Quiescence Enhances Survival during Viral Infection in Caenorhabditis elegans

Michael J Iannacone; Paul Um; Jeremy I Grubbs; Alexander M van der Linden; David M Raizen

doi:10.1523/JNEUROSCI.1700-22.2024

. 2024 Jul 26;44(35):e1700222024. doi: 10.1523/JNEUROSCI.1700-22.2024

Quiescence Enhances Survival during Viral Infection in Caenorhabditis elegans

Michael J Iannacone ¹, Paul Um ¹, Jeremy I Grubbs ², Alexander M van der Linden ², David M Raizen ¹

PMCID: PMC11358607 PMID: 39060176

Abstract

Infection causes reduced activity, anorexia, and sleep, which are components of the phylogenetically conserved but poorly understood sickness behavior. We developed a Caenorhabditis elegans model to study quiescence during chronic infection, using infection with the Orsay virus. The Orsay virus infects intestinal cells yet strongly affects behavior, indicating gut-to-nervous system communication. Infection quiescence has the sleep properties of reduced responsiveness and rapid reversibility. Both the ALA and RIS neurons regulate virus-induced quiescence though ALA plays a more prominent role. Quiescence-defective animals have decreased survival when infected, indicating a benefit of quiescence during chronic infectious disease. The survival benefit of quiescence is not explained by a difference in viral load, indicating that it improves resilience rather than resistance to infection. Orsay infection is associated with a decrease in ATP levels, and this decrease is more severe in quiescence-defective animals. We propose that quiescence preserves energetic resources by reducing energy expenditures and/or by increasing extraction of energy from nutrients. This model presents an opportunity to explore the role of sleep and fatigue in chronic infectious illness.

Keywords: C. elegans, fatigue, neuropeptides, sleep, virus

Significance Statement

Sleepiness and fatigue are cardinal symptoms of infectious disease. We do not understand the mechanisms regulating sleep during sickness, how sickness sleep differs from regular sleep, and whether sickness sleep is beneficial to recovery from illness. We present a model for studying sleep-like quiescence during viral infection in the roundworm Caenorhabditis elegans. Sickness quiescence in worms relies on different neural circuitry than other forms of sleep. Quiescence during viral infection increases survival by improving resilience. Loss of quiescence during sickness leads to a drop in ATP levels, suggesting that it improves survival by conserving energy.

Introduction

Fatigue is a nearly invariant human symptom associated with disease, including infection, autoimmune disease, and cancer. While the fatigue and sleepiness associated with acute infectious disease (e.g., COVID-19) is typically short lasting, fatigue associated with chronic infectious diseases such as HIV infection (Harmon et al., 2008), or parainfectious disease such as postacute sequelae of SARS CoV-2 infection (Proal and VanElzakker, 2021), is often nonremitting and is a cause for disability. Little is known about the biological mechanisms underlying fatigue and sleepiness in the setting of illness.

Increased sleep in response to infectious disease is conserved among animals, including fruit flies (Kuo and Williams, 2014a,b), mice (Toth et al., 1995b), and rabbits (Toth and Krueger, 1988). It is unclear whether the neural mechanisms underlying sleep during chronic infectious sickness are the same as the neural mechanism underlying sleep during health. Furthermore, while it is commonly assumed that this behavioral response to sickness facilitates recovery, there is little experimental evidence to support this assumption. Finally, while homeostatic regulation of daily sleep has been demonstrated in multiple animals (Deboer, 2013), there is a paucity of data to support homeostatic regulation of sickness sleep (Toth et al., 1995a; Lapshina and Ekimova, 2010; Kuo and Williams, 2014a). To fill these gaps in our knowledge, we have developed an experimental model of a virus-induced sleep-like behavior in the nematode Caenorhabditis elegans.

We found that infection with the Orsay virus causes a sleep-like state characterized by rapidly reversible movement quiescence, feeding quiescence, and reduced responsiveness. Orsay-induced quiescence requires the second-order interneurons ALA and RIS, though the ALA neuron plays a more important role. Infected animals have a reduced lifespan in comparison with uninfected animals, and the lifespan is further reduced in animals with defective quiescent behavior. This benefit of Orsay-induced quiescence is associated with a metabolic advantage that increases resilience to the infection.

Materials and Methods

Worm cultivation

Worms were cultivated on Nematode Growth Medium (NGM) containing of 1.7% agar and 200 ng/ml streptomycin, unless otherwise specified. The diameter of the Petri dishes was 5.5 cm and the total volume of NGM-agar was 10 ml. Unless noted otherwise, plates were seeded with DA837, a streptomycin-resistant variant of the Escherichia coli strain OP50 (Davis et al., 1995). Worms were grown in 20°C incubators, unless otherwise specified. Strains used are listed in Table 1.

Table 1.

Strains used in this study

Strain	Genotype	Reference
N2	wild type	Brenner, 1974
WM27	rde-1(ne219) V	Tabara et al., 1999
IB16	ceh-17(np1) I	Pujol et al., 2000
HBR232	aptf-1(tm3287) II	Turek et al., 2013
TB528	ceh-14(ch3) X	Cassata et al., 2000
HBR232	flp-11(tm2706) X	Barstead et al., 2012
NQ1208	qnEx643[flp-11p::HisCl1::SL2::mCherry; Pmyo-2:mCherry]	Grubbs et al., 2020
NQ1167	ceh-17(np1) I; rde-1(ne219) V	This study
NQ1183	aptf-1(tm3287) II; rde-1(ne219) V	This study
NQ1184	egl-21(n476) IV; rde-1(ne219) V	This study
NQ1230	rde-1(ne219) V; ceh-14(ch3) X	This study
NQ1231	rde-1(ne219) V; qnEx643[flp-11p::HisCl1::SL2::mCherry; Pmyo-2:mCherry]	This study
NQ1251	rde-1(ne219) V; flp-11(tm2706) X	This study
NQ1292	ceh-17 (np1) I; rde-1 (ne219) V; qnIs303[hsp16.41p::flp-13; hsp-16.41::GFP; rab-3p::mCherry; myo-3p::dsRed]	This study

Open in a new tab

Construction of worm strains

We generated strains containing more than one gene mutation using standard Mendelian genetic tools (Fay, 2006). We used some combination of phenotype scoring, single worm PCR, and linkage in order to combine gene mutations in the same strain.

Orsay filtrate preparation/infection protocol

The Orsay filtrate preparation protocol was adapted from Félix et al. (2011). Briefly, recently starved rde-1 mutant worms of the strain WM27, infected with Orsay virus, were washed from eight plates (5.5 cm diameter) and suspended in 10 ml of 20 mM Tris-Cl, pH 7.8. The solution was pelleted at 5,000 × g. The supernatant was centrifuged at 21,000 × g for 5 min, and pellets were discarded twice over. The supernatant was filtered with a 0.2 µm filter. The resulting filtrate was used to infect worms.

Thirty microliter of Orsay filtrate was pipetted onto a lawn of DA837 bacteria on an NGM-agar plate. Larval stage 4 (L4) hermaphrodites were placed on the infected lawn. After 24 h, during which the animals matured to adulthood and laid eggs, these animals were removed from the plates. When the eggs hatched and the worms developed to L4 stage, they were picked to a fresh DA837 NGM-agar plate and used for behavioral studies 1 d later as Day 1 adults.

Movement quiescence assays

Movement quiescence was monitored using the WorMotel as described in Churgin et al. (2019). The WorMotel is a PDMS microfluidic device containing 48 3.5-mm-diameter wells, enabling long-term continuous behavioral monitoring of individual worms. The wells of the WorMotel were filled with NGM (1.7% agar, 200 mg/ml streptomycin) and spread with a thin layer of DA837 bacteria. One worm was placed in each well, and the WorMotel was sealed in a humidified petri dish (10 cm diameter, Azer); the inside lid of the dish was treated with 10% Tween to minimize condensation. WorMotels were imaged under dark-field conditions with indirect lighting from red LED strips (Oznium), using a 5 megapixel camera (The Imaging Source, DMK 23GP031) and a 12.5 mm lens (Fujifilm, HF12.5SA-1). Images were taken once every 10 s for 8 h, at a resolution of 14 µm/pixel. Images were processed using custom MatLab software (Churgin et al., 2019) using frame subtraction to distinguish movement from quiescence (Raizen et al., 2008). Temporally adjacent images were subtracted, and the difference image was treated with a Gaussian smoothing filter with standard deviation of one pixel. If the intensity value of a pixel changed above a specific threshold between two images, that pixel was counted as active. This threshold was between 20 and 30%, with adjustments made for each experiment depending on the background noise. If there was no activity between successive images, then the worm was determined to be quiescent for that time period (10 s). Movement quiescence was calculated as the sum of all time periods where the worm was quiescent. Movement and quiescence bouts were counted as continuous periods of movement or immobility, respectively. Based on the frequency of imaging (1 image per 10 s), quiescent bouts shorter than 10 s were not detectable.

Following automated analysis, experimenters performed a quality control check to confirm that periods of inactivity scored by the computer corresponded to inactivity in the images. Worms were censored from analysis for the following five reasons: the worm exited the well or crawled below the agar surface; the surface of the well was outside of the focal plane of the camera lens; the bacterial lawn was too thick and obscured the movements of the animal; a glare on the well obscured the movements of the animal; movement from hatched L1s was detected. Orsay-infected animals were censored at a higher rate than uninfected animals (mean, 25.4 vs 7.8%; t₍₆₎ = 4.4; p < 0.01); however, there was no difference in the rate of censorship between control rde-1-infected worms compared with experimental infected worms (mean, 26.4 vs 24.5%; t₍₆₎ = 0.63; p > 0.05). The number of animals censored for each WorMotel figure is listed in Table 3.

Table 3.

Experimental design and statistics: list of statistical tests, test statistics, and p values for all experiments in the study

Figure	Experiment	Strains	Sample size: N (censored)	Number of WorMotels	Statistical test	Test statistic	p value	Post hoc test	Post hoc test statistic and p value
1c	WorMotel movement	WM27	73(15), 122(78)	12	Unpaired t test	t₍₁₉₁₎ = 9.64	<0.0001	–	–
1d	WorMotel bout duration	WM27	73(15), 122(78)	12	Unpaired t test	t₍₁₉₁₎ = 8.36	<0.0001	–	–
1e	WorMotel bout number	WM27	73(15), 122(78)	12	Unpaired t test	t₍₁₉₁₎ = 10.43	<0.0001	–	–
1f	Feeding	WM27	41(0), 47(0)	–	Unpaired t test	t₍₈₆₎ = 5.37	<0.0001	–	–
1g	Movement + Feeding	WM27	155(0)	–	Chi-square	X₍₁₎ = 63.52	<0.0001	–	–
2a	Mechanical reversibility	WM27	12(30) (repeated measures)	–	Paired t test	t₍₁₁₎ = 12.35	<0.0001	–	–
2b	Mechanical stim response probability	WM27	35(6)	1	Restricted maximum likelihood model	F_(1.58,28.4) = 22.6	<0.0001	Šídák	SHAM vs STIM: active t₍₃₄₎ = 6.03, p < 0.0001; qui t₍₁₁₎ = 1.24, p = 0.4239
2c	Octanol response latency	WM27	17(0), 32(0)	–	Unpaired t test	t₍₄₇₎ = 6.86	<0.0001	–	–
3c	Homeostasis (change from baseline)	WM27 uninfected	Sham: 6(2); stim: 9(7)	3	2-way mixed ANOVA	Interaction effect F_(1,14) = 0.003	p = 0.957	–	–
3c	Homeostasis (change from baseline)	WM27 infected	Sham: 20(19); stim: 40(39)	3	2-way mixed ANOVA	Interaction effect F_(1,58) = 12.73	p = 0.0007	Šídák	STIM-PRE: t₍₁₁₆₎ = 3.49, p = 0.0014; POST-PRE: t₍₁₁₆₎ = 0.399, p = 0.904
3d	Homeostatic (bouts duration)	WM27 uninfected	Sham: 6(2); stim: 9(7)	3	Restricted maximum likelihood model	Interaction effect F_(1,24) = 0.898	p = 0.353	–	–
3d	Homeostatic (bouts duration)	WM27 infected	Sham: 20(19); stim: 40(39)	3	2-way mixed ANOVA	Interaction effect F_(1,58) = 1.29	p = 0.261	–	–
3e	PRQ comparison	WM27	6(0) and 36(5)	1	2-way mixed ANOVA	Interaction effect: F_(1,40) = 10.42	p = 0.002	Šídák	SHAM vs STIM: uninfected t₍₄₀₎ = 1.99, p = 0.103; infected t₍₄₀₎ = 3.66, p = 0.001
4b	UV WorMotel: ceh-17, aptf-1, egl-21	WM27, NQ1167, NQ1183, NQ1184	10(0), 7(1), 9(1), 8(0) (repeated measures)	1	Restricted maximum likelihood model	Interaction F_(3,30) = 28.96	p < 0.0001	Dunnett	Untreated (vs WM27): NQ1167 q₍₆₁₎ = 0.1623 p = 0.99; NQ1183 q₍₆₁₎ = 0.098 p = 0.99; NQ1184 q₍₆₁₎ = 0.21 p = 0.99; UV (vs WM27): NQ1167 q₍₆₁₎ = 6.96 p < 0.0001; NQ1183 q₍₆₁₎ = 12.26 p < 0.0001; NQ1184 q₍₆₁₎ = 9.41 p < 0.0001
4c	Orsay WorMotel: egl-21	WM27, NQ1184	14(0), 14(0), 24(3), 25(2)	2	2-way ANOVA	Interaction effect: F_(1,73) = 15.48	p = 0.0002	Šídák	Uninfected t₍₇₃₎ = 0.130, p = 0.9894; infected, t₍₇₃₎ = 6.695, p < 0.0001
4d	Orsay WorMotel: ceh-17	WM27, NQ1167	31(1), 32(0), 25(7), 30(2)	3	2-way ANOVA	Interaction F_(1,114) = 16.42	p < 0.0001	Šídák	Uninfected t₍₁₁₄₎ = 0.2056, p = 0.9736; infected t₍₁₁₄₎ = 5.343 p < 0.0001
4e	Orsay WorMotel: ceh-14	WM27, NQ1230	4(0), 4(0), 20(0), 20(0)	1	2-way ANOVA	Interaction F_(1,44) = 1.17	p = 0.286	Šídák	Uninfected t₍₄₄₎ = 0.016, p = 0.999; infected t₍₄₄₎ = 2.68, p < 0.020
4f	Orsay WorMotel: aptf-1	WM27, NQ1183	24(8), 27(5), 36(28), 35(29)	4	2-way ANOVA	Interaction F_(1,118) = 0.4435	p = 0.5068	Šídák	Uninfected t₍₁₁₈₎ = 0.5134 p = 0.8468; infected t₍₁₁₈₎ = 0.4242, p = 0.8925
4g	Orsay WorMotel: flp-11	WM27, NQ1251	31(1), 28(4), 47(17), 40(24)	4	2-way ANOVA	Interaction F_(1,142) = 2.92	p = 0.0899	Šídák	Uninfected t₍₁₄₂₎ = 0.069 p = 0.997; infected t₍₁₄₂₎ = 2.6, p = 0.0205
4h	UV WorMotel: RIS HisCl	WM27, NQ1231	2(2), 3(1), 5(7), 9(3)	3	2-way ANOVA	Interaction F_(1,81) = 27.58	p = 0.0001	Šídák	Untreated t₍₈₁₎ = 0.064 p = 0.99; UV t₍₈₁₎ = 8.60 p < 0.0001
4i	Orsay WorMotel: RIS HisCl	No his WM27, NQ1231	8(0), 6(2), 9(7), 10(6)	1	2-way ANOVA	Interaction F_(1,29) = 0.007	p = 0.934	Šídák	Uninfected t₍₂₉₎ = 0.104 p = 0.99; infected t₍₂₉₎ = 0.251 p = 0.96
4i	Orsay WorMotel: RIS HisCl	10 mM his WM27, NQ1231	63(7), 62(14), 80(36), 65(55)	8	2-way ANOVA	Interaction F_(1,266) = 9.27	p = 0.0026	Šídák	Uninfected t₍₂₆₆₎ = 0.527 p = 0.839; infected t₍₂₆₆₎ = 3.88 p = 0.0002
5a	Orsay pumping	WM27, NQ1167, NQ1230, NQ1183, NQ1184	44(0), 50(0), 50(0), 28(0), 38(0); 50(0), 50(0), 40(0), 29(0), 44(0)	–	2-way ANOVA	Interaction F_(4,413) = 10.67	p < 0.0001	Dunnett	Uninfected (vs WM27): NQ1167 q₍₄₁₃₎ = 0.97 p = 0.737; NQ1230 q₍₄₁₃₎ = 0.17 p = 0.999; NQ1183 q₍₄₁₃₎ = 2.65 p = 0.030; NQ1184 q₍₄₁₃₎ = 2.49 p = 0.046; Orsay (vs WM27): NQ1167 q₍₄₁₃₎ = 5.67 p < 0.0001; NQ1230 q₍₄₁₃₎ = 5.48 p < 0.0001; NQ1183 q₍₄₁₃₎ = 1.26 p = 0.545; NQ1184 q₍₄₁₃₎ = 3.75 p = 0.0008
5b	UV pumping	WM27, NQ1167, NQ1230, NQ1183, NQ1184	40(0), 30(0); 25(0), 20(0); 25(0), 20(0); 24(0), 20(0); 30(0), 30(0)	–	2-way ANOVA	Interaction F_(4,254) = 70.25	p < 0.0001	Dunnett	Untreated (vs WM27): NQ1167 q₍₂₅₄₎ = 1.16 p = 0.631; NQ1230 q₍₂₅₄₎ = 1.42 p = 0.450; NQ1183 q₍₂₅₄₎ = 1.12 p = 0.656; NQ1184 q₍₂₅₄₎ = 0.49 p = 0.988; UV (vs WM27): NQ1167 q₍₂₅₄₎ = 7.11 p < 0.0001; NQ1230 q₍₂₅₄₎ = 20.30 p < 0.0001; NQ1183 q₍₂₅₄₎ = 0.05 p = 0.999; NQ1184 q₍₂₅₄₎ = 0.10 p = 0.999
6a–d	Survival	see Tables 4–7
6f	FLP-13 OE WorMotel	WM27, NQ1292	4(0), 3(1), 19(1), 19(1)	1	2-way ANOVA	Interaction F_(1,41) = 3.34	p = 0.075	Šídák	20°C t₍₄₁₎ = 0.008 p > 0.99; 25°C t₍₄₁₎ = 4.69 p < 0.0001
7a	Orsay virus load	WM27, NQ1167	12(0), 12(0)	–	Mann–Whitney test	U = 60	p = 0.514	–	–
7b	cul-6	WM27, NQ1167	3(1), 3(1), 4(1), 4(1)	–	Multiple 2-way ANOVA: family-wise alpha 0.05 (Bonferroni’s corrected to 0.007)	Infection F_(1,10) = 198.2; interaction F_(1,10) = 1.10	p < 0.0001; p = 0.32
	F26F2.1		3(1), 3(1), 4(1), 4(1)	–		Infection F_(1,10) = 3,290; interaction F_(1,10) = 0	p < 0.0001; p > 0.99
	F26F2.3		4(0), 4(0), 5(0), 5(0)	–		Infection F_(1,14) = 459.4; interaction F_(1,14) = 1.13	p < 0.0001; p = 0.20
	F26F2.4		2(2), 2(2), 3(2), 3(2)	–		Infection F_(1,6) = 632.2; interaction F_(1,6) = 4.74	p < 0.0001; p = 0.07
	pals-5		4(0), 4(0), 5(0), 5(0)	–		Infection F_(1,14) = 238.8; interaction F_(1,14) = 0.92	p < 0.0001; p = 0.35
	skr-4		3(1), 3(1), 4(1), 4(1)	–		Infection F_(1,10) = 74.8; interaction F_(1,10) = 0.42	p < 0.0001; p = 0.42
	skr-5		3(1), 4(0), 5(0), 5(0)	–		Infection F_(1,13) = 55.0; interaction F_(1,13) = 1.19	p < 0.0001; p = 0.30
7c	GFP bacteria	WM27, NQ1167	See Table 8 (all between subjects comparisons)
7d	Dead bacteria survival	WM27	See Table 9
7e	ATP	WM27, NQ1167	3(0), 7(0), 8(0), 8(0)	–	2-way ANOVA	Interaction F_(1,22) = 14.7	p = 0.0009	Šídák	WM27, t₍₂₂₎ = 1.99, p = 0.11; NQ1167, t₍₂₂₎ = 9.28, p < 0.0001

Open in a new tab

Sample sizes (N) are shown for each group in the order that they appear in the figures; the number of censored animals for each group is shown next to the sample size in parentheses.

Feeding quiescence assays

Pharyngeal pumping rates of Day 1 adult hermaphrodites were counted for 10 s while observing the animals with bright-field stereomicroscopy at 40× total magnification (4× objective and 10× ocular lens). A manual tally counter was used to count pumps.

Mechanical stimulation assay

Mechanical stimulation was applied as described in McClanahan et al. (2020). A WorMotel (as described above) was mounted on top of an audio speaker (PLMRW10 10 inch Marine Subwoofer, Pyle Audio). Acrylic mounting plates with screws fixed the WorMotel tightly to the inside of a 10 cm petri dish, which itself was mounted on the center of the speaker cone using an acrylic ring and screws. The field was illuminated with a ring of red LEDs situated around the Petri dish. Images were recorded at a rate of 1 image per second. Stimuli were delivered at 10% maximum volume at 1,000 Hz for 1 s. Twenty-eight stimuli were delivered to each worm, each separated by a 4 min interval. Sham stimuli were analyzed at the 2 min interval between each stimulus. To measure reversibility (Fig. 2a), movement was automatically detected using the image subtraction algorithm for WorMotel analysis. Behavioral response categorization (Fig. 2b, Movie 1) was scored by watching videos 10 s following stimulation (or sham). The scorer was blinded to both the stimulation condition and the behavior of the worm prior to stimulation. Scores were separated according to condition (sham and stim) and behavioral state prior to stimulation (active and quiescent). A worm was considered quiescent if it was immobile for the 10 s period prior to stimulation. Worms were included in the analysis if there were at least 8 out of 28 trials where they matched the appropriate condition (e.g., their response probability would be excluded from the sham/active condition if they were only active prior to 6 out of 28 sham events).

Figure 2. — Responsiveness and reversibility of Orsay-induced quiescence. a, Probability of movement following either no stimulation (Sham) or mechanical stimulation (Stim) in quiescent infected *rde-1* mutants (n = 12); data are from 1 WorMotel. b1, Probability of response to mechanical stimulation in *rde-1* infected worms (n = 35). Each block represents the mean probability for each response type. Data are from 1 WorMotel. b2, Probability of sustained or complex movement (category 2 or greater in Fig. 2b) following either no stimulation (Sham) or a mechanical stimulation (Stim) in *rde-1* mutants. c, Latency to respond to 1-octanol olfactory stimulus in infected *rde-1* mutants that were either active (n = 17) or quiescent (n = 32) at the time of the stimulus.

Olfactory stimulation assay

Response to 1-octanol was measured as described in Raizen et al. (2008), with some modifications. 1-Octanol was diluted in ethanol to a concentration of 10%. An eyelash was dipped in the 1-octanol solution and presented to the anterior end of infected worms while they were either active or quiescent. Following presentation of the olfactory stimulus, a reversal response was measured as the latency to reverse the length of the worm's pharynx (∼200 µm).

Homeostatic rebound assay

The homeostatic rebound assay was performed using the vibrating WorMotel described in the mechanical stimulation assay and McClanahan et al. (2020). Infected animals were recorded for at least 4 h, with images collected at 1 s intervals. Seventy-five minutes after the recording started, animals received a mechanical stimulation every 30 s for 1 h (121 total stimulations). Each stimulation was 1 s in duration, at 1,000 Hz, using 100% maximum volume. The “pre-stim” period covered the 1 h period ending 1 min before stimulation started. The “post-stim” period covered the 1 h period starting after the last stimulation. The “stimulation” period covered all time between the first stimulation and the last stimulation. For the stimulation time period, data from the first 5 s after each stimulation was excluded, in order to avoid motion artifacts due to vibration. The change in quiescent time was calculated using the fraction of time spent quiescent during each time window (during stim or post-stim) minus the fraction of time spent quiescent during the pre-stim time window. Sham and stim conditions were a between-subjects factor in this experiment.

Post-response quiescence assay

The PRQ analysis was performed using the data that were collected for the mechanical stimulation assay described above and based on the experiments described in McClanahan et al. (2020). To generate the XY plot in Figure 3d: for each animal, the quiescence fraction was calculated from 30 s pre-stim to 45 s post-stim as the probability that an animal was quiescent at a given time point across each of the 28 stimulations performed (and similarly for the sham time periods). To generate the bar plot in Figure 3e: the average fraction of time spent quiescent pre-stim (−20 to −1 s) was subtracted from the average fraction of time spent quiescent post-stim (+6 to +20 s). The average value from these time periods was taken for each animal from the first 15 stimulations (or sham stimulations). The first 5 s post-stim were excluded to avoid motion artifacts from vibration. Sham and stim conditions were a within-subjects factor in this experiment.

Figure 3. — Homeostasis and postresponse quiescence of Orsay-induced quiescence behavior. ***a–c***, Quiescent behavior during Orsay infection in *rde-1* mutants does not show homeostatic rebound. a, Average fraction of quiescent animals across 3 h period before, during, and after mechanical stimulation, with labels showing time frames used in b and c. b, The difference in the fraction of time spent quiescent in the 1 h periods during and after mechanical stimulation. c, Mean duration of movement quiescent bouts in the 1 h period before and after mechanical stimulation. Each marker shows the average bout length for an individual worm. N(un-sham) = 6, N(un-stim) = 9, N(inf-sham) = 20, N(inf-stim) = 40. Stimulation data were pooled from 2 WorMotels, and sham data were from 1 WorMotel. d, e, Orsay virus infection is associated with postresponse quiescence (PRQ) in *rde-1* mutants. a, Average fraction of quiescence at 1 s time intervals relative to stimulus (or sham stimulus) for infected (N = 35) and uninfected (N = 6) animals (e.g., a value of 0.5 indicates an animal was quiescent on 50% of the trials at that specific time point). Shading indicates SEM. PRE/POST indicate time frames used in b, average change in quiescence time in seconds after stimulation (POST − PRE). Data were from 1 WorMotel. Line plots display mean ± standard error of the mean, scatterplots display mean ± standard deviation. ^nsp > 0.05; **p < 0.01; ***p < 0.001.

Intestinal GFP analysis

To determine whether Orsay virus infection influences bacterial colonization, we fed infected animals with the bacteria strain pFPV25.1 (obtained from CGC), which expresses GFP, and measured green fluorescence in the intestine for the first 3 d of adulthood in rde-1 and ceh-17; rde-1 animals. Worms were grown and infected as described above except they were grown on GFP-expressing OP50 bacteria (pFPV25.1; Labrousse et al., 2000), and the NGM did not contain streptomycin. Infected and uninfected L4 stage worms were picked to new plates. Intestinal fluorescence was assessed on each of the subsequent 3 d (for Day 1, 2, and 3 adults, respectively). Worms were washed in M9, mounted on 2% NGM-agarose pads, immobilized with 0.1% sodium azide, and imaged at 40× on a Leica DM5500 compound microscope and Hamamatsu Orca II camera. Scoring: We assessed animals on a 4-point ordinal scale ranging 0–3, where 0 denotes no GFP in the intestine; 1 denotes a small amount of GFP in the intestine; 2 denotes GFP along with intestinal distention; and 3 denotes GFP found in the body cavity beyond the intestine. We did not observe a GFP signal above 0 in uninfected animals in this age range, indicating that these animals did not accumulate GFP in the intestinal lumen and that the signal observed in our analysis was not confounded by autofluorescence. The individual scoring the images was blind to condition.

Longevity assays

Eggs were laid on Orsay virus-treated plates as described above. Infected L4 worms were transferred to a new seeded plate that was not treated with Orsay virus. The next day, the number of alive, dead, and censored worms were counted, and the live worms were transferred to new seeded plates. Dead worms were defined as remaining immobile after three touches to the anterior third of the body (at the level of the posterior bulb of the pharynx). Worms were censored if they displayed the bag-of-worms or exploded vulva phenotypes, or if they climbed up the side of the Petri dish and could not be found. The number of worms censored in each experiment is listed in Tables 4–7 and 9. For the experiments involving flp-13 overexpression, all worms were incubated at 25°C.

Table 4.

Summary statistics for Figure 6a: pairwise comparisons for survival experiments

ALA dysfunction	Comparison		N (censor)	Mean (days)	Curve Comparison Χ²(degrees of freedom), p value	Median survival (days)	Median comparison p value
Number of comparisons: 8 Family-wise α: 0.05 Adjusted α: 0.006	rde-1(-)	Uninfected	81 (14)	13.8	62.95(1), <0.001	14.0	<0.001
	rde-1(-)	Infected	82 (18)	7.4	62.95(1), <0.001	6.0	<0.001
	ceh-17(-); rde-1(-)	Uninfected	85 (24)	12.5	84.48(1), <0.001	12.5	<0.001
	ceh-17(-); rde-1(-)	Infected	87 (15)	4.6	84.48(1), <0.001	3.7	<0.001
	rde-1(-)	Uninfected	81 (14)	13.8	1.73(1), 0.19	14.0	0.75
	rde-1(-)	Infected	85 (24)	12.5	1.73(1), 0.19	12.5	0.75
	ceh-17(-); rde-1(-)	Uninfected	82 (18)	7.4	32.53(1), <0.001	6.0	<0.001
	ceh-17(-); rde-1(-)	Infected	87 (15)	4.6	32.53(1), <0.001	3.7	<0.001

Open in a new tab

Bonferroni’s correction method was used to control for multiple comparison, alpha-level showed on the left. Test statistic and degrees of freedom are displayed for Mantel–Cox log-rank test for curve comparisons. Median value is shown as linear interpolation of 50th percentile of mortality curve, and comparison of these values was performed using Fisher's exact test. Statistical comparisons were performed using Oasis 2 (Han et al., 2016). Significant differences (below adjusted alpha) are displayed in bold.

Table 5.

Summary statistics for Figure 6b: pairwise comparisons for survival experiments

ALA dysfunction	Comparison		N (censor)	Mean (days)	Curve Comparison Χ²(df), p value	Median survival (days)	Median comparison p value
Number of comparisons: 8 Family-wise α: 0.05 Adjusted α: 0.006	rde-1(-)	Uninfected	81 (14)	13.8	62.95(1), <0.001	14.0	<0.001
	rde-1(-)	Infected	82 (18)	7.4	62.95(1), <0.001	6.0	<0.001
	ceh-14(-); rde-1(-)	Uninfected	27 (12)	10.6	30.59(1), <0.001	11.9	<0.001
	ceh-14(-); rde-1(-)	Infected	84 (22)	3.6	30.59(1), <0.001	2.5	<0.001
	rde-1(-)	Uninfected	81 (14)	13.8	6.57(1), 0.01	14.0	0.82
	rde-1(-)	Infected	27 (12)	10.6	6.57(1), 0.01	11.9	0.82
	ceh-14(-); rde-1(-)	Uninfected	82 (18)	7.4	58.23(1), <0.001	6.0	<0.001
	ceh-14(-); rde-1(-)	Infected	84 (22)	3.6	58.23(1), <0.001	2.5	<0.001

Open in a new tab

Table 6.

Summary statistics for Figure 6c: pairwise comparisons for survival experiments

RIS dysfunction	Comparison		N (censor)	Mean (days)	Curve Comparison Χ²(df), p value	Median survival (days)	Median comparison p value
Number of comparisons: 8 Family-wise α: 0.05 Adjusted α: 0.006	rde-1(-)	Uninfected	29 (4)	15.7	74.7(1), <0.001	15.7	<0.001
	rde-1(-)	Infected	89 (21)	6.0	74.7(1), <0.001	5.1	<0.001
	aptf-1(-); rde-1(-)	Uninfected	29 (11)	13.6	37.00(1), <0.001	13.9	<0.001
	aptf-1(-); rde-1(-)	Infected	58 (11)	6.1	37.00(1), <0.001	5.1	<0.001
	rde-1(-)	Uninfected	29 (4)	15.7	2.87(1), 0.09	15.7	>0.99
	rde-1(-)	Infected	29 (11)	13.6	2.87(1), 0.09	13.9	>0.99
	aptf-1(-); rde-1(-)	Uninfected	89 (21)	6.0	0.09(1), 0.75	5.1	0.73
	aptf-1(-); rde-1(-)	Infected	58 (11)	6.1	0.09(1), 0.75	5.1	0.73

Open in a new tab

Table 7.

Summary statistics for Figure 6d: pairwise comparisons for survival experiments

flp-13 over-expression	Comparison		N (censor)	Mean (days)	Curve Comparison Χ²(df), p value	Median survival (days)	Median comparison p value
Number of comparisons: 12 Family-wise α: 0.05 Adjusted α: 0.004	Uninfected	rde-1(-)	90 (18)	12.0	3.45(1), 0.06	12.0	0.003
	Uninfected	ceh-17(-); rde-1(-)	90 (18)	11.1	3.45(1), 0.06	10.1	0.003
	Uninfected	rde-1(-)	90 (18)	12.0	5.57(1), 0.02	12.0	0.76
	Uninfected	ceh-17(-); rde-1(-); HS:FLP-13	85 (24)	13.5	5.57(1), 0.02	12.1	0.76
	Uninfected	ceh-17(-); rde-1(-)	90 (18)	11.1	12.45(1), <0.001	10.1	0.123
	Uninfected	ceh-17(-); rde-1(-); HS:FLP-13	85 (24)	13.5	12.45(1), <0.001	12.1	0.123
	Infected	rde-1(-)	90 (27)	6.7	33.91(1), <0.001	4.5	<0.001
	Infected	ceh-17(-); rde-1(-)	82 (20)	3.9	33.91(1), <0.001	2.9	<0.001
	Infected	rde-1(-)	90 (27)	6.7	3.37(1), 0.07	4.5	0.88
	Infected	ceh-17(-); rde-1(-); HS:FLP-13	79 (17)	6.0	3.37(1), 0.07	4.3	0.88
	Infected	ceh-17(-); rde-1(-)	82 (20)	3.9	17.48(1), <0.001	2.9	0.002
	Infected	ceh-17(-); rde-1(-); HS:FLP-13	79 (17)	6.0	17.48(1), <0.001	4.3	0.002

Open in a new tab

Table 9.

Summary statistics for Figure 7d: pairwise comparisons for survival experiments

rde-1(n219)	Comparison		N (censor)	Mean (days)	Curve comparison Χ²(df), p value	Median survival (days)	Median comparison p value
Number of comparisons: 8 Family-wise α: 0.05 Adjusted α: 0.006	Live bacteria	Uninfected	49 (31)	19.1	150.32(1), <0.001	17.5	<0.001
	Live bacteria	Infected	74 (6)	5.1	150.32(1), <0.001	3.8	<0.001
	Dead bacteria	Uninfected	63 (13)	20.3	140.53(1), <0.001	18.9	<0.001
	Dead bacteria	Infected	71 (6)	6.8	140.53(1), <0.001	5.1	<0.001
	Uninfected	Live bacteria	49 (31)	19.1	0.12(1), 0.73	17.5	0.028
	Uninfected	Dead bacteria	63 (13)	20.3	0.12(1), 0.73	18.9	0.028
	Infected	Live bacteria	74 (6)	5.1	14.83(1), <0.001	3.8	0.016
	Infected	Dead bacteria	71 (6)	6.8	14.83(1), <0.001	5.1	0.016

Open in a new tab

Dead bacteria longevity experiment

Longevity experiments were performed as described above with the following exceptions. Worms were synchronized by egg-prep (Stiernagle, 2006). Three-centimeter-diameter NGM-agar plates were prepared without streptomycin or peptone. A liquid culture of GFP-expressing OP50 E. coli (pFPV25.1, grown overnight in LB + 50 mg/ml ampicillin) was concentrated four times, and 75 µl was spread evenly across the NGM-agar. In the dead bacteria conditions, the plates were placed in a Spectrolinker XL-1500 (Spectroline) and treated with 254 nm UV radiation of 9,999 J/m². In the Orsay infection conditions, 30 µl of Orsay filtrate was spread across the bacteria lawns. At the beginning of the experiment, 40–50 synchronized L1 worms were plated on plates in one of four conditions: dead (irradiated) bacteria with or without Orsay virus and live (nonirradiated) bacteria with or without Orsay virus. Once these worms reached the L4 larval stage, ∼30 L4 worms were picked to fresh plates, none of which were treated with the Orsay virus. Throughout the experiment, worms were maintained on either dead or live bacteria plates, consistent with their experimental group.

ATP level determination in Orsay-infected animals

ATP levels in whole worms were determined as described (Grubbs et al., 2020). For Orsay-infected animals, 200–300 worms were age synchronized using the double-bleaching method (Baugh et al., 2009) transferred to NGM-agar surface (5.5 cm diameter) fully covered with a lawn of E. coli OP50 and grown at 20°C. Animals were cultured until the L2–3 larval stage and 30 µl of Orsay filtrate (or 30 µl M9 as a control) was added to infect animals (Félix et al., 2011). At the young adult stage, animals were checked visually for sleep behavior (movement quiescence and pumping cessation). If 60% or more of the animals infected displayed sleep behavior, then animals were washed off the agar surface with 5 ml of M9 buffer. The worm and bacterial suspension was transferred to a 15 μm nylon mesh filter, which passes bacteria but traps the worms. After collection, animals were flash frozen in liquid nitrogen and stored at −80°C until processing and analysis. Samples of frozen worms were immersed in boiling water for 15 min and then placed on ice for 5 min. ATP was quantified in supernatants of worm solutions using an ATP Determination Kit (Molecular Probes, catalog #A22066) and a microplate reader (Synergy HT, Biotek) according to the manufacturers protocols. ATP concentrations were normalized to total protein content as determined by a Micro BCA protein assay kit (Thermo Fisher Scientific, catalog #23235). The average ATP concentration per microgram protein was calculated per biological sample with a minimum of three biological experiments for each condition.

Total RNA isolation

Each biological replicate consisted of ∼50 Day 1 adult worms collected from an individual plate of infected or uninfected animals. RNA samples were extracted and prepared using RNeasy MiniKit (Qiagen, 74104). Worms were picked into 1.8 ml Eppendorf tubes containing lysis buffer (RLT buffer) with 10 µl/ml β-mercaptoethanol and ∼10 µl 500 µm zirconium oxide beads (Next Advance). Worms were flash frozen in a dry ice/ethanol bath and stored at −80°C for up to 2 weeks before further processing. Frozen worms were lysed in a bead beater (Next Advance) for 2 min at setting 8. An additional 80 µl RLT was added to the tubes, and they were lysed for an additional minute. Lysed samples were centrifuged in a tabletop centrifuge, and the supernatant was transferred to a fresh tube (without the beads) and mixed with 100 µl 70% ethanol. RNA was extracted from the supernatant according to the Qiagen RNeasy MiniKit protocol. Total RNA for each sample was measured using NanoDrop (Thermo Fisher Scientific).

Quantitative reverse-transcription polymerase chain reaction

Total RNA was reverse-transcribed to cDNA using High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, 4387806), which uses MuLV reverse transcriptase and a mix of random octamer and 16-polyT primers. For each biological replicate, 10 ng of RNA was reverse transcribed. Quantitative PCR was performed using Power SYBR Green on a 7500 Fast Real-Time PCR System (Applied Biosystems) using 96-well PCR plates (Bio-Rad Laboratories). Following an initial 2 min at 95°C, samples were cycled 40 times between 72°C (1 min) and 95°C (30 s). After amplification, product specificity was determined by a melting curve. Each biological replicate was performed in duplicate. A total of 4–12 µl cDNA was used in each technical replicate (within each experiment, the same amount of cDNA was used for each sample). The delta-delta-Ct method was used to compare gene expression levels. ama-1 was used as a reference gene, and change in gene expression levels for each genotype [rde-1(-) and ceh-17(-);rde-1(-)] were compared with their respective uninfected controls. PCR primers are listed in Table 2. Background and threshold were determined automatically by the Applied Biosystems software. The median cycle-threshold (Ct) of the technical replicates was used for each biological replicate.

Table 2.

Oligonucleotides used in this study

Use	Oligo name	Target	Sequence	Reference
qRT-PCR	oNQ1866	Orsay virus (forward)	ACCTCACAACTGCCATCTACA	Félix et al., 2011
qRT-PCR	oNQ1867	Orsay virus (reverse)	GACGCTTCCAAGATTGGTATTGGT	Félix et al., 2011
qRT-PCR	oNQ1916	ama-1 (forward)	CGGATGGAGGAGCATCGCCG	Zhang et al., 2012
qRT-PCR	oNQ1917	ama-1 (reverse)	CAGCGGCTGGGGAAGTTGGC	Zhang et al., 2012
qRT-PCR	oNQ1973	skr-4 (forward)	CCGACAGCCAGAAACAAATCA	Reddy et al., 2017
qRT-PCR	oNQ1974	skr-4 (reverse)	GGTCTTGGATTGGCTGATCAC	Reddy et al., 2017
qRT-PCR	oNQ1975	skr-5 (forward)	CGAAGAGCAAGATGTCAAAATTG	Reddy et al., 2017
qRT-PCR	oNQ1976	skr-5 (reverse)	AGAAGCTTGGATTGATTGGCA	Reddy et al., 2017
qRT-PCR	oNQ1977	cul-6 (forward)	CTGGGCTTACTCACAATGCC	Reddy et al., 2017
qRT-PCR	oNQ1978	cul-6 (reverse)	GCAGAGTTGGCTTGCTGTAA	Reddy et al., 2017
qRT-PCR	oNQ1979	pals-5 (forward)	CATTGGAAAGCGATATTGGA	Reddy et al., 2017
qRT-PCR	oNQ1980	pals-5 (reverse)	TCTCCAGGCACCTATCTTGTAG	Reddy et al., 2017
qRT-PCR	oNQ1981	F26F2.1 (forward)	TGGAACCAGGTCAGAGACAC	Reddy et al., 2017
qRT-PCR	oNQ1982	F26F2.1 (reverse)	TTGTGAGAATTTCCGCGATA	Reddy et al., 2017
qRT-PCR	oNQ1983	F26F2.3 (forward)	GGAAAGGGAATGCATTATGG	Reddy et al., 2017
qRT-PCR	oNQ1984	F26F2.3 (reverse)	CCGCACGGTTATTTCTCAT	Reddy et al., 2017
qRT-PCR	oNQ1985	F26F2.4 (forward)	CAACAATACACTGCGGATGG	Reddy et al., 2017
qRT-PCR	oNQ1986	F26F2.4 (reverse)	TCGCACTGTTATTCATCTCCA	Reddy et al., 2017

Open in a new tab

Experimental design and statistical analysis

Images from the WorMotel were analyzed in MatLab (MathWorks) as described in Churgin et al. (2019). Subsequent processing of activity value matrices from the image subtraction analysis were also performed in MatLab. Prism (GraphPad) was used to produce graphs and perform statistical analysis. A detailed account of statistical comparisons for each figure is listed in Table 3. Direct pairwise comparisons were performed using Student's t test with α = 0.05. Grouped analyses were performed using two-way analysis of variance (ANOVA) with α = 0.05, and, when appropriate, Šídák's multiple-comparison test was used for post hoc pairwise comparisons using a family-wise alpha threshold of 0.05. Dunnett's instead of Šídák's multiple-comparison test was used in Figures 4b and 5 because pairwise comparisons outside of the control condition were irrelevant. Survival curves were analyzed using OASIS 2 (Han et al., 2016): hazard rate comparisons were made using the Mantel–Cox log-rank test, and 50th percentile comparisons were made using Fisher's exact test. A family-wise alpha level of 0.05 was maintained for each group using the Bonferroni’s method to control for multiple comparisons.

Figure 4. — The ALA neuron plays a larger role than the RIS neuron in promoting sleep during Orsay virus infection. a, Model of the genetic and neural control of stress-induced sleep following heat shock or ultraviolet radiation stressors. Following an acute stress exposure, EGF receptor ligand activates the ALA and RIS neurons through the EGF-receptor LET-23. RIS and ALA release somnogenic neuropeptides following activation by EGFR signaling. The carboxypeptidase E EGL-21 is required for maturation of neuropeptides. ALA and RIS neurons function partially in parallel, and ALA also activates RIS. FLP-13 neuropeptides from ALA signal through the inhibitory G-protein coupled receptor DMSR-1 to reduce activity in wake-promoting neurons. The somnogenic effects of FLP-11 require the receptors FRPR-3, NPR-4, and NPR-22. b, UV-induced quiescence requires ALA, RIS, and neuropeptide processing. Movement quiescence during 2–4 h time window following UV treatment. N = [10, 7, 9, 8], data are from 1 WorMotel. ***c–g***, Orsay virus infection-induced movement quiescence in SIS mutants. c, Neuropeptide processing mutants [*egl-21(n476); rde-1(ne219)*] suppress Orsay-induced movement quiescence. N = [14, 14, 24, 25]. Data are pooled from 2 WorMotels. d, e, ALA neuron development mutants [*ceh-17(np1); rde-1(ne219)* (N = [31, 32, 25, 30]) and *ceh-14(ch3); rde-1(ne219)*; N = [4, 4, 20, 20]] suppress Orsay-induced movement quiescence. Data are pooled from 3 and 1 WorMotels, respectively. f, RIS neuron development mutants [*aptf-1(tm3287); rde-1(ne219)*] do not suppress Orsay-induced movement quiescence. N = [24, 27, 36, 35], data are pooled from 4 WorMotels. g, FLP-11 neuropeptide mutants *rde-1(ne219); flp-11(tm2706)* modestly suppress Orsay-induced movement quiescence. N = [31, 28, 47, 40], data are pooled from 4 WorMotels. h, Chemogenetic inhibition of RIS suppresses movement quiescence during 2–4 h time window after UV treatment. N = [2, 3, 5, 9], data are from 1 WorMotel. i, Chemogenetic inhibition of RIS [*rde-1(ne219); flp-11p:HisCl1*] suppresses Orsay-induced movement quiescence. N = [8, 6, 9, 10; 63, 62, 80, 65]. Data for no histamine are from are from 1 WorMotel, and data for histamine were pooled from 8 WorMotels. Mean ± standard deviation. ^nsp > 0.05; *p < 0.05; ***p < 0.001.

Figure 5. — Feeding quiescence during Orsay-induced sleep. a, b, Feeding quiescence in SIS mutants during (a) Orsay virus-induced sleep and (b) UV stress-induced sleep. Pharyngeal pumping rate measured during 10 s interval. N(a) = [44, 50, 50, 28, 38; 50, 50, 40, 29, 44]; N(b) = [40, 25, 25, 24, 30; 30, 20, 20, 20, 30]. Mean ± standard deviation. All pairwise comparisons were made within treatment groups between experimental and control genotypes [*rde-1(n219)*] using Dunnett's multiple-comparisons test. ^nsp > 0.05; *p < 0.05; ***p < 0.001.

Results

Orsay virus infection is associated with a sleep-like state

To infect C. elegans, we used the Orsay virus, a nodavirus isolated from wild C. elegans worms. The Orsay virus is transmitted horizontally and infects intestinal cells (Félix et al., 2011; Franz et al., 2014). Since C. elegans uses RNA-interference (RNAi) as a defense against viruses (Ashe et al., 2015), RNAi-deficient worms have increased viral load and infection symptoms compared with wild-type animals (Félix et al., 2011). Therefore, in all viral infection experiments, we used RNAi-deficient animals that have a mutation in rde-1(ne219), an Argonaut family member (Tabara et al., 1999; Félix et al., 2011). To test whether Orsay virus infection caused sleep, we evaluated the following behavioral criteria, which have been used to describe sleep (Campbell and Tobler, 1984): behavioral quiescence, reversibility, increased arousal threshold, and homeostasis.

Infected adult worms had reduced body movements and feeding rates compared with uninfected controls (Fig. 1). Infected animals exhibited pauses in both movement and feeding, which were rare in controls. During an 8 h period, mean quiescence time for infected animals was 131.8 min (27.5%) compared with 9.1 min for uninfected animals (t₍₁₉₁₎ = 9.6; p < 0.0001; Fig. 1a–c). The mean movement quiescent bout duration (64 ± 48 s) and number (126 ± 73) were also greater among infected animals than among uninfected controls (16 ± 9 s and 32 ± 29, respectively; Fig. 1d,e). Feeding rates fell into a bimodal distribution: 60% of the worms pumped rapidly with a range of 3–5 Hz and a mean of 4.2 Hz, which was similar to mean pumping rate of uninfected animals (4.3 Hz); the remaining worms either did not pump (32%) or pumped at <1 Hz (8%; Fig. 1f). The bimodal distribution of pumping rates suggests that nonpumpers were in a distinct behavioral state from rapid pumpers.

Figure 1. — Orsay virus infection induces a sleep state in *C. elegans rde-1* mutants. a, b, Activity and quiescence over 8 h of individual Day 1 adult *rde-1* worms uninfected (a, n = 73) or infected (b, n = 122). Each row represents an individual worm. White indicates movement and black indicates quiescence. Data are ordered from least quiescent (top) to most quiescent (bottom). Data are pooled from 12 WorMotels. c, Total time spent quiescent during the 8 h period shown in Figure 1a,b. Mean ± standard deviation. d, e, Mean bout duration (d) and number of bouts (e) related to movement quiescence bouts from data in ***a–c***. Mean ± standard deviation. f, Feeding rate during a 10 s period: uninfected (n = 41) or infected (n = 47) *rde-1* worms. Solid horizontal lines indicate medians, and dotted lines indicate first and third quartiles. g, Co-occurrence of movement and feeding quiescence, frequency table (with fraction of whole in parentheses). Movement and feeding quiescence are not independently occurring behavioral states (Χ²₍₁₎ = 63.52; p < 0.0001). ***p < 0.001, two-tailed Student's t test.

To further test the notion that quiescence is a distinct behavioral state, we simultaneously observed movement and feeding quiescence (Fig. 1g). If the observed quiescence were a distinct behavioral state, then one would expect absence of feeding to occur at the same time as an absence of movement and active movement to occur at the same time as active feeding behavior. We observed worms for 10 s and considered them to be quiescent for movement if they were immobile and quiescent for feeding if they did not pump during the 10 s. Of 103 animals that showed active feeding behavior, 102 were also moving. In contrast, among 52 animals quiescent for feeding, 24 (46.2%) were active for body movement and 28 (53.8%) were quiescent for movement. The 53.8% likelihood of movement quiescence during feeding quiescence is threefold higher than the likelihood of movement quiescence overall (29/155, 18.1%), indicating that movement and feeding quiescence are not independent behaviors (Χ²₍₁₎ = 63.52; p < 0.0001). However, based on the observation that feeding quiescence sometimes does occur while the animal is moving indicates that observing feeding alone may not be sufficient to conclude the animal is in a quiescent behavioral state.

After observing movement and feeding quiescence in these same worms, we tested reversibility of quiescence by mechanically stimulating the worms with a thin metal wire). All worms with movement quiescence resumed locomotion for at least 10 s following stimulation. No worms with feeding quiescence resumed pumping, which is unsurprising because mechanical stimulation inhibits pharyngeal pumping (Chalfie et al., 1985).

To further characterize reversibility of this virus-induced behavioral quiescence, we stimulated infected worms with a mechanical stimulus, using a speaker system to vibrate the worms while recording movement quiescence. Inactive animals responded to these stimuli with brisk dorsoventral waves of body contraction, indicating that this quiescent state is rapidly reversible. Following a mechanical stimulation, the probability of a quiescent worm moving was 0.88, whereas the probability of spontaneously moving without stimulation (i.e., sham) was 0.12 (Fig. 2a), indicating that this quiescent behavior is reversible. We categorized the behavioral responses to mechanical stimulation on a 5-point ordinal scale: 0, no movement; 1, brief backing movement; 2, sustained backing movement; 3, omega turn; and 4 acceleration (Fig. 2b, Movie 1). If an animal was quiescent at the time of stimulation, it was less likely than an active animal to engage in complex movements (i.e., category 2 or greater; Fig. 2b). We also tested the responsiveness to 1-octanol, an aversive odor for worms (Hart et al., 1999; Fig. 2c). Among animals infected with Orsay virus, they responded more slowly when they were presented with 1-octanol during a quiescent bout (9.0 ± 1.1 s) compared with an active bout (3.1 ± 0.3 s). The results of these experiments are consistent with the sleep criteria of reversibility and reduced responsiveness to stimulation.

Sleep homeostasis is the propensity for sleep or depth of sleep to increase following prolonged wakefulness. A behavioral homeostatic response to deprivation of sleep in healthy animals has been observed widely among animals including mammals (Borbély and Neuhaus, 1979; Borbély et al., 1984; Tilley et al., 1987; Huber et al., 2000), insects (Tobler, 1983; Hendricks et al., 2000; Shaw et al., 2000), and nematodes (Raizen et al., 2008; Iwanir et al., 2013). In contrast, there have been few reports that attempt to demonstrate sleep homeostasis during sickness (Toth et al., 1995a; Kuo and Williams, 2014a). A challenge of those studies is that it is difficult to selectively deprive animals of sleep induced by infection without depriving them of healthy sleep that they engage in daily. In contrast when C. elegans are healthy they sleep during larval transitions (Raizen et al., 2008) and only rarely during adulthood. This model presents an opportunity to test for homeostatic regulation of sickness sleep without the confounding effect of healthy sleep.

To test if our quiescence state shows homeostasis, we disrupted movement quiescence in infected animals using mechanical stimulation. We delivered a 1 s vibrational stimulus at 30 s intervals for 60 min. We measured the fraction of time spent quiescent in the 1 h periods before, during, and after the stimulation period (Fig. 3a). A control experiment was recorded under the same protocol without providing stimulation (i.e., sham). During the stimulation period, there was a significant decrease from baseline in the fraction of time spent quiescent in the stimulation condition (−0.15 ± 0.24) compared with the sham condition (+0.10 ± 0.18; Fig. 3b, left), indicating that sleep deprivation was successful. During the 1 h period after completion of the stimulation (post), there was no difference in the change in quiescence from baseline between the sham (+0.14 ± 0.27) and stimulation (+0.10 ± 0.32) conditions (Fig. 3b, right). We also measured the duration of quiescence bouts as an estimate of sleep depth and found no difference in average bout duration following stimulation between sham (18.72 s ± 27.66) and stimulation (11.40 s ± 16.58) conditions (Fig. 3c). These results suggest that Orsay-induced quiescence is not subject to homeostatic rebound following deprivation.

Besides viral infection, sickness sleep in worms is caused by exposure to several cell stressors including ultraviolet light (UV), heat, cold, and osmotic shock (Hill et al., 2014; DeBardeleben et al., 2017). One behavioral consequence of these stressors is a phenomenon termed poststimulus response quiescence (PRQ), which is a brief period of quiescence that follows a mechanical stimulus. PRQ has also been described in animals with activation of the epidermal growth factor receptor (EGFR; McClanahan et al., 2020), which depolarizes the sleep-inducing neurons ALA and RIS (Van Buskirk and Sternberg, 2007; Turek et al., 2013; Nelson et al., 2014; Konietzka et al., 2020). To test whether infection induces a similar behavioral state to that induced by other stressors, we tested PRQ in Orsay-infected animals. We observed PRQ in infected worms (Fig. 3d,e), suggesting that infection engages similar molecular and neural pathways as those engaged by other stressors or by EGFR activation.

Together, these results indicate that, similar to previously studied forms of acute stress and sickness induced sleep, quiescence caused by Orsay virus infection is reversible and is associated with an elevated arousal threshold and with PRQ. We do not provide evidence that virus-induced quiescence is homeostatically regulated (see Discussion), although sickness sleep triggered by other stressors has also not been reported to be regulated homeostatically in worms (Hill et al., 2014; McClanahan et al., 2020) or in mammals (Toth, 1995; see Discussion). Based on our inability to determine whether virus-induced quiescence is homeostatically regulated, we will refer to this behavioral state as virus-induced quiescence throughout the remainder of this article.

Virus-induced quiescence is regulated by the ALA neuron which controls sickness induced quiescence

In response to brief stressors such as a 30 min heat shock or 20 s UV exposure (Hill et al., 2014; DeBardeleben et al., 2017), C. elegans enters stress-induced sleep (SIS). The underlying neural mechanisms of this quiescent response have been partially elucidated (Fig. 4a). Following exposure to cellular stressors, epidermal growth factor receptor (EGFR) ligands activate the sleep-active neurons ALA (Van Buskirk and Sternberg, 2007; Hill et al., 2014) and RIS (Turek et al., 2013). RIS releases sleep-promoting neuropeptides encoded by flp-11 (Turek et al., 2016), and ALA releases sleep-promoting neuropeptides encoded by flp-13, flp-24, and nlp-8 (Nelson et al., 2014; Nath et al., 2016). Maturation of most neuropeptides requires EGL-21 (Husson et al., 2007), which is a carboxypeptidase E (Jacob and Kaplan, 2003). FLP-13 peptides activate the G-protein coupled receptor (GPCR) DMSR-1, which inhibits wake-promoting neurons (Iannacone et al., 2017) and flp-11 signals via three other GPCRs (Turek et al., 2016). We set out to determine whether mechanisms controlling sleep during chronic Orsay virus infection are the same as those controlling sleep in response to acute stressors. We tested animals with loss-of-function mutations at multiple stages of this signaling pathway. After crossing these SIS mutants into an rde-1 mutant background, we measured movement quiescence (Fig. 4b) and feeding quiescence (Fig. 5b) in response to UV stress (Figs. 4b, 5b) and in response to Orsay infection (Figs. 4c–g, 5a).

We began by testing egl-21, which is required for neuropeptide maturation (Jacob and Kaplan, 2003). Removing egl-21 function should impair the function of both ALA and RIS, since both neurons use neuropeptides as transmitters (Nelson et al., 2014; Nath et al., 2016; Turek et al., 2016). Indeed, egl-21; rde-1 double mutants were highly defective in movement quiescence during Orsay infection (Fig. 4c, Movie 2), indicating that neuropeptides mediate movement quiescence. The egl-21 mutation did not affect feeding quiescence (Fig. 5a) during Orsay infection. Similarly, following acute UV light exposure, egl-21; rde-1 mutants were defective in movement but not feeding quiescence (Figs. 4b, 5b).

We used genetic approaches to impair the function of the ALA and RIS neurons. Disruption of the transcription factors ceh-17 or ceh-14 prevents the proper development of a small number of neurons that include ALA (Pujol et al., 2000; Van Buskirk and Sternberg, 2010). Animals with mutations in either ceh-17 or ceh-14 were defective in movement and feeding quiescence caused by Orsay infection (Figs. 4d,e, 5a; Movie 3), indicating that the ALA neuron is required for virus infection-induced quiescence. To disrupt development of RIS, we used a mutation in aptf-1, which encodes an AP2 transcription factor required for RIS function (Turek et al., 2013). While aptf-1; rde-1 double mutants were strongly defective for movement quiescence following a brief UV light exposure (Fig. 4b) as previously reported (Grubbs et al., 2020; Konietzka et al., 2020), these animals retained normal movement and feeding quiescence behavior during Orsay infection (Figs. 4f, 5a; Movie 4). In addition to aptf-1 mutants, we tested flp-11 mutants, which lack a somnogenic neuropeptide released from RIS. rde-1; flp-11 double mutants had a modest reduction in quiescence during Orsay infection compared with infected rde-1 mutant controls (Fig. 4g): there was a marginal p value for the interaction effect between genotype and infection (F_(1,142) = 2.92; p = 0.089), and a post hoc pairwise comparison among infected animals (t₍₁₄₂₎ = 2.6) had a p value of 0.02. Together, the mixed results from the aptf-1 and flp-11 mutant animals indicate that the RIS neuron plays a minor role in virus-induced sleep.

The lack of an effect of the aptf-1 mutation on Orsay-induced sleep was surprising given the prominent role of the RIS neuron in both stress-induced sleep (Konietzka et al., 2020) and developmentally timed sleep (Turek et al., 2013). It is possible that compensatory changes occur across development with the genetic apft-1 perturbation. To clarify the contradictory results regarding the role of RIS, we used histamine-gated chloride channels as a chemogenetic approach to silence this neuron exclusively in adulthood (Pokala et al., 2014). We targeted RIS by transgenically expressing HisCl1 under the flp-11 promoter (Turek et al., 2016).

During exposure to 10 mM histamine, flp-11p:HisCl1 infected animals had significantly reduced movement quiescence compared with controls (Fig. 4i). The effect of silencing RIS on Orsay-induced quiescence was modest (31% reduction in quiescence; Fig. 4i) in comparison with its effect on UV light-induced movement quiescence (95% reduction in quiescence; Fig. 4h). The lack of effect of aptf-1 and the relatively modest effects of flp-11 and RIS inactivation indicate that the RIS neuron plays a diminished role in virus-induced quiescence compared with acute stressors. Meanwhile, based on the effects of ceh-17 and ceh-14 on movement quiescence, the ALA neuron appears to play a comparable role in the responses to virus infection and acute stress.

Virus-induced quiescence is beneficial to survival

Sleep in response to microbial infection is conserved from invertebrates to humans (Toth and Krueger, 1988; Toth et al., 1995b; Mullington et al., 2000; Kuo et al., 2010), but the function of this behavioral response to sickness is poorly understood. One possibility is that reduced body movement and feeding is a consequence of the infection impairing neuromuscular function and is simply a correlate to infection. A more interesting possibility, which is supported by our above analysis, is that this sickness behavioral program is regulated by the nervous system to confer a benefit to the animal.

To evaluate whether virus-induced quiescence is an adaptive behavior, we compared the lifespan of infected control animals to that of infected animals with impaired quiescence. Infected rde-1 control mutants had reduced median lifespan compared with uninfected animals (6 vs 13 d), indicating that the virus posed a vital threat to the animal (Fig. 6a). Infected animals with defective ALA function (rde-1; ceh-17 and rde-1; ceh-14) had significantly reduced median lifespans compared with infected control rde-1 mutant animals (6 vs 4 d; Fig. 6a,b; Tables 4, 5).

Figure 6. — Increased mortality in Orsay virus infection due to reduced quiescence. a, b, Lifespan is reduced in Orsay-infected animals compared with uninfected controls. Among Orsay-infected animals, ALA defective mutants *ceh-17(np1); rde-1(n219)* (a) and *ceh-14(ch3); rde-1(n219)* (b) has reduced lifespan compared with infected *rde-1(n219)*. c, Among Orsay-infected animals, RIS *aptf-1(tm3287); rde-1(n219)* mutants do not have different lifespans compared with control *rde-1(n219)* animals. d, Chronic overexpression of somnogenic FLP-13 neuropeptides in Orsay virus infected ALA mutants [*ceh-17(np1);rde-1(ne219); hsp-16.2p:flp-13* black-outlined triangles] restores lifespan to levels similar to control infected animals [*rde-1(ne219)* gray-filled circles]. Worms of all genotypes were cultivated at 25°C. e, Chronic overexpression of *flp-13* causes movement quiescence. Stage 4 larvae (L4) of each genotype were incubated at 20°C (left) or 25°C (right) for 24 h and then transferred to the WorMotel as Day 1 adults and assayed for movement quiescence for 8 h at room temperature (20–22°C). Mean ± standard deviation. N = [4, 3, 19, 19], data are from 1 WorMotel. Kaplan–Meier survival curves. See Tables 4–7 for detailed statistics and sample sizes. ^nsp > 0.05; ***p < 0.001.

In contrast to ALA mutants, infected animals with a defective RIS (rde-1; aptf-1) did not differ from infected controls in median lifespan (6 vs 6 d; Fig. 6c, Table 6), supporting our aforementioned observations of reduced role for RIS in virus-infection induced sleep.

It is possible that the enhanced mortality of infected rde-1; ceh-17 mutants could be explained by a life-promoting function of ALA or of the ceh-17 mutation unrelated to quiescence. We hypothesized that the enhanced mortality was specifically caused by reduced quiescence and was unrelated to other effects of the ceh-17 mutation or of the ALA neuron. This hypothesis predicts that restoring quiescence in infected rde-1; ceh-17 mutants would improve survival. To restore quiescence, we transgenically overexpressed the somnogenic FLP-13 neuropeptides using a heat-responsive promoter. We incubated infected ceh-17; rde-1; hsp-16.2p:flp-13 animals at 25°C throughout their lifespan, in order to elicit elevated FLP-13 expression and increase sleep. This manipulation succeeded in elevating sleep chronically (Fig. 6e). Infected ceh-17; rde-1 mutants with flp-13 overexpression had an increased median lifespan (6 d) compared with infected ceh-17; rde-1 without flp-13 overexpression (3 d; Fig. 6d, Table 7), which were also cultivated at 25°C. These results indicate that quiescence driven by ALA and FLP-13 provides a survival benefit. Significant differences (below adjusted alpha) are displayed in bold.

In the flp-13 overexpression experiment, which was performed at 25°C, we observed a small but significant reduction in lifespan of uninfected ceh-17 mutants compared with controls (Fig. 6d, Table 7). Yet, in experiments performed at 20°C, there was no difference in longevity in the uninfected condition (Fig. 6a–c, Tables 4–6). The effect observed at 25°C might be explained by chronic heat stress, which, when applied acutely, is known to shorten lifespan in a ceh-17-dependent fashion (Hill et al., 2014; Fry et al., 2016; Konietzka et al., 2020). This heat-related reduced survival in uninfected ceh-17 mutants was rescued by flp-13 overexpression. Since infected ceh-17;rde-1;hsp-16.2p:flp-13 animals cultivated at 25°C did not have reduced survival compared with infected rde-1 animals cultivated at 25°C, we conclude that FLP-13 overexpression was sufficient to rescue deficit in survival due to either heat stress or infection.

Quiescence improves resilience to Orsay virus infection

Survival during infectious disease can be explained by either resistance or resilience to infection. Increased resistance to infection would manifest by a reduced pathogen load, whereas increased resilience would manifest by improved outcomes despite similar pathogen loads. We tested the hypothesis that the loss of virus-induced quiescence caused reduced resistance to virus infection, as manifested by increased viral load.

Using quantitative reverse-transcription polymerase chain reaction (qRT-PCR), we measured viral load in infected animals with an intact ALA neuron (rde-1) and in infected animals with a disrupted ALA neuron (ceh-17; rde-1). There was no significant difference in the levels of virus in these populations (Fig. 7a). This result suggested that the survival benefit of quiescence was due to enhanced resilience of infected animals, rather than an enhanced resistance to infection.

Figure 7. — Mechanisms of early demise in sleepless animals. a, Orsay virus load in infected animals [*rde-1(n219)*, N = 12] and ALA mutants [*ceh-17(np1); rde-1(n219)*, N = 12]. b, Intracellular pathogen response genes are upregulated during Orsay infection. Transcription of IPR genes increases in infected animals [*rde-1(n219)*] and infected ALA mutants [*ceh-17(np1); rde-1(n219)*] compared with uninfected animals. Two-way ANOVA with factors infection and genotype was performed separately for each gene and the main effect of Orsay infection is indicated on graph. There is neither a main effect of genotype nor an interaction effect between genotype and infection. N = 3–5 per group (see Table 3 for specifics). c, Bacteria colonize the intestine of Orsay-infected worms. GFP-expressing *E. coli* more rapidly infiltrate and escape the intestine of infected ALA mutants compared with infected controls. The y-axis indicates frequency for each score. For detailed statistics, see Table 8. d, Survival on UV-killed bacteria diet. Orsay-infected *rde-1(n219)* animals were fed either live or UV-killed GFP-expressing *E. coli* bacteria throughout their lifespan. Infected animals fed UV-killed bacteria had significantly increased lifespan compared with animals fed dead bacteria. Kaplan–Meier survival curve. For detailed statistics, see Table 9. e, Whole-animal ATP levels are reduced in ALA-defective animals during Orsay infection. ATP levels were not reduced in *rde-1(ne219)* infected animals compared with uninfected controls. ATP levels were reduced in infected ALA mutants [*ceh-17(np1); rde-1(n219)*] compared with uninfected animals. ^nsp > 0.05; *p < 0.05; ***p < 0.001.

Movie 1.

Download video file^{(1.4MB, mp4)}

DOI: 10.1523/JNEUROSCI.1700-22.2024.video1

Open in a new tab

Behavioral responses to mechanical stimulation. Worms were presented a vibrational stimulus during video recording on the WorMotel. Behavioral response to mechanical stimulation provides evidence for both the reversibility of viral infection-induced movement quiescence and its association with reduced responsiveness. Yellow box indicates time of stimulation. Videos show 10 s before and after stimulation. Behavioral responses were categorized into five types: (0) no response; (1) brief backing; (2) sustained backing; (3) turn or complex response; (4) acceleration. [View online]

Movie 2.

Download video file^{(5.5MB, mp4)}

DOI: 10.1523/JNEUROSCI.1700-22.2024.video2

Open in a new tab

Movement quiescence in egl-21 neuropeptide processing mutants. Example animals from 1 h recording on WorMotel. Red mask indicates movement detected by image subtraction. Clockwise from top left: Uninfected rde-1(ne219); Infected rde-1(ne219); Infected egl-21(n476); rde-1(ne219); Uninfected egl-21(n476); rde-1(ne219). [View online]

Movie 3.

Download video file^{(4.7MB, mp4)}

DOI: 10.1523/JNEUROSCI.1700-22.2024.video3

Open in a new tab

Movement quiescence in ceh-17 ALA mutants. Example animals from 1 h recording on WorMotel. Red mask indicates movement detected by image subtraction. Clockwise from top left: Uninfected rde-1(ne219); Infected rde-1(ne219); Infected ceh-17(np1); rde-1(ne219); Uninfected ceh-17(np1); rde-1(ne219). [View online]

Movie 4.

Download video file^{(6MB, mp4)}

DOI: 10.1523/JNEUROSCI.1700-22.2024.video4

Open in a new tab

Movement quiescence in aptf-1 RIS mutants. Example animals from 1 h recording on WorMotel. Red mask indicates movement detected by image subtraction. Clockwise from top left: Uninfected rde-1(ne219); Infected rde-1(ne219); Infected aptf-1(tm3287); rde-1(ne219); Uninfected aptf-1(tm3287); rde-1(ne219). [View online]

One possible explanation for resilience-promoting effects of quiescence is that it promotes a more robust host response to the pathogen. Following infection with Orsay virus, rde-1 animals engage in an intracellular pathogen response (IPR) which involves the increased transcription of several genes whose products collectively combat virus-induced cellular stress (Chen et al., 2017; Reddy et al., 2017). The most highly upregulated IPR transcripts show more than a 10-fold increase in expression following Orsay infection in rde-1 animals (Chen et al., 2017). We tested whether there was a deficit in the ability to upregulate these IPR transcripts in infected animals with disrupted ALA (ceh-17; rde-1). We focused on the most highly upregulated IPR transcripts: cul-6, skr-4, and skr-5, which encode components of the ubiquitin ligase system, as well as on F26F2.1, F26F2.3, F26F2.4, and pals-5, whose function is largely unknown. These IPR transcripts were upregulated to similar extents in infected animals in both rde-1 single mutant and ceh-17; rde-1 double mutant animals (Fig. 7b). These results suggest that the survival benefit of quiescence could not be attributed to the animals’ ability to activate the IPR in response to viral infection.

Next we sought to determine the cause of death in these animals and whether loss of quiescence accelerated this process. Since the Orsay virus infects the intestine, we reasoned that the cause of death may be related to intestinal dysfunction. In the laboratory, the worm's diet consists of the E. coli strain OP50 (Brenner, 1974). Worms mechanically disrupt bacteria in the pharynx before digestion in the intestine (Riddle et al., 1997). In uninfected worms, some OP50 bacteria colonize the intestinal lumen. The rate of colonization increases with age, and the density of colonization is negatively correlated to lifespan, indicating that OP50 intestinal colonization is pathogenic to the animal (Portal-Celhay et al., 2012). To determine whether Orsay virus infection influences bacterial colonization, we fed infected animals with GFP-expressing OP50 E. coli and measured green fluorescence in the intestine for the first 3 d of adulthood in rde-1 and ceh-17; rde-1 animals. We assessed animals on a 4-point ordinal scale ranging 0–3, where 0 denotes no GFP in the intestine; 1 denotes a small amount of GFP in the intestine; 2 denotes GFP along with intestinal distention; and 3 denotes GFP found in the body cavity beyond the intestine (Fig. 7c). Uninfected worms rarely had GFP present in their intestines even on Day 3 of adulthood: among 30 rde-1 mutants and 30 ceh-17; rde-1 double mutants, only one animal had any GFP in the intestine. In contrast, Orsay-infected rde-1 mutant animals often had green gut fluorescence, with >50% of animals showing gut lumen fluorescence by Day 2 of adulthood (Fig. 7c, Table 8). By Day 1 of adulthood, there were significantly more ceh-17; rde-1 animals with intestinal GFP (score greater than 0) compared with rde-1 single mutant worms (Fig. 7c, Table 8). By Day 3 of adulthood, there were significantly more ceh-17; rde-1 animals with GFP present in the body cavity (score 3) compared with rde-1 animals (Fig. 7c, Table 8). The presence of GFP in the intestine of infected animals indicated that E. coli was able to evade digestion in young worms, which are typically resistant to E. coli colonization. The presence of bacteria outside of the intestine in ceh-17; rde-1 double mutant animals suggests that the loss of sleep during infection leaves the intestinal epithelium vulnerable. These observations suggested the hypothesis that the early death in Orsay-infected animals is related to decreased resistance to secondary infection by bacteria and that quiescence enhances resistance to this secondary infection.

Table 8.

Bacteria colonize the intestine of Orsay-infected worms more quickly in ALA mutant animals: contingency tables and statistical comparisons in Figure 7c

	Day	Genotype	Score				Comparison
	Day	Genotype	0: No GFP	1: Low GFP, no distension	2: High GFP, no distension	3: GFP in body cavity	Any GFP (score ≥1/total)	GFP outside of gut (score 3/total)
Number of comparisons: 6 Family-wise α: 0.05 Adjusted α: 0.0083	1	rde-1(-)	19	1	0	0	1/20	0/20
		ceh-17(-); rde-1(-)	11	5	3	1	9/20	1/20
							p = 0.008	p > 0.99
	2	rde-1(-)	9	2	9	0	11/20	0/20
		ceh-17(-); rde-1(-)	3	7	4	6	17/20	6/20
							p = 0.08	p = 0.02
	3	rde-1(-)	10	7	3	0	10/20	0/20
		ceh-17(-); rde-1(-)	1	8	3	9	19/20	9/20
							p = 0.003	p = 0.001

Open in a new tab

On each day, Fisher's exact test was performed on two types of data. First, the frequency of animals with any score greater than 0 (Any GFP) was compared between genotypes. Second, the frequency of animals with a score of 3 (GFP outside of gut) was compared between genotypes. Significant differences (below adjusted alpha) are displayed in bold.

To test this hypothesis, we measured lifespan in infected animals fed a dead-bacteria diet. We reasoned that if these worms die prematurely due to bacterial infection, then a dead-bacteria diet should extend lifespan among infected animals. Infected animals on a UV-killed bacteria diet survived significantly longer than infected animals on a live diet, with an increased median lifespan of 34% (5.1 vs 3.8 d; p = 0.016; Fig. 7d, Table 9). The UV-killed bacteria diet also significantly increased the lifespan of uninfected animals, with an increase of 8.0% in median lifespan compared with the live bacteria diet (18.9 vs 17.5 d, p = 0.028; Fig. 7d, Table 9). Notably, infected animals on the dead-bacteria diet still had greatly reduced survival compared with uninfected animals (5.1 vs 18.9 d, 66.5% reduction), as was the case with the live bacteria diet (3.8 vs 17.5 d, 73.3% reduction). Together, these results suggest that E. coli superinfection plays a small role in the decreased lifespan in virus infection.

Finally, we tested the hypothesis that the resilience-promoting effects of quiescence are explained by an improved energetic state. Sleep confers an overall energy-saving effect on whole animal physiology (Walker and Berger, 1980) and is associated with altered metabolism (Houthoofd et al., 2005; Schmidt, 2014; Nowak et al., 2021). Several genetic manipulations in C. elegans have been shown to affect animal energy stores, as evident by differences in total animal ATP levels (Palikaras and Tavernarakis, 2016; Grubbs et al., 2020). We therefore measured ATP levels in infected and uninfected animals with intact and disrupted ALA function.

Orsay infection is associated with a decrease in ATP in rde-1; ceh-17 double mutants compared with uninfected rde-1; ceh-17 worms, but no significant difference between uninfected and infected control rde-1 mutants (Fig. 7e). Because ceh-17; rde-1 animals have reduced survival when infected, it remains possible that the observed ATP reduction is a result of early death in these animals. However, since we did not observe dead animals when we collected ATP samples on Day 1 of adulthood and survival rates among these animals began to diverge from controls only on Day 3 of adulthood (Fig. 6a,b), we favor the conclusion that the ATP reduction is caused by lack of sleep during infection and that the resilience benefit of sleep arises from increased energy conservation.

Discussion

We have characterized a quiescent state associated with viral infection in a nematode. This behavioral state meets the behavioral criteria for sleep including immobility, rapid reversibility, and reduced responsiveness; however, we did not find evidence that this behavior is homeostatically regulated. However, we cannot conclude that quiescence is not homeostatically regulated, since it remains possible that we failed to detect sleep rebound through our particular experimental paradigm.

Our findings are not inconsistent with the literature. Sleep homeostasis has not been observed for other forms of stress-induced sleep in C. elegans (Hill et al., 2014; McClanahan et al., 2020), and infected sleep-deprived rabbits do not show increased recovery sleep compared with uninfected sleep-deprived animals (Toth et al., 1995a). Although rebound sleep has been observed following sleep deprivation of infected fruit flies (Kuo and Williams, 2014a), the flies in those experiments were also likely deprived of healthy circadian sleep, confounding interpretation. In this study, we provide evidence that loss of this quiescence behavior leads to reduced survival of viral infection, suggesting that this behavioral state plays a critical role in maintaining physiological homeostasis of life-sustaining processes. We submit that demonstrating a homeostatic behavioral response is not essential to distinguish sleep from other states of immobility such as coma, torpor, tonic immobility, or general anesthesia (Anafi et al., 2019). Regardless of whether this behavioral state may be considered sleep per se, mechanisms underlying this experimental model are relevant to the elements of sickness behavior in other animals that involve lethargy, fatigue, and sleep. Given the chronic nature of our experimental paradigm, we believe that our model is most relevant to severe or prolonged sickness.

We and others have previously characterized nematode sleep during development (Van Buskirk and Sternberg, 2007; Raizen et al., 2008; Singh et al., 2011; Turek et al., 2013) and in response to acute stress (SIS; Hill et al., 2014; Nelson et al., 2014; DeBardeleben et al., 2017; Sinner et al., 2021). Acute SIS requires the activity of the ALA and RIS neurons (Hill et al., 2014; Konietzka et al., 2020; Chávez-Pérez et al., 2021). One proposed interpretation of the observation of the role of the ALA neuron in sleep regulation is that it functions to promote “drowsiness” but not necessarily sleep (Konietzka et al., 2020).

However, our data indicates that ALA is central to the sleep in response to Orsay virus infection. In contrast, the RIS neuron, which has a central role in promoting developmentally timed sleep as well as sleep in response to acute stressors (Turek et al., 2013; Wu et al., 2018; Konietzka et al., 2020), plays a small role in the regulation of sleep in the setting of Orsay virus infection. Disrupting RIS development using an aptf-1 mutation does not affect Orsay-induced sleep (Fig. 3f), while this mutation causes a near complete loss of sleep following acute heat or UV stress (Fig. 3b; Konietzka et al., 2020; Chávez-Pérez et al., 2021), as well as a severe deficit in developmentally timed sleep (Turek et al., 2013). RIS is required for sleep during other chronic states such as in starved L1 animals (Wu et al., 2018), indicating that the weak effect on Orsay-induced sleep is unlikely to be explained by the chronic nature of the virus infection compared with the acute heat or UV stress. Hence, while RIS plays a central role in the regulation of sleep in response to acute stressors and in the chronic L1 diapause, it plays a relatively minor role in the regulation of sleep in the setting of Orsay virus infection.

Both during Orsay virus infection and following acute UV light exposure, neuropeptide processing by EGL-21 is required for movement quiescence but not feeding quiescence (Figs. 3b,c, 4a,b). egl-21 encodes a carboxypeptidase E (Jacob and Kaplan, 2003) that is required for the maturation of most C. elegans neuropeptides (Husson et al., 2007). This observation suggests that feeding quiescence in SIS is either not mediated by neuropeptides or is mediated by neuropeptides that do not require processing by EGL-21. Interestingly, NLP-8 and FLP-24, sleep-promoting neuropeptides that are expressed in ALA and contribute to feeding quiescence (Nath et al., 2016), do not require EGL-21 for proper processing (Husson et al., 2007).

Our results underscore the complexity of sleep regulation and suggest that similar or greater complexity may be observed during sickness behavior in mammals. Indeed, this complexity may provide an explanation for the identification of several brain regions each promoting sleep in mammals. Unlike C. elegans, mammals engage in daily sleep behavior, which is controlled by a circadian clock and homeostatic sleep drive (Saper et al., 2010). Mammalian sleep consists of both slow wave sleep (SWS) and rapid eye movement sleep (REMs), which arise from activity in partially distinct brain regions (Anaclet et al., 2014; Weber et al., 2015, 2018; Chung et al., 2017; Kroeger et al., 2018; Zhang et al., 2019; Stucynski et al., 2022). During sickness, mammals also engage in sleep outside of the two-process model (Krueger et al., 1986; Toth and Krueger, 1988; Fang et al., 1995). This sleep behavior is dominated by SWS at the expense of REMs (Krueger et al., 1986). Mammalian sickness sleep occurs in response to bacterial and viral infection, through communication from somatic cells to the central nervous system by inflammatory cytokines (Szentirmai and Krueger, 2014) and vagal nerve activity (Zielinski et al., 2013).

Similarly in C. elegans, distinct neurons contribute to sleep behavior leading to distinct behavioral and physiological consequences. Although ALA and RIS both contribute to sleep following stress, loss of signaling from these two neurons produces distinct movement (Robinson et al., 2019; Chávez-Pérez et al., 2021) and feeding (Grubbs et al., 2020) phenotypes. Moreover, loss of ALA but not RIS function reduces survival following heat shock (Konietzka et al., 2020) as well as viral infection (Fig. 6), suggesting that the functions of these two neurons are different. This complexity in a simple nervous system informs our understanding of sleep control in mammals. For example, the physiological consequences of mammalian sleep may depend on the brain region promoting that sleep.

Early death of animals lacking the ALA neuron could not be explained by an increase in pathogen load among this group. Animals that lack ALA function maintain a robust transcriptional response to viral infection, indicating that loss of sleep does not prevent the animals from detecting the pathogen and initiating an immune response. These findings suggest that the increased survival from sleep is not due to differences in resistance to viral infection, but rather to increased resilience.

Bacteria, which make up the worm's diet, colonize the gut in infected animals and do so more rapidly in ALA mutant animals. In infected ALA mutants, bacteria have penetrated the gut epithelium and infected the body cavity by Day 3 of adulthood. A dead-bacteria diet causes only a modest improvement in survival for Orsay-infected animals, indicating that bacterial infection contributes to the early death of infected animals but that bacterial infection is not the primary cause of early death. Dysregulation of the gut environment is not surprising, given that the Orsay virus selectively infects the intestinal epithelium (Franz et al., 2014). Sleep loss appears to exacerbate damage to the integrity of infected gut cells. Similarly, sleep deprivation in fruit flies reduces gut integrity through accumulation of reactive oxygen species, leading to premature death (Vaccaro et al., 2020). Together, these results suggest that sleep plays a role in maintaining the health of the gut epithelium.

Improved resilience in sleeping animals is associated with higher levels of ATP during infection. This observation points to a mechanism whereby sleeping animals have increased energy stores and better cope with infection. Three possible explanations could account for reduced ATP levels in the sleepless infected animals. First, awake animals incur the increased energy demands of feeding and moving. Second, sleepless animals have decreased integrity of the gut epithelium, leading to disrupted digestion and nutrient extraction. Third, sleeping animals may extract more energy from nutrients by changing metabolic regulation. For example, a shift from glycolysis to the use of the TCA cycle would result in more ATP generated from sugar catabolism.

This explanation is consistent with the finding that exhaled metabolites vary across sleep cycles in humans, with a tight correlation between specific metabolic states and sleep stages (Nowak et al., 2021). In the mouse cerebral cortex, the rate of aerobic glycolysis is significantly reduced during SWS compared with wakefulness (Wisor et al., 2013). In our paradigm, the metabolic changes that occur during SIS may compensate for the energetic demands of the virus.

There is debate regarding the core function of sleep, with leading theories proposing a role for synaptic homeostasis and learning (Tononi and Cirelli, 2003), energy allocation (Schmidt, 2014), and energy conservation (Berger and Phillips, 1995). Among these, our data suggests that, at least in the case of sleep during sickness, energy allocation and energy conservation are central to the function of sleep. Our evidence points to a model where improved resilience to viral infection relies on metabolic changes that occur during sickness sleep.

Our experimental model of SIS during chronic viral infection is relevant to the persistent illness experienced in patients with chronic viral infection or from post-viral syndromes such as postacute sequelae of SARS CoV-2 infection (Proal and VanElzakker, 2021). Since we use animals that are particularly susceptible to infection and generate a high viral load, our experimental model may be more relevant to sickness and fatigue experienced during severe sickness. By identifying the neural and genetic mechanisms of sleep caused by chronic infectious or post-infectious diseases, we will better understand the disabling fatigue reported in these illnesses.

References

Anaclet C, Ferrari L, Arrigoni E, Bass CE, Saper CB, Lu J, Fuller PM (2014) The GABAergic parafacial zone is a medullary slow wave sleep-promoting center. Nat Neurosci 17:1217–1224. 10.1038/nn.3789 [DOI] [PMC free article] [PubMed] [Google Scholar]
Anafi RC, Kayser MS, Raizen DM (2019) Exploring phylogeny to find the function of sleep. Nat Rev Neurosci 20:109–116. 10.1038/s41583-018-0098-9 [DOI] [PubMed] [Google Scholar]
Ashe A, Sarkies P, Le Pen J, Tanguy M, Miska EA (2015) Antiviral RNA interference against Orsay virus is neither systemic nor transgenerational in Caenorhabditis elegans. J Virol 89:12035–12046. 10.1128/JVI.03664-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
Barstead R, et al. (2012) Large-scale screening for targeted knockouts in the caenorhabditis elegans genome. G3 (Bethesda) 3:1415–1425. 10.1534/g3.112.003830 [DOI] [PMC free article] [PubMed] [Google Scholar]
Baugh LR, DeModena J, Sternberg PW (2009) RNA Pol II accumulates at promoters of growth genes during developmental arrest. Science 324:92–94. 10.1126/science.1169628 [DOI] [PubMed] [Google Scholar]
Berger RJ, Phillips NH (1995) Energy conservation and sleep. Behav Brain Res 69:65–73. 10.1016/0166-4328(95)00002-B [DOI] [PubMed] [Google Scholar]
Borbély AA, Neuhaus HU (1979) Sleep-deprivation: effects on sleep and EEG in the rat. J Comp Physiol A 133:71–87. 10.1007/BF00663111 [DOI] [Google Scholar]
Borbély AA, Tobler I, Hanagasioglu M (1984) Effect of sleep deprivation on sleep and EEG power spectra in the rat. Behav Brain Res 14:171–182. 10.1016/0166-4328(84)90186-4 [DOI] [PubMed] [Google Scholar]
Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77:71–94. 10.1093/genetics/77.1.71 [DOI] [PMC free article] [PubMed] [Google Scholar]
Campbell SS, Tobler I (1984) Animal sleep: a review of sleep duration across phylogeny. Neurosci Biobehav Rev 8:269–300. 10.1016/0149-7634(84)90054-X [DOI] [PubMed] [Google Scholar]
Cassata G, Kagoshima H, Andachi Y, Kohara Y, Dürrenberger MB, Hall DH, Bürglin TR (2000) The LIM homeobox gene ceh-14 confers thermosensory function to the AFD neurons in Caenorhabditis elegans. Neuron 25:587–597. 10.1016/s0896-6273(00)81062-4 [DOI] [PubMed] [Google Scholar]
Chalfie M, Sulston JE, White JG, Southgate E, Thomson JN, Brenner S (1985) The neural circuit for touch sensitivity in Caenorhabditis elegans. J Neurosci 5:956–964. 10.1523/JNEUROSCI.05-04-00956.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
Chávez-Pérez C, Jafari N, Keenan BT, Raizen DM, Rohacek AM (2021) Motivated displacement assay distinguishes ALA neuron mutants from RIS neuron mutants during recovery from heat stress in Caenorhabditis elegans. MicroPubl Biol 2021. 10.17912/micropub.biology.000468 [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen K, Franz CJ, Jiang H, Jiang Y, Wang D (2017) An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18:303. 10.1186/s12864-017-3689-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
Chung S, et al. (2017) Identification of preoptic sleep neurons using retrograde labeling and gene profiling. Nature 545:477. 10.1038/nature22350 [DOI] [PMC free article] [PubMed] [Google Scholar]
Churgin MA, Szuperak M, Davis KC, Raizen DM, Fang-Yen C, Kayser MS (2019) Quantitative imaging of sleep behavior in Caenorhabditis elegans and larval Drosophila melanogaster. Nat Protoc 14:1455–1488. 10.1038/s41596-019-0146-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
Davis MW, Somerville D, Lee Ryn, Lockery S, Avery L, Fambrough DM (1995) Mutations in the Caenorhabditis elegans Na,K-ATPase alpha-subunit gene, eat-6, disrupt excitable cell function. J Neurosci 15:8408–8418. 10.1523/JNEUROSCI.15-12-08408.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
DeBardeleben H, Lopes LE, Nessel M, Raizen DM (2017) Stress-induced sleep after exposure to ultraviolet light is promoted by p53 in Caenorhabditis elegans. Genetics 207:571–582. 10.1534/genetics.117.300070 [DOI] [PMC free article] [PubMed] [Google Scholar]
Deboer T (2013) Behavioral and electrophysiological correlates of sleep and sleep homeostasis. Curr Top Behav Neurosci 25:1–24. 10.1007/7854_2013_248 [DOI] [PubMed] [Google Scholar]
Fang J, Sanborn CK, Renegar KB, Majde JA, Krueger JM (1995) Influenza viral infections enhance sleep in mice. Proc Soc Exp Biol Med 210:242–252. 10.3181/00379727-210-43945 [DOI] [PubMed] [Google Scholar]
Fay D (2006) Genetic mapping and manipulation: chapter 7-making compound mutants. WormBook 1:1–4. 10.1895/wormbook.1.96.2 [DOI] [PMC free article] [PubMed] [Google Scholar]
Félix M-A, et al. (2011) Natural and experimental infection of Caenorhabditis nematodes by novel viruses related to nodaviruses Hodgkin J, ed. PLoS Biol 9:e1000586. 10.1371/journal.pbio.1000586 [DOI] [PMC free article] [PubMed] [Google Scholar]
Franz CJ, Renshaw H, Frezal L, Jiang Y, Félix M-A, Wang D (2014) Orsay, Santeuil and Le Blanc viruses primarily infect intestinal cells in Caenorhabditis nematodes. Virology 448:255–264. 10.1016/j.virol.2013.09.024 [DOI] [PubMed] [Google Scholar]
Fry AL, Laboy JT, Huang H, Hart AC, Norman KR (2016) A conserved GEF for Rho-family GTPases acts in an EGF signaling pathway to promote sleep-like quiescence in Caenorhabditis elegans. Genetics 202:1153–1166. 10.1534/genetics.115.183038 [DOI] [PMC free article] [PubMed] [Google Scholar]
Grubbs JJ, Lopes LE, van der Linden AM, Raizen DM (2020) A salt-induced kinase is required for the metabolic regulation of sleep. PLoS Biol 18:e3000220. 10.1371/journal.pbio.3000220 [DOI] [PMC free article] [PubMed] [Google Scholar]
Han SK, Lee D, Lee H, Kim D, Son HG, Yang J-S, Lee SV, Kim S (2016) OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget 7:56147–56152. 10.18632/oncotarget.11269 [DOI] [PMC free article] [PubMed] [Google Scholar]
Harmon JL, Barroso J, Pence BW, Leserman J, Salahuddin N (2008) Demographic and illness-related variables associated with HIV-related fatigue. J Assoc Nurses AIDS Care 19:90. 10.1016/j.jana.2007.08.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hart AC, Kass J, Shapiro JE, Kaplan JM (1999) Distinct signaling pathways mediate touch and osmosensory responses in a polymodal sensory neuron. J Neurosci 19:1952–1958. 10.1523/JNEUROSCI.19-06-01952.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hendricks JC, Finn SM, Panckeri KA, Chavkin J, Williams JA, Sehgal A, Pack AI (2000) Rest in Drosophila is a sleep-like state. Neuron 25:129–138. 10.1016/S0896-6273(00)80877-6 [DOI] [PubMed] [Google Scholar]
Hill AJ, Mansfield R, Lopez JMNG, Raizen DM, Van Buskirk C (2014) Cellular stress induces a protective sleep-like state in C. elegans. Curr Biol 24:2399–2405. 10.1016/j.cub.2014.08.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
Houthoofd K, Braeckman BP, Lenaerts I, Brys K, Matthijssens F, De Vreese A, Van Eygen S, Vanfleteren JR (2005) DAF-2 pathway mutations and food restriction in aging Caenorhabditis elegans differentially affect metabolism. Neurobiol Aging 26:689–696. 10.1016/j.neurobiolaging.2004.06.011 [DOI] [PubMed] [Google Scholar]
Huber R, Deboer T, Tobler I (2000) Effects of sleep deprivation on sleep and sleep EEG in three mouse strains: empirical data and simulations. Brain Res 857:8–19. 10.1016/S0006-8993(99)02248-9 [DOI] [PubMed] [Google Scholar]
Husson SJ, Janssen T, Baggerman G, Bogert B, Kahn-Kirby AH, Ashrafi K, Schoofs L (2007) Impaired processing of FLP and NLP peptides in carboxypeptidase E (EGL-21)-deficient Caenorhabditis elegans as analyzed by mass spectrometry. J Neurochem 102:246–260. 10.1111/j.1471-4159.2007.04474.x [DOI] [PubMed] [Google Scholar]
Iannacone MJ, Beets I, Lopes LE, Churgin MA, Fang-Yen C, Nelson MD, Schoofs L, Raizen DM (2017) The RFamide receptor DMSR-1 regulates stress-induced sleep in C. elegans. Elife 6:377–391. 10.7554/eLife.19837 [DOI] [PMC free article] [PubMed] [Google Scholar]
Iwanir S, Tramm N, Nagy S, Wright C, Ish C, Biron D (2013) The microarchitecture of C. elegans behavior during lethargus: homeostatic bout dynamics, a typical body posture, and regulation by a central neuron. Sleep 36:385–395. 10.5665/sleep.2456 [DOI] [PMC free article] [PubMed] [Google Scholar]
Jacob TC, Kaplan JM (2003) The EGL-21 carboxypeptidase E facilitates acetylcholine release at Caenorhabditis elegans neuromuscular junctions. J Neurosci 23:2122–2130. 10.1523/JNEUROSCI.23-06-02122.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
Konietzka J, et al. (2020) Epidermal growth factor signaling promotes sleep through a combined series and parallel neural circuit. Curr Biol 30:1–16.e13. 10.1016/j.cub.2019.10.048 [DOI] [PubMed] [Google Scholar]
Kroeger D, et al. (2018) Galanin neurons in the ventrolateral preoptic area promote sleep and heat loss in mice. Nat Commun 9:4129. 10.1038/s41467-018-06590-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
Krueger JM, Kubillus S, Shoham S, Davenne D (1986) Enhancement of slow-wave sleep by endotoxin and lipid A. Am J Physiol 251:R591–R597. 10.1152/ajpregu.1986.251.3.R591 [DOI] [PubMed] [Google Scholar]
Kuo T-H, Pike DH, Beizaeipour Z, Williams JA (2010) Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFκB Relish. BMC Neurosci 11:17. 10.1186/1471-2202-11-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
Kuo T-H, Williams JA (2014a) Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. Sleep 37:859–869. 10.5665/sleep.3648 [DOI] [PMC free article] [PubMed] [Google Scholar]
Kuo T-H, Williams JA (2014b) Increased sleep promotes survival during a bacterial infection in Drosophila. Sleep 37:1077–1086. 10.5665/sleep.3764 [DOI] [PMC free article] [PubMed] [Google Scholar]
Labrousse A, Chauvet S, Couillault C, Kurz CL, Ewbank JJ (2000) Caenorhabditis elegans is a model host for Salmonella typhimurium. Curr Biol 10:1543–1545. 10.1016/S0960-9822(00)00833-2 [DOI] [PubMed] [Google Scholar]
Lapshina KV, Ekimova IV (2010) Effects of sleep deprivation on measures of the febrile reaction and the recovery of somatovisceral functions and sleep in endotoxemia. Neurosci Behav Physiol 40:381–388. 10.1007/s11055-010-9268-6 [DOI] [PubMed] [Google Scholar]
McClanahan PD, Dubuque JM, Kontogiorgos-Heintz D, Habermeyer BF, Xu JH, Ma AM, Raizen DM, Fang-Yen C (2020) A quiescent state following mild sensory arousal in Caenorhabditis elegans is potentiated by stress. Sci Rep 10:4140. 10.1038/s41598-020-60994-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
Mullington J, Korth C, Hermann DM, Orth A, Galanos C, Holsboer F, Pollmächer T (2000) Dose-dependent effects of endotoxin on human sleep. Am J Physiol Regul Integr Comp Physiol 278:947–955. 10.1152/ajpregu.2000.278.4.R947 [DOI] [PubMed] [Google Scholar]
Nath RD, Chow ES, Wang H, Schwarz EM, Sternberg PW (2016) C. elegans stress-induced sleep emerges from the collective action of multiple neuropeptides. Curr Biol 26:2446–2455. 10.1016/j.cub.2016.07.048 [DOI] [PMC free article] [PubMed] [Google Scholar]
Nelson MD, Lee KH, Churgin MA, Hill AJ, Van Buskirk C, Fang-Yen C, Raizen DM (2014) FMRFamide-like FLP-13 neuropeptides promote quiescence following heat stress in Caenorhabditis elegans. Curr Biol 24:2406–2410. 10.1016/j.cub.2014.08.037 [DOI] [PMC free article] [PubMed] [Google Scholar]
Nowak N, et al. (2021) Rapid and reversible control of human metabolism by individual sleep states. Cell Rep 37:109903. 10.1016/j.celrep.2021.109903 [DOI] [PubMed] [Google Scholar]
Palikaras K, Tavernarakis N (2016) Intracellular assessment of ATP levels in Caenorhabditis elegans. Bio Protoc 6:2048. 10.21769/BioProtoc.2048 [DOI] [PMC free article] [PubMed] [Google Scholar]
Pokala N, Liu Q, Gordus A, Bargmann CI (2014) Inducible and titratable silencing of Caenorhabditis elegans neurons in vivo with histamine-gated chloride channels. Proc Natl Acad Sci U S A 111:2770–2775. 10.1073/pnas.1400615111 [DOI] [PMC free article] [PubMed] [Google Scholar]
Portal-Celhay C, Bradley ER, Blaser MJ (2012) Control of intestinal bacterial proliferation in regulation of lifespan in Caenorhabditis elegans. BMC Microbiol 12:49. 10.1186/1471-2180-12-49 [DOI] [PMC free article] [PubMed] [Google Scholar]
Proal AD, VanElzakker MB (2021) Long COVID or post-acute sequelae of COVID-19 (PASC): an overview of biological factors that may contribute to persistent symptoms. Front Microbiol 12:698169. 10.3389/fmicb.2021.698169 [DOI] [PMC free article] [PubMed] [Google Scholar]
Pujol N, Torregrossa P, Ewbank JJ, Brunet JF (2000) The homeodomain protein CePHOX2/CEH-17 controls antero-posterior axonal growth in C. elegans. Development 127:3361–3371. 10.1242/dev.127.15.3361 [DOI] [PubMed] [Google Scholar]
Raizen DM, Zimmerman JE, Maycock MH, Ta UD, You Y, Sundaram MV, Pack AI (2008) Lethargus is a Caenorhabditis elegans sleep-like state. Nature 451:569–572. 10.1038/nature06535 [DOI] [PubMed] [Google Scholar]
Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER (2017) An intracellular pathogen response pathway promotes proteostasis in C. elegans. Curr Biol 27:3544–3553. 10.1016/j.cub.2017.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
Riddle DL, Blumenthal T, Meyer BJ, Priess JR (1997) Section II: Feeding. In: C. elegans II, Ed 2, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
Robinson B, Goetting DL, Desir JC, van Buskirk C (2019) aptf-1 mutants are primarily defective in head movement quiescence during C. elegans sleep. MicroPubl Biol 2019. 10.17912/micropub.biology.000148 [DOI] [PMC free article] [PubMed] [Google Scholar]
Saper CB, Fuller PM, Pedersen NP, Lu J, Scammell TE (2010) Sleep state switching. Neuron 68:1023. 10.1016/j.neuron.2010.11.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
Schmidt MH (2014) The energy allocation function of sleep: a unifying theory of sleep, torpor, and continuous wakefulness. Neurosci Biobehav Rev 47:122–153. 10.1016/j.neubiorev.2014.08.001 [DOI] [PubMed] [Google Scholar]
Shaw PJ, Cirelli C, Greenspan RJ, Tononi G (2000) Correlates of sleep and waking in Drosophila melanogaster. Science 287:1834–1837. 10.1126/science.287.5459.1834 [DOI] [PubMed] [Google Scholar]
Singh K, et al. (2011) C. elegans notch signaling regulates adult chemosensory response and larval molting quiescence. Curr Biol 21:825–834. 10.1016/j.cub.2011.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
Sinner MP, Masurat F, Ewbank JJ, Pujol N, Bringmann H (2021) Innate immunity promotes sleep through epidermal antimicrobial peptides. Curr Biol 31:564–577.e12. 10.1016/j.cub.2020.10.076 [DOI] [PubMed] [Google Scholar]
Stiernagle T (2006) Maintenance of C. elegans. WormBook 1:1–11. 10.1895/wormbook.1.101.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
Stucynski JA, Schott AL, Baik J, Chung S, Weber F (2022) Regulation of REM sleep by inhibitory neurons in the dorsomedial medulla. Curr Biol 32:37–50.e6. 10.1016/j.cub.2021.10.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
Szentirmai É, Krueger JM (2014) Sickness behaviour after lipopolysaccharide treatment in ghrelin deficient mice. Brain Behav Immun 36:200–206. 10.1016/j.bbi.2013.11.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
Tabara H, Sarkissian M, Kelly WG, Fleenor J, Grishok A, Timmons L, Fire A, Mello CC (1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123–132. 10.1016/S0092-8674(00)81644-X [DOI] [PubMed] [Google Scholar]
Tilley A, Donohoe F, Hensby S (1987) Homeostatic changes in slow wave sleep during recovery sleep following restricted nocturnal sleep and partial slow wave sleep recovery during an afternoon nap. Sleep 10:600–605. [PubMed] [Google Scholar]
Tobler I (1983) Effect of forced locomotion on the rest-activity cycle of the cockroach. Behav Brain Res 8:351–360. 10.1016/0166-4328(83)90180-8 [DOI] [PubMed] [Google Scholar]
Tononi G, Cirelli C (2003) Sleep and synaptic homeostasis: a hypothesis. Brain Res Bull 62:143–150. 10.1016/j.brainresbull.2003.09.004 [DOI] [PubMed] [Google Scholar]
Toth LA (1995) Sleep, sleep deprivation and infectious disease: studies in animals. Adv Neuroimmunol 5:79–92. 10.1016/0960-5428(94)00045-P [DOI] [PubMed] [Google Scholar]
Toth LA, Krueger JM (1988) Alteration of sleep in rabbits by Staphylococcus aureus infection. Infect Immun 56:1785–1791. 10.1128/iai.56.7.1785-1791.1988 [DOI] [PMC free article] [PubMed] [Google Scholar]
Toth LA, Opp MR, Mao L (1995a) Somnogenic effects of sleep deprivation and Escherichia coli inoculation in rabbits. J Sleep Res 4:30–40. 10.1111/j.1365-2869.1995.tb00148.x [DOI] [PubMed] [Google Scholar]
Toth LA, Rehg JE, Webster RG (1995b) Strain differences in sleep and other pathophysiological sequelae of influenza virus infection in naive and immunized mice. J Neuroimmunol 58:89–99. 10.1016/0165-5728(94)00193-R [DOI] [PubMed] [Google Scholar]
Turek M, Besseling J, Spies JP, König S, Bringmann H (2016) Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep. Elife 5. 10.7554/eLife.12499 [DOI] [PMC free article] [PubMed] [Google Scholar]
Turek M, Lewandrowski I, Bringmann H (2013) An AP2 transcription factor is required for a sleep-active neuron to induce sleep-like quiescence in C. elegans. Curr Biol 23:2215–2223. 10.1016/j.cub.2013.09.028 [DOI] [PubMed] [Google Scholar]
Vaccaro A, Kaplan Dor Y, Nambara K, Pollina EA, Lin C, Greenberg ME, Rogulja D (2020) Sleep loss can cause death through accumulation of reactive oxygen species in the gut. Cell 181:1307–1328.e15. 10.1016/j.cell.2020.04.049 [DOI] [PubMed] [Google Scholar]
Van Buskirk C, Sternberg PW (2007) Epidermal growth factor signaling induces behavioral quiescence in Caenorhabditis elegans. Nat Neurosci 10:1300–1307. 10.1038/nn1981 [DOI] [PubMed] [Google Scholar]
Van Buskirk C, Sternberg PW (2010) Paired and LIM class homeodomain proteins coordinate differentiation of the C. elegans ALA neuron. Development 137:2065–2074. 10.1242/dev.040881 [DOI] [PMC free article] [PubMed] [Google Scholar]
Walker JM, Berger RJ (1980) Sleep as an adaptation for energy conservation functionally related to hibernation and shallow torpor. Prog Brain Res 53:255–278. 10.1016/S0079-6123(08)60068-0 [DOI] [PubMed] [Google Scholar]
Weber F, Chung S, Beier KT, Xu M, Luo L, Dan Y (2015) Control of REM sleep by ventral medulla GABAergic neurons. Nature 526:435. 10.1038/nature14979 [DOI] [PMC free article] [PubMed] [Google Scholar]
Weber F, Hoang Do JP, Chung S, Beier KT, Bikov M, Saffari Doost M, Dan Y (2018) Regulation of REM and non-REM sleep by periaqueductal GABAergic neurons. Nat Commun 9:354. 10.1038/s41467-017-02765-w [DOI] [PMC free article] [PubMed] [Google Scholar]
Wisor JP, Rempe MJ, Schmidt MA, Moore ME, Clegern WC (2013) Sleep slow-wave activity regulates cerebral glycolytic metabolism. Cereb Cortex 23:1978. 10.1093/cercor/bhs189 [DOI] [PMC free article] [PubMed] [Google Scholar]
Wu Y, Masurat F, Preis J, Bringmann H (2018) Sleep counteracts aging phenotypes to survive starvation-induced developmental arrest in C. elegans. Curr Biol 28:3610–3624. 10.1016/j.cub.2018.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang Z, et al. (2019) An excitatory circuit in the perioculomotor midbrain for non-REM sleep control. Cell 177:1293–1307.e16. 10.1016/j.cell.2019.03.041 [DOI] [PubMed] [Google Scholar]
Zhang Y, Chen D, Smith MA, Zhang B, Pan X (2012) Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity. PLoS One 7:e31849. 10.1371/journal.pone.0031849 [DOI] [PMC free article] [PubMed] [Google Scholar]
Zielinski MR, Dunbrasky DL, Taishi P, Souza G, Krueger JM (2013) Vagotomy attenuates brain cytokines and sleep induced by peripherally administered tumor necrosis factor-α and lipopolysaccharide in mice. Sleep 36:1227–1238. 10.5665/sleep.2892 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B1] Anaclet C, Ferrari L, Arrigoni E, Bass CE, Saper CB, Lu J, Fuller PM (2014) The GABAergic parafacial zone is a medullary slow wave sleep-promoting center. Nat Neurosci 17:1217–1224. 10.1038/nn.3789 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] Anafi RC, Kayser MS, Raizen DM (2019) Exploring phylogeny to find the function of sleep. Nat Rev Neurosci 20:109–116. 10.1038/s41583-018-0098-9 [DOI] [PubMed] [Google Scholar]

[B3] Ashe A, Sarkies P, Le Pen J, Tanguy M, Miska EA (2015) Antiviral RNA interference against Orsay virus is neither systemic nor transgenerational in Caenorhabditis elegans. J Virol 89:12035–12046. 10.1128/JVI.03664-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] Barstead R, et al. (2012) Large-scale screening for targeted knockouts in the caenorhabditis elegans genome. G3 (Bethesda) 3:1415–1425. 10.1534/g3.112.003830 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] Baugh LR, DeModena J, Sternberg PW (2009) RNA Pol II accumulates at promoters of growth genes during developmental arrest. Science 324:92–94. 10.1126/science.1169628 [DOI] [PubMed] [Google Scholar]

[B6] Berger RJ, Phillips NH (1995) Energy conservation and sleep. Behav Brain Res 69:65–73. 10.1016/0166-4328(95)00002-B [DOI] [PubMed] [Google Scholar]

[B7] Borbély AA, Neuhaus HU (1979) Sleep-deprivation: effects on sleep and EEG in the rat. J Comp Physiol A 133:71–87. 10.1007/BF00663111 [DOI] [Google Scholar]

[B8] Borbély AA, