to be non-toxic to MDBK cells by cell viability assay. Three experimental models were used, as described below:

Model 1: Pretreated-Sporozoite Invasion Activity Assay. E. tenella sporozoites were pre-incubated with TPE, sissotrin, ononin, amprolium, or PBS at 37℃ for 4 h. The treated sporozoites were collected by centrifugation and washed 3 times with sterile PBS before resuspension in DMEM with 2% FBS. For sporozoite invasion activity assay, MDBK cells were seeded in 96-well plates at a density of 5 × 104 cells/well in growth medium. After incubation for 24 h, the confluent cells were inoculated with pre-treated sporozoites at MOI 0.1 and incubated at 37℃ in 5% CO2. Twenty-four hours postinfection (hpi), the infected cells were washed once with sterile PBS, and fresh medium was added for continued 24 h incubation. At 48 hpi, the cells were trypsinized by 0.25% Trypsin-EDTA (Gibco, Grand Island, NY) and washed twice with sterile PBS. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Germany) following the manufacturer's instructions.

Model 2: Infection Activity in Pre-Exposure Cells. MDBK cells seeded in 96-well plates were first treated with TPE, sissotrin, ononin, amprolium, or PBS before sporozoite infection. After incubation at 37℃ in 5% CO2 for 2 h, the cells were washed with sterile PBS 3 times to rinse out the extracts. After being replenished with fresh growth medium, the cells were infected with fresh sporozoites at MOI 0.1 and incubated for 48 h. Then, the cells were collected after washing with PBS 3 times and trypsinized. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Germany) following the manufacturer's instructions.

Model 3: Infection Activity in Post-Exposure Cells. After co-cultivation of MDBK cells and sporozoites at MOI 0.1 for 6 h at 37℃ in 5% CO2, the culture media in wells were replaced with fresh medium containing TPE, sissotrin, ononin, amprolium, or PBS for 4 h. After incubation, the cells were washed 3 times with sterile PBS and cultured in fresh medium for 38 h. Then, the cells were collected after washing with PBS 3 times and trypsinized. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Germany) following the manufacturer's instructions.

Quantification of Sporozoites in MDBK Cells

Eimeria tenella sporozoites in MDBK cells were determined by absolute quantification of sporozoite genomic DNA copies by real-time PCR assay with the standard curve established from the model plasmid. The model plasmid included was the E. tenella gene qEt from the internal transcribed spacer 1, which was chosen as the target gene and amplified with primers qEt-F: TGGAGGGGATTATGAGAGGA and qEt-R: CAAGCAGCATGTAACGGAGA and KAPA HiFi HotStart ReadyMix kit (Roche, Switzerland) by conventional PCR method to produce 147-bp gene fragment (Kawahara et al., 2008). The resulting fragment was purified by FavorPrep Gel purification kit (Favorgen, Taiwan) and subcloned into T-vector by T-A cloning kit (Yeastern Biotech, Taiwan) to generate a model plasmid designated pTA-qET. Blue-white screening was performed to select the plasmid-transformed ECOS 101 DH5a competent cells (Yeastern Biotech, Taiwan). The plasmid DNAs were extracted using the Plasmid Miniprep Purification Kit (GeneMark, Taiwan), and the concentrations of plasmid DNAs were measured by EzDrop 1000 (Blue-ray Biotech, Taiwan). The plasmid DNA sequence was confirmed by Sanger's sequencing method and BLAST sequence alignment analysis.

Lightcycler 480 II system (Roche, Switzerland) was used for quantitative real-time PCR assay. The total 20 μL of the reaction mixture consisted of 10 μL SYBR Fast qPCR 2× Master Mix (KAPA Biosystems), 0.4 μL qEt-F (10 μM stock), 0.4 μL qEt-R (10 μM stock), 1 μL template DNA and 8.2 μL PCR-grade water. The thermal cycling condition of the RT-PCR reaction was conducted as described below: 3 min at 95℃, followed by 40 cycles of 10 s at 95℃, 20 s at 62℃, and 1 s at 72℃. The dissociation curve was created by applying the melting curve program of a system involving a temperature range from 61 to 95℃. Serial dilutions of model plasmid DNA from 10−1 to 10−5-fold were applied as templates with the same real-time PCR conditions to generate a quantified standard curve.

In Vivo Trials of Anticoccidial Activity

The in vivo trials were designed and performed following the relevant guidelines and regulations laid out by the Institutional Animal Care and Use Committee of National Pingtung University of Science and Technology of Taiwan, with the authorization numbers #NPUST-111-067 and #NPUST-110-062. Three independent in vivo experiments were conducted to analyze the anticoccidial activity of herbal extracts against E. acervulina, E. tenella and E. maxima, respectively. Briefly, in each trial, a total of 72 one-day-old Leghorn male chicks were randomly divided into 6 treatment groups with 4 replicated cages of 3 birds each. Negative control (unmedicated, unchallenged control, UUC) and infection control (unmedicated, challenged control, UCC) birds were fed standard chicken diets without any additives. Birds in the reference group were fed basal diets containing 125 ppm amprolium (AMP125). The other 3 groups of birds received basal chicken diets containing 500 ppm or 1,000 ppm of TP (TP500, TP1000), or 100 ppm of TPE (TPE100). All chickens had access to feed and water ad libitum during the experimental period. Chickens of all groups except the UUC group were orally challenged with purified sporulated oocysts at 3 wk of age. Experiment 1 was challenge with 1 × 105 oocysts of E. acervulina per chick, experiment 2 was challenge with 2 × 104 oocysts of E. tenella per chick, and experiment 3 was challenge with 2.5 × 104 oocysts of E. maxima per chick. The body weight of each chicken was recorded on the day of the challenge and the day of sacrifice to evaluate growth rates by calculating the percentage of relative body weight gain before and after the challenge. The survival rates were observed after oocyst inoculation until sacrifice. Chicken feces from each cage were collected at d 5 postinfection for E. acervulina, or at d 6 postinfection for E. tenella and E. maxima. Fecal oocyst numbers for the relevant groups were expressed as oocysts per gram of feces (OPG) obtained by the McMaster egg counting technique. All birds were sacrificed at 4 wk of age (the 7th d after challenge). On the day of animal sacrifice, serum samples were collected for primary metabolome analysis, and gut samples were collected to assess lesions and scored following the index descriptions in Johnson and Reid (1970).

Data Analysis

The dataset obtained in the in vitro experiments, including percentage in oocyst sporulation inhibition assay and genome copy numbers in the sporozoite invasion and reproduction inhibition assays, was presented as the median values and box plots. The sporulation percentage values of each group were obtained through calculation with the formula: sporulation rate (%) = 100 × (sporulating oocysts/total number of counted oocysts).

The experimental data from the in vivo trials were expressed as the anticoccidial Index (ACI) and box plots. The ACI was utilized to determine the anticoccidial efficacy of TP/TPE by calculating the experimental parameters recorded from in vivo trials following a previously described formula (McManus et al., 1968). The ACI of each group = % SR + % RWG – (10 × LS + 0.4 × ROPG), where SR is survival rate, and RWG is relative weight gain between the trial group and the UUC group. The RWG was calculated using the formula: RWG (%) = 100 × (average body weight gain of treated group/average body weight gain of UUC group). The LS is average lesion score of each group, and ROPG is relative OPG obtained between the trial group and the UCC group, ROPG = (average of OPG of treated group/average of OPG of UCC group) × 100.

Statistical analyses were conducted by SPSS Software v. 22.0 (IBM, Armonk, New York), using the Kruskal–Wallis test for intragroup statistics followed by the post-hoc Dunn's multiple comparisons test. Statistical significance was defined as a P value of less than 0.05.

Primary Metabolome Analysis of Chicken Serum

The serum samples (50 μL each) from tested chickens were mixed with 80% methanol-containing ribitol (0.2 mg/mL) as an internal standard with vigorous vortexing; then the samples were put in liquid nitrogen for 10 min. The protocol was repeated 3 times to thoroughly remove the protein fraction. After centrifuging at 12,000 × g for 10 min at 4°C, the supernatants were collected and dried in a vacuum by SpeedVac (Labconco, Kansas, Missouri). The dried analytes were incubated with 20 μl methoxyamine (20 mg/mL in pyridine) at 30°C for 90 min for reaction and then derivatized with 100 μL N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1% trimethylchloro-silane (TMCS) at 70°C for 120 min.

The primary metabolome of chicken serum samples from the UUC, UCC, AMP, and TP groups were performed by gas chromatography/quadrupole time-of-flight (GC/Q-TOF) mass spectrometer (Agilent Technologies, Santa Clara, California) at the Metabolomics Core Facility of the Agricultural Biotechnology Research Center, Academia Sinica, Taiwan. The derivatized samples (0.5 μL) were injected with helium as the carrier gas flow at 1 mL/min into an Agilent J&W DB-5ms column (30 m × 250 μm × 0.25 μm). The GC oven temperature ramp was maintained at 60°C for 1 min, then elevated to 325°C (10°C/min) and held constant for 10 min. The mass range was 50-600 Da, and the data were gathered in full scan mode. Mass spectra were compared against the NIST Chemistry WebBook (National Institute of Standard and Technology) and PubChem (National Center for Biotechnology Information). Peak heights of the mass (mass-to-charge ratio) fragments were normalized to each sample's internal standard (ribitol).

RESULTS AND DISCUSSION

Chemical Profile of T. pratense Extract

The HPLC chromatogram of T. pratense ethanolic extract at 254 nm is shown in Figure 1. Four major peaks were identified as ononin 1) (Lewis et al., 1998), sissotrin 2) (Lewis et al., 1998), formononetin 3) (Aly et al., 2020), and biochanin A 4) (Wang et al., 2019), respectively, based on our data of MS and 1H NMR spectrometry analyses and compared to the published references. The HPLC profile and the 4 index compounds were used to ensure the batch-to-batch consistency of the TP plant and extracts in the supplementation feeds.

Figure 1.

Figure 1

Open in a new tab

HPLC chromatogram of Trifolium pratense ethanolic extract at 254 nm. Compound identification: 1) ononin (17.28 min), 2) sissotrin (26.18 min), 3) formononetin (38.70 min), 4) biochanin A (43.94 min).

T. pratense Extract Inhibited Oocyst Sporulation of 3 Eimeria Species

First, the anticoccidial activity of TPE was evaluated using oocyst sporulation inhibition assay. The commercial anticoccidial drug amprolium was used as a reference control. The sporulation levels of oocysts with 50 μg/mL of TPE treatment are presented as percentage values in Table 1. TPE treatment of E. acervulina and E. maxima oocysts had significantly lower sporulation activity compared to the PBS control group (P = 0.004 and P = 0.002). After TPE treatment, E. tenella oocysts exhibited the highest sporulation rates (Median: 91.9%), representing the lowest sporulation inhibition activity, indicating distinct sensitivities among coccidians to TPE treatment. Such a discrepancy in sporulation levels between the tested Eimeria spp. might be due to the composition of oocyst walls, which play a role in mediating the entry of TPE eventually interfering with the sensitivity to TPE (Belli et al., 2009; Mai et al., 2009).

Table 1.

In vitro effects of TPE on Eimeria oocyst sporulation.

Groups E. acervulina oocysts E. tenella oocysts E. maxima oocysts
Median (%) Median (%) Median (%)
PBS 82.9a 92.0a 62.2a
AMP125 79.4ab 85.7b 43.6ab
TPE50 72.8b 91.9ab 18b
Open in a new tab

The tests were performed in triplicate. Statistical differentiation was conducted by Kruskal–Wallis test and Dunn's post hoc multiple comparison test. Numbers with different letters in the same column represent significant differences (P < 0.05).

T. pratense Extract Inhibited Sporozoite Invasion and Reproduction of E. tenella

The effects of TPE and the sissotrin and ononin compounds on the inhibition of E. tenella sporozoite invasion and reproduction were investigated using three models. The first and second models were used to mimic the initial stage of coccidian infection using 2 prophylactic approaches, pre-exposure to sporozoites (Model 1) and cells (Model 2), respectively. In addition, a third model (Model 3) was used to reveal the therapeutic mechanism by stimulating the reproduction stage of coccidian after sporozoites entered target cells (Thabet et al., 2015; Marugan-Hernandez et al., 2020). The invasion and reproduction capability was determined according to the decrease in genome copies retained in cells in the treated groups compared with control groups through quantitative real-time PCR. As shown in Figure 2, under the 3 different model analyses, TPE (60 μg/mL) showed suppression of sporozoites of E. tenella compared to the vehicle control. Using the Kruskal–Wallis test followed by Dunn's post-hoc test for multiple comparisons, TPE revealed significant reproduction inhibition activity in Model 2 (P = 0.00) and Model 3 (P = 0.00) simulative of the prophylactic and therapeutic approach (Figures 2B and 2C). Both sissotrin and ononin also reduced sporozoite production. Sissotrin (P = 0.005) and ononin (P = 0.000) in Model 1, and sissotrin (P = 0.048) in Model 3 showed biological and statistical significance in reduction of sporozoites compared to the vehicle control, indicating that both compounds have sporozoite-cidal effects by directly alleviating the ability of sporozoites to invade or infect cells. The reference control, amprolium, at 125 μg/mL, showed significant effects in Model 1, 2 and 3 assays (Figure 2). These results indicated that sissotrin and ononin are the two bioactive compounds responsible for the anticoccidial effect of TPE which had similar anticoccidial properties to the commercial drug amprolium. In summary, TPE has prophylactic properties before coccidial infection and is a therapeutic after coccidial infection.

Figure 2.

Figure 2

Open in a new tab

Effects of TPE treatment on the activities of E. tenella sporozoite infection. The genome copy numbers of sporozoites were quantified by real-time PCR using three study models: pretreated-sprozoite invasion activity assay (A), infection activity in pre-exposure cells (B), and infection activity in postexposure cells (C). These models were used as indicators for evaluating the efficiency of tested extracts in reducing the sporozoite infection in MDBK cells. All experimental data are presented as box plots. Assays were performed in quadruplicate and statistical differentiation was calculated by intragroup comparing the non-treated group (vehicle), the amprolium at 125μg/mL (AMP125) group, and the TPE 60 μg/mL treated group (TPE60) through Kruskal–Wallis test and Dunn's Multiple Comparison post hoc tests. Statistically significant effects are marked with asterisks (*, P < 0.05).

TP and TPE Exhibited Significant Anticoccidial Effects in Vivo

The in vivo effects of TP500, TP1000 and TPE100 compared to AMP125 were measured in E. acervulina, E. tenella, and E. maxima infected chickens. All chickens treated in this study survived the trial period. The measurements of relative weight gain percentage before and after E. acervulina infection showed that the TP/TPE treatment groups had more effect than the UCC group (Figure 3A), and the E. tenella-infected chicken group also showed similar results, except for the TP-1000 treatment, which resulted in a slightly lower weight gain than the UCC group (Figure 3B). Both groups were statistically significantly different, with P < 0.05 for E. acervulina-infected chickens and P < 0.01 for the E. tenella-infected chickens. None of the TP/TPE treatments showed a statistical non-difference compared to the reference group (AMP125), indicating that their effects were equivalent to a commercial coccidicide, although they were unable to achieve a level of weight gain similar to the UUC group. In E. maxima-infected chickens, the percentage of relative body weight gain before and after the challenge in the UUC, UCC, and treated groups did not show statistical differences (Figure 3C). Overall, the observations indicate that Trifolium pratense can partially effectively alleviate the phenomenon of weight loss caused by infection with both E. acervulina and E. tenella in chickens.

Figure 3.

Figure 3

Open in a new tab

The relative percentage of body weight gain before and after chickens were challenged with E. acervulina (A) E. tenella (B) and E. maxima (C) and underwent AMP, TP and TPE treatments. N = 12 animals per group. All values are presented as box plots and Kruskal–Wallis test and Dunn's Multiple Comparison post hoc test were performed to determine the statistical differences between the unmedicated non-challenged group (UUC), unmedicated challenged group (UCC), reference group (AMP 125 ppm) and treatment groups (TP 500 ppm, TP 1,000 ppm and TPE 100 ppm). Statistically significant effects are marked with asterisks (*, P < 0.05).

The results of the lesion score obtained 5- or 6-d postinoculation with Eimeria spp. without or with treatment are shown in Figure 4. For the E. acervulina-infected groups, chickens treated with AMP 125 ppm, TP 500 ppm, TP 1,000 ppm or TPE 100 ppm all showed significantly fewer lesions compared to the unmedicated control (P < 0.05) (Figure 4A). TPE100 had a larger effect than AMP125 (P = 0.046). E. tenella-infected groups presented similar lesion reduction results in the AMP125, TP500, and TP1000 groups (Figure 4B), but the TPE100 treatment groups showed no significant difference from the UCC control group. For the E. maxima-infected groups, TP500, TP1000, and TPE100 all showed a significant inhibitory effect, whereas AMP125 did not show a positive effect (Figure 4C). TP and TPE treatments had favorable gut protective activity against tested coccidia.

Figure 4.

Figure 4

Open in a new tab

The lesion score reduction of coccidia-infected chickens after treatment with AMP, TP or TPE at the indicated doses. All birds were sacrificed on the 7th d postchallenge, and the gut tissue samples were obtained for scoring based on the lesion index of particular Eimeria spp. N = 12 animals per group. The variations in lesion scores of chickens challenged with E. acervulina (A) E. tenella (B) and E. maxima (C) are presented as a box plot. Kruskal–Wallis test and Dunn's Multiple Comparison post hoc test were performed to determine the statistical differentiation of the non-medicated challenged group (UCC), the reference group (AMP 125 ppm) and the treatment groups (TP 500 ppm, TP 1,000 ppm and TPE 100 ppm). Statistically significant effects are marked with asterisks (*, P < 0.05).

The effects of TP and TPE on the suppression of oocyst development after coccidian inoculation were monitored. The output of OPG at d 5 or 6 postinfection with E. acervulina, E. tenella, or E. maxima were obtained by the McMaster egg counting method. The decrease in OPG in the TP500, TP1000, and TPE100 treatment groups were all greater than that of the AMP125 group in the three types of Eimeria species-infected chickens (Figure 5). These results are in good agreement with the lower lesion scores shown in Figure 4. Taken together, all of TP or TPE additives used as feed supplements for the treatment of coccidian obviously improved the outcome of oocyst shedding and also exhibited better inhibition of oocyst development than the reference group, AMP125.

Figure 5.

Figure 5

Open in a new tab

Effects of TP and TPE on suppression of oocyst development after coccidian inoculation. The output of OPG on d 5 postinfection with E. acervulina (A), and d 6 postinfection with E. tenella (B), and E. maxima (C) were obtained by the McMaster egg counting method and presented as a box plot. N = 4 cages of fecal samples per group. Kruskal–Wallis test and Dunn's post hoc multiple comparison test were performed to determine the statistical differentiation of the nonmedicated challenged group (UCC), the reference group (AMP 125 ppm), and the treatment groups (TP 500 ppm, TP 1,000 ppm and TPE 100 ppm). Significant effects are marked with asterisks (*, P < 0.05).

The anticoccidial index (ACI) was first constructed to evaluate the drug resistance of particular coccidia. It has subsequently become one of the most popular criteria for assessment of the anticoccidial activity of putative additives in livestock research (McManus et al., 1968; Pablos et al., 2010; Ojimelukwe et al., 2018; Pop et al., 2019). The effects of supplementing TP in the diets of chickens after challenge with coccidia were established through ACI calculations considering 4 factors; survival rates, relative weight gain, lesion score, and relative OPG output. The ACI scores of each trial group are presented in Table 2. The putative anticoccidial activity of TP against all the tested Eimeria strains was revealed based on the ACI criteria (Qaid et al., 2021). TP or TPE treatment had a better ACI than that of AMP treatment. Furthermore, TP/TPE showed very significant coccidicidal properties against E. maxima (with ACI 156-179) and E. tenella challenge (with ACI 150∼168) in chickens, and moderated the anticoccidial effect (with ACI 141 to 143) on infection with E. acervulina. However, the UCC group infected with E. maxima had a relatively higher ACE score of 130, which fell into the range (120–140) defined as having partial anticoccidial capability. One possible reason was that E. maxima has a lower virulence than E. tenella and E. acervuline, which might have resulted in no significant difference in relative weight gain in the E. maxima challenge UUC group; therefore the calculated ACI score is relatively higher than those in other UUC groups (Table 2).

Table 2.

Effects of TP and TPE treatments on the anticoccidial index (ACI) of chickens challenged with coccidian.

Groups ACI of E. acervulina ACI of E. tenella ACI of E. maxima
UCC 98 112 130
AMP125 133 132 143
TP500 143 168 179
TP1000 142 150 156
TPE100 141 160 179
Open in a new tab

An ACI score below 120 represents a lack of anticoccidial activity, 120 to 140 represents a partial effect, 140 to 160 represents a moderate effect and above 160 represents very effective anticoccidicidal activity.

In summary, if an ACI score of 120 is taken as the baseline for no anticoccidial activity, against the three different species of Eimeria, most of the TP or TPE treatments resulted in an increase in ACI score of more than 40 compared to their respective UCC group, indicating that TP and TPE possess moderate to very effective anticoccidial activity. These data indicate that the TP plant and its extract are novel phytogenics that possess broad-spectrum coccidicidal activity.

T. pratense Dietary Supplement Reprogrammed Primary Metabolism in Eimeria-Infected Chickens

The potential effect of TP supplementation on the primary metabolome in sera of chickens challenged with either E. tenella or E. acervulina was investigated using GC/Q-TOF MS. The E. maxima infected groups were not included in this primary metabolome analysis as the ACI of UCC control group was slightly high (up to 130; Table 2).

Multivariate partial least squares discriminant analysis (PLS-DA) was conducted on a total of 93 metabolites detected in the serum. Figures 6A and 6B show the score plot and loading plot of the overall primary metabolites in healthy (control) chickens and chickens infected with E. tenella and E. acervulina, respectively (vehicle). Both score plots revealed that control versus vehicle can be separated into two distinct groups. The loading plot further suggested that some metabolite outliers might have a biological or pathological role in chickens with E. tenella or E. acervulina infection. Furthermore, the fold-change of the metabolite content in control chickens (control) versus E. tenella or E. acervulina-challenged chickens (vehicle) were compared and the results are shown in the heat map in Figure 6C. The range of relative fold-change of metabolites was set between 0.2- and 4.0-fold. The metabolites identified were classified according to their chemical structures and functions, such as amino acids and their derivatives, carbohydrates, fatty acids, nucleotides, organic acids, sterols, urea cycle-related metabolites, and others (the metabolites did not belong to the aforementioned categories). In general, most of the levels of metabolites in chicken sera either declined or increased with E. tenella or E. acervulina infection, suggesting that coccidial infection with either species has an obvious impact on primary metabolism in chickens. In terms of the fold-change of the overall metabolite profiles and their relative levels in infected chickens compared to control (healthy) chickens, E. tenella infection had a higher impact on the primary metabolism of chickens than E. acervulina infection (Figure 6C). Of note, most proteinogenic amino acids, the building blocks of protein (with 0.2- to 0.7-fold decrease) and fatty acids (with 0.4- to 0.7-fold decrease) were significantly deregulated in E. tenella-infected chickens, a phenomenon which was not observed in the E. acervulina-infected chicken sera. In contrast, the levels of nucleotide metabolites, such as hypoxanthine, xanthine, inosine, and uracil involved in purine/pyrimidine metabolism were significantly raised (1.7-2.5−fold increase) in E. tenella-infected chicken sera, but not in E. acervulina-infected chickens. These results indicate that E. tenella infection negatively impacted the amino acid and fatty acid metabolisms in chickens. On the other hand, the levels of creatinine and urea in the E. tenella group, and ornithine, urea and allantoin in the E. acervulina group were significantly increased and accumulated, suggesting that the urea metabolism and kidney function of infected chickens might be dysregulated. Together, this metabolomic information partly supports the notion of a negative role for E. tenella as the most pathogenic intracellular protozoan parasite of the Eimeria species, causing cecal coccidiosis leading to serious morbidity and mortality in chickens.

Figure 6.

Figure 6

Open in a new tab

Effects on the primary metabolome in chickens challenged with E. tenella and E. acervulina, respectively. PLS-DA analysis of serum primary metabolome in healthy (control) chickens and chickens infected with E. tenella (vehicle) (A). PLS-DA analysis of serum primary metabolites in healthy (control) chickens and chickens infected with E. acervulina (vehicle) (B). The heat map shows the fold-change of the intensities of metabolites between the healthy group (control) and chickens infected with E. tenella or E. acervulina (vehicle) (C).

The serum primary metabolites of the vehicle were further compared with the AMP125 and TP500 treatment groups. The score plot and loading plot of E. tenella-challenged chicken serum metabolomes treated with vehicle, AMP, or TP are shown in Figures 7A and 7B. Separated group clusters and some corresponding substance outliers were observed, suggesting that AMP or TP treatment could affect primary metabolism in E. tenella-infected chickens. The heat map data of E. tenella infection (vehicle) was related to both the TP and AMP treatment groups (Figure 7B) showing that the levels of His, Ser and Tyr in the TP group and His, Ile, Lys, Tyr, and Val in the AMP group which declined in infected chickens (vehicle) were reversely increased after treatment. Notably, trans-4-hydroxy-L-proline, an important metabolite derived from the posttranslational modification of proline that revealed oxidant scavenging activity and stimulation of the expression of anti-oxidative enzymes in the cell (Zhang et al., 2021; Phang et al., 2010), was found decreased in chicken sera after E. tenella infection, but TP or AMP supplementation was able to elevate its level, suggesting that both treatments had a positive effect on preventing oxidative stress caused by E. tenella infection.

Figure 7.

Figure 7

Open in a new tab

Effect of dietary supplementation of TP on the primary metabolome in chickens challenged with E. tenella. Score and loading plots of the chicken serum metabolome in E. tenella challenged chickens with vehicle, amprolium (AMP125) (control), or TP500 treatment obtained by PLS-DA analysis (A). The heat map shows the fold-change of the intensities of metabolites between vehicle, AMP, and TP groups challenged with E. tenella (B).

Among the 10 carbohydrates detected, the increase in lyxose, mannitol, and pinitol levels in chicken sera upon E. tenella challenge could be decreased by AMP or TP treatment (Figures 6C and 7B). Threitol, a signaling metabolite involved in fungus-plant interaction (Wong et al., 2020) was induced (11-fold) by AMP in infected chickens; however, the reason for this increase is not clear. On the other hand, the reduced levels of arachidonic acid, oleamide, and oleic acid could be increased by AMP treatment (1.6-4.1−fold). TP had a negligible effect on fatty acids, except oleamide, which was increased 1.5-fold. Oleamide, an amide of oleic acid, has been reported to possess several biological effects, including anti-inflammation, immunomodulation, and anti-allergy activities among others (Moon et al., 2018; Naumoska et al., 2020). The significantly upregulated nucleotide-related metabolites in E. tenella-infected chickens were decreased or returned to normal levels after treatment, especially in the AMP group.

Allantoin increases in response to different stress conditions and environments (Li et al., 2022). The slight increase in allantoin in the E. tenella-infected group was decreased 0.6 to 0.7-fold in the TP/AMP-treated groups, implying that TP/AMP might attenuate coccidia infection-induced stresses in chickens. Creatinine is a waste product of muscles and is filtered by glomerular filtration in the kidneys. Therefore, a high level of creatinine in chicken sera can suggest renal dysfunction (Song et al., 2020). An increase in creatinine after E. tenella infection was partially reversed by AMP or TP treatment (Figure 7B). Moreover, TP treatment (0.4-fold) showed a more pronounced effect on attenuating urea levels than that of AMP (0.7-fold) in infected chickens, suggesting that TP treatment could protect kidneys damaged by E. tenella infection. Sialic acid (N-acetylneuraminic acid) residues linked to glycoproteins are found in the healthy cell membranes of many poultry and mammals (Freire-de-Lima et al., 2012). Sialidase (neuraminidase) is an enzyme that separates sialic acid from glycoproteins, thereby helping E. tenella to increase its ability to invade the host and use the carbon skeleton as an energy source (Schwerdtfeger et al., 2010). In the E. tenella-challenged group, the level of N-acetylneuraminic acids (sialic acids) significantly increased (1.7-fold) in comparison to that of the control group, and slightly decreased after AMP treatment, suggesting that AMP inhibits E. tenella invasion.

Primary metabolome analysis of E. acervulina-challenged chickens revealed that the vehicle, AMP, and TP-treated chicken metabolome can be separated into 3 distinct groups. Furthermore, the loading plot showed some outlier metabolites which might have a role in E. acervulina infection (Figure 8A). The heat maps revealed that most of the 23 amino acids or amino acid derivatives detected were increased (1.5−2.3-fold) after TP or AMP treatment (Figure 8B), suggesting amino acid metabolisms were boosted in infected chickens. In previous studies, E. acervulina-infected chickens showed a reduction in the absorption of methionine in the duodenum and jejunum (Ruff et al., 1976). Therefore, a lower serum methionine level under E. acervulina infection may suggest impaired absorption of dietary methionine. The level of methionine was increased (1.7−2.0-fold) in the AMP and TP groups (Figure 8B). Similar increased levels of tryptophan in both treatment groups were also observed compared to the infected group. Since tryptophan is an aromatic amino acid (AAA) that plays an important role in immune response regulation (Liu et al, 2021), while methionine is a key player in the oxidative stress response (Campbell et al., 2016), these data suggest that the TP and AMP supplementation have a positive impact in E. acervulina-challenged chickens. E. acervulina infection also led to some degree of decline in carbohydrates and fatty acids (Figure 6C). In previous studies, researchers identified the mannitol cycle as a metabolic pathway found in Eimeria species (Schmatz, 1997). This process allows parasites to use mannitol for their production and development (Schmatz, 1989). The level of mannitol in the E. acervulina-infected group decreased (0.7-fold) compared to the control group, and increased (3−4-fold) in the TP and AMP-treated groups, which might suggest TP/AMP inhibited mannitol digestion and, in turn, inhibited the expansion of E. acervulina.

Figure 8.

Figure 8

Open in a new tab

Effect of dietary supplementation of TP on the primary metabolome in chickens challenged with E. acervulina. Score and loading plots of chicken serum metabolome in E. acervulina-challenged chickens with vehicle, amprolium (AMP125) (control), or TP500 treatment obtained by PLS-DA analysis (A). The heat map shows the fold-change of the intensities of metabolites between vehicle, AMP, and TP supplementation challenged with E. acervulina (B).

The invasion of Eimeria species was observed to cause an imbalance in the gut microbial community (Ducatelle et al., 2015). The gastrointestinal gut microbiota of chickens provides a protective barrier against opportunistic bacteria. They also produce vitamins, fatty acids, and organic acids to contribute to the development of host cells (Madlala et al., 2021). In this study, the moderate decrease in fatty acid metabolism in the E. acervulina infection group could be enhanced in both treatment groups (Figures 6C and 8B). Organic acids have been shown to have multiple therapeutic effects on pathological disorders in poultry birds, such as anticoccidial, antiprotozoal, antimicrobial, and antifungal (Du et al., 2023). Supplementation of some types of organic acids, such as lactic acid, fumaric acid, formic acid, citric acid, butyric acid, and tartaric acid has been demonstrated to significantly improve the health status and production performance of chickens. Interestingly, we observed that TP and AMP could enhance the contents of organic acids including citric acid, fumaric acid, lactic acid and butanoic acid in E. acervulina-infected birds (Figure 8B). These data indicate that TP supplement is beneficial to the host against E. acervulina-infection.

To understand whether TP treatment could restore some metabolite levels in parasite-challenged chickens back to those of the control (healthy) chickens, we analyzed and compared the metabolic profiles of the control chickens versus E. tenella or E. acervuline-infected chickens, or versus infected chickens supplemented with T. pretense. We observed metabolites that were either elevated or decreased after E. tenella infection which could be restored by TP supplementation to levels close to those in control chickens. These metabolites included urea cycle metabolites (creatinine, ornithine, and urea), organic acids (2-aminomalonic acid, 2-hydroxybutyric acid, succinic acid, and 2,3,4-trihydroxybutyric acid), and other metabolites, such as glycine, serine and oleamide. TP supplementation also restored the levels of many forms of fatty acids, organic acids, urea cycle metabolites, etc. in E. acervuline-infected chickens back to those in control chickens. Particularly, the toxic metabolite, urea, was found accumulated in E. tenella- and E. acervuline-infected groups and TP could reduce its levels in parasite-challenged chickens to close to the healthy control group level, indicating the beneficial or detoxification effect of TP supplementation (Al-Zharani et al., 2023). We also noticed the level of trans-4-hydroxy-L-proline, which possesses oxidant scavenging activity, was decreased in E. tenella- and E. acervuline-infected groups, and TP supplementation could significantly increase its level, suggesting TP treatment may prevent oxidative stress in chickens caused by Eimeria infection.

In summary, in the metabolomics study, we observed that the 2 different species of Eimeria infection exhibited different degrees of effect on the metabolite profiles in respective chickens, and the impact of TP supplementation on the two infected chicken models was different. Since Eimeria infection is a serious coccidian disease in chickens affecting the host animal's GI system and metabolism significantly, it is unlikely the levels of overall metabolites in TP-treated chickens could be completely reversed or restored back to the healthy chicken statuses. Nevertheless, TP indeed had positive effects on the primary metabolism of infected chickens.

In conclusion, both E. tenella and E. acervulina infections lead to a disruption in most of the detected primary metabolites in chicken sera involved in different metabolic or pathogenic pathways. TP supplementation had an obvious and positive impact on the primary metabolism of chickens under the stress induced by E. tenella and E. acervulina infection in chickens. This study provides strong evidence to support the novel effect of Trifolium pratense and its extracts in control of coccidiosis caused by E. acervulina, E. tenella and E. maxima, and also illuminates the underlying mechanisms by which this effect takes place. We suggest that Trifolium pratense and its extracts may be applied as phytogenic additives in the poultry industry.

DISCLOSURES

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Lie-Fen Shyur reports financial support was provided by Ministry of Economic Affairs. Lie-Fen Shyur reports a relationship with Academia Sinica, Taiwan that includes: non-financial support. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

The authors would like to thank Ms. Miranda Loney of the ABRC English Editor's Office, Academia Sinica, Taiwan, for English editorial assistance, the Metabolomics Core Facility of Agricultural Biotechnology Research Center, Academia Sinica, Taiwan for GC/MS analysis, and Ms. Minh Tuyet Thi Nguyen for technical assistance. This research was funded by the Ministry of Economic Affairs (112-1401-04-27-06 and 113-1401-04-30-02) and Academia Sinica, Taiwan.

REFERENCES

  1. Aly S.H., Elissawy A.M., Fayez A.M., Eldahshan O.A., Elshanawany M.A., Singab A.N.B. Neuroprotective effects of Sophora secundiflora, Sophora tomentosa leaves and formononetin on scopolamine-induced dementia. Nat. Prod. Res. 2020;35:5848–5852. doi: 10.1080/14786419.2020.1795853. [DOI] [PubMed] [Google Scholar]
  2. Al-Zharani M., Mubarak M., Rudayni H.A., Abdelwahab M.M., Al-Eissa M. Intoxication induced by urea containing diets in broiler chickens: effect on weight gain, feed conversion ratio, hematological and biochemical profiles. Adv. Biosci. Biotechnol. 2023;14:106–119. [Google Scholar]
  3. Baba E., Ikemoto T., Fukata T., Sasai K., Arakawa A., McDougald L.R. Clostridial population and the intestinal lesions in chickens infected with Clostridium perfringens and Eimeria necatrix. Vet. Microbiol. 1997;54:301–308. doi: 10.1016/s0378-1135(96)01289-8. [DOI] [PubMed] [Google Scholar]
  4. Belli S.I., Ferguson D.J.P., Katrib M., Slapetova I., Mai K., Slapeta J., Flowers S.A., Miska K.B., Tomley F.M., Shirley M.W., Wallach M.G., Smith N.C. Conservation of proteins involved in oocyst wall formation in Eimeria maxima, Eimeria tenella and Eimeria acervulina. Int. J. Parasitol. 2009;39:1063–1070. doi: 10.1016/j.ijpara.2009.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Blake D.P., Knox J., Dehaeck B., Huntington B., Rathinam T., Ravipati V., Ayoade S., Gilbert W., Adebambo A.O., Jatau I.D., Raman M., Parker D., Rushton J., Tomley F.M. Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020;51:1–14. doi: 10.1186/s13567-020-00837-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Booth N.L., Overk C.R., Yao P., Burdette J.E., Nikolic D., Chen S.N., Bolton J.L., Breemen R.B.V., Pauli G.F., Farnsworth N.R. The chemical and biologic profile of a red clover (Trifolium pratense L.) phase II clinical extract. J. Altern. Complement. Med. 2006;12:133–139. doi: 10.1089/acm.2006.12.133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Campbell K., Vowinckel J., Keller M.A., Ralser M. Methionine metabolism alters oxidative stress resistance via the pentose phosphate pathway. Antioxid. Redox. Signal. 2016;24:543–547. doi: 10.1089/ars.2015.6516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Deplazes P., Eckert J., Mathis A., Von Samson-Himmelstjerna G., Zahner H. 1st ed. Wageningen Academic Publishers; 2016. Parasitology in Veterinary Medicine. [Google Scholar]
  9. Du H., Sarwar I., Ahmad S., Suheryani I., Anjum S., Andlib S., Kakar M.U., Arain M.A. Organic acids in poultry industry: a review of nutritional advancements and health benefits. World’s Poult. Sci. J. 2023;80:133–153. [Google Scholar]
  10. Ducatelle R., Eeckhaut V., Haesebrouck F., Immerseel F.V. A review on prebiotics and probiotics for the control of dysbiosis: present status and future perspectives. Animal. 2015;9:43–48. doi: 10.1017/S1751731114002584. [DOI] [PubMed] [Google Scholar]
  11. El-Shall N.A., Abd El-Hack M.E., Albaqami N.M., Khafaga A.F., Taha A.E., Swelum A.A., El-Saadony M.T., Salem H.M., El-Tahan A.M., AbuQamar S.F., El-Tarabily K.A., Elbestawy A.R. Phytochemical control of poultry coccidiosis: a review. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Freire-de-Lima L., Oliveira I.A., Neves J.L., Penha L.L., Alisson-Silva F., Dias W.B., Todeschini A.R. Sialic acid: a sweet swing between mammalian host and Trypanosoma cruzi. Front. Immunol. 2012;3:356. doi: 10.3389/fimmu.2012.00356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Huang G., Tang X., Bi F., Hao Z., Han Z., Suo J., Zhang S., Wang S., Duan C., Yu Z., Yu F., Yu Y., Lv Y., Suo X., Liu X. Eimeria tenella infection perturbs the chicken gut microbiota from the onset of oocyst shedding. Vet. Parasitol. 2018;258:30–37. doi: 10.1016/j.vetpar.2018.06.005. [DOI] [PubMed] [Google Scholar]
  14. Johnson J., Reid W.M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970;28:30–36. doi: 10.1016/0014-4894(70)90063-9. [DOI] [PubMed] [Google Scholar]
  15. Kawahara F., Taira K., Nagai S., Onaga H., Onuma M., Nunoya T. Detection of five avian Eimeria species by species-specific real-time polymerase chain reaction assay. Avian. Dis. 2008;52:652–656. doi: 10.1637/8351-050908-Reg.1. [DOI] [PubMed] [Google Scholar]
  16. Lee Y., Lu M., Lillehoj H.S. Coccidiosis: recent progress in host immunity and alternatives to antibiotic strategies. Vaccines. 2022;10:215. doi: 10.3390/vaccines10020215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lewis P., Kaltia S., Wähälä K. The phase transfer catalysed synthesis of isoflavone-O-glucosides. J. Chem. Soc., Perkin Trans. 1. 1998;16:2481–2484. [Google Scholar]
  18. Li X., Jiang X.J., Qi D.X., Wang X.Y., Wang C.M., Fei C.Z., Zhou W., Li J., Zhang K.Y. Effects of ethanamizuril, sulfachlorpyridazine or their combination on cecum microbial community and metabolomics in chickens infected with Eimeria tenella. Microb. Pathog. 2022;173 doi: 10.1016/j.micpath.2022.105823. [DOI] [PubMed] [Google Scholar]
  19. Lien Y.Y., Sheu S.C., Liu H.J., Chen S.C., Tsai M.Y., Luo S.C., Wu K.C., Liu S.S., Su H.Y. Cloning and nucleotide sequencing of the second internal transcribed spacer of ribosomal DNA for three species of Eimeria from chickens in Taiwan. Vet. J. 2007;173:184–189. doi: 10.1016/j.tvjl.2005.09.017. [DOI] [PubMed] [Google Scholar]
  20. Liu B.H., Ma X.T., Cai J.P. Construction and analysis of coexpression network to understand biological responses in chickens infected by Eimeria tenella. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.688684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Madlala T., Okpeku M., Adeleke M.A. Understanding the interactions between Eimeria infection and gut microbiota, towards the control of chicken coccidiosis: a review. Parasite. 2021;28:48. doi: 10.1051/parasite/2021047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mai K., Sharman P.A., Walker R.A., Katrib M., De Souza D., McConville M.J., Wallach M.G., Belli S.I., Ferguson D.J.P., Smith N.C. Oocyst wall formation and composition in coccidian parasites. Mem. Inst. Oswaldo Cruz. 2009;104:281–289. doi: 10.1590/s0074-02762009000200022. [DOI] [PubMed] [Google Scholar]
  23. Marugan-Hernandez V., Jeremiah G., Aguiar-Martins K., Burrell A., Vaughan S., Xia D., Randle N., Tomley F. The growth of Eimeria tenella: characterization and application of quantitative methods to assess sporozoites invasion and endogenous development in cell culture. Front. Cell. Infect. Microbiol. 2020;10 doi: 10.3389/fcimb.2020.579833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. McManus E.C., Campbell W.C., Cuckler A.C. Development of resistance to quinoline coccidiostats under field and laboratory conditions. J. Parasitol. 1968;54:1190–1193. [PubMed] [Google Scholar]
  25. Molan A.L., Liu Z., De S. Effect of pine bark (Pinus radiata) extracts on sporulation of coccidian oocysts. Folia. Parasitol. 2009;56:1–5. doi: 10.14411/fp.2009.001. [DOI] [PubMed] [Google Scholar]
  26. Moon S.M., Lee S.A., Hong J.H., Kim J.S., Kim D.K., Kim C.S. Oleamide suppresses inflammatory responses in LPS-induced RAW264.7 murine macrophages and alleviates paw edema in a carrageenan-induced inflammatory rat model. Int. Immunopharmacol. 2018;56:179–185. doi: 10.1016/j.intimp.2018.01.032. [DOI] [PubMed] [Google Scholar]
  27. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods. 1983;65:55–63. doi: 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
  28. Muthamilselvan T., Kuo T.F., Wu Y.C., Yang W.C. Herbal remedies for coccidosis control: a review of plants, compounds, and anticoccidial actions. Evid. Based. Complement. Alternat. Med. 2016;2016 doi: 10.1155/2016/2657981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Naumoska K., Jug U., Metliˇcar V., Vovk I. Oleamide, a bioactive compound, unwittingly introduced into the human body through some plastic food/beverages and medicine containers. Foods. 2020;9:549. doi: 10.3390/foods9050549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ojimelukwe A.E., Emedhem D.E., Agu G.O., Nduka F.O., Abah A.E. Populations of Eimeria tenella express resistance to commonly used anticoccidial drugs in southern Nigeria. Int. J. Vet. Sci. Med. 2018;6:192–200. doi: 10.1016/j.ijvsm.2018.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pablos L.M.D., Dos Santos M.F.B., Montero E., Garcia-G A., Parra A., Osuna A. Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens. Parasitol. Res. 2010;107:601–604. doi: 10.1007/s00436-010-1901-3. [DOI] [PubMed] [Google Scholar]
  32. Phang J.M., Wei L., Zabirnyk O. Proline metabolism and microenvironmental stress. Annu. Rev. Nutr. 2010;30:441. doi: 10.1146/annurev.nutr.012809.104638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Pop M.L., Varga E., Coroian M., Nedisan M.E., Mircean V., Dumitrache M.O., Farczadi L., Fulop I., Croitoru M.D., Fazakas M., Gyorke A. Efficacy of a commercial herbal formula in chicken experimental coccidiosis. Parasit. Vectors. 2019;12:343. doi: 10.1186/s13071-019-3595-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Qaid M.M., Al-Mufarrej S.I., Azzam M.M., Al-Garadi M.A., Albaadani H.H., Alhidary I.A., Aljumaah R.S. Anti-coccidial effect of Rumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. Animals. 2021;11:167–183. doi: 10.3390/ani11010167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ruff M.D., Witlock D.R., Smith R.R. Eimeria acervulina and E. tenella: Effect on methionine absorption by the avian intestine. Exp. Parasitol. 1976;39:244–251. doi: 10.1016/0014-4894(76)90124-7. [DOI] [PubMed] [Google Scholar]
  36. Schmatz D.M. The mannitol cycle in Eimeria. Parasitology. 1997;114:81–89. [PubMed] [Google Scholar]
  37. Schmatz D.M. The mannitol cycle-a new metabolic pathway in the coccidian. Parasitol. Today. 1989;5:205–208. doi: 10.1016/0169-4758(89)90268-8. [DOI] [PubMed] [Google Scholar]
  38. Schwerdtfeger S.M., Melzig M.F. Sialidases in biological systems. Pharmazie. 2010;65:551–561. doi: 10.1002/chin.201047267. [DOI] [PubMed] [Google Scholar]
  39. Shane S.M., Gyimah J.E., Harrington K.S., Snider T.G., 3rd Etiology and pathogenesis of necrotic enteritis. Vet. Res. Commun. 1985;9:269–287. doi: 10.1007/BF02215151. [DOI] [PubMed] [Google Scholar]
  40. Song X., Li Y.H., Chen S.F., Jia R.Y., Huang Y.Y., Zou Y.F., Li L.X., Zhao X.X., Yin Z.Q. Anticoccidial effect of herbal powder "Shi ying zi" in chickens infected with Eimeria tenella. Animals (Basel) 2020;10:1484. doi: 10.3390/ani10091484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Taha S., Nguyen-Ho-Bao T., Daugschies A., Renteria-Solis Z. In vitro infection of Madin-Darby bovine kidney (MDBK) cells with Eimeria acervulina sporozoites: quantitative analysis of parasite cellular invasion and replication using real-time polymerase chain reaction (PCR) Parasitol. Res. 2021;120:2689–2693. doi: 10.1007/s00436-021-07211-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tewari A.K., Maharana B.R. Control of poultry coccidiosis: changing trends. J. Parasit. Dis. 2011;35:10–17. doi: 10.1007/s12639-011-0034-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Thabet A., Alnassan A.A., Daugschies A., Bangoura B. Combination of cell culture and qPCR to assess the efficacy of different anticoccidials on Eimeria tenella sporozoites. Parasitol. Res. 2015;14:2155–2163. doi: 10.1007/s00436-015-4404-4. [DOI] [PubMed] [Google Scholar]
  44. Wang L., Yang X., Zhang Y., Chen R., Cui Y., Wang Q. Anti-inflammatory chalcone-isoflavone dimers and chalcone dimers from Caragana jubata. J. Nat. Prod. 2019;82:2761–2767. doi: 10.1021/acs.jnatprod.9b00365. [DOI] [PubMed] [Google Scholar]
  45. Williams R.B., Marshall R.N., La Ragione R.R., Catchpole J. A new method for the experimental production of necrotic enteritis and its use for studies on the relationships between necrotic enteritis, coccidiosis and anticoccidial vaccination of chickens. Parasitol. Res. 2003;90:19–26. doi: 10.1007/s00436-002-0803-4. [DOI] [PubMed] [Google Scholar]
  46. Wong, Jo W.-H., Plett K.L., Natera S.H.A., Roessner U., Anderson I.C., Plett J.M. Comparative metabolomics implicates threitol as a fungal signal supporting colonization of Armillaria luteobubalina on eucalypt roots. Plant Cell Environ. 2020;43:374–386. doi: 10.1111/pce.13672. [DOI] [PubMed] [Google Scholar]
  47. Zhang Z., Liu P., Su W., Zhang H., Xu W., Chu X. Metabolic engineering strategy for synthetizing trans‑4‑hydroxy‑l‑proline in microorganisms. Microb. Cell Fact. 2021;20:87. doi: 10.1186/s12934-021-01579-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES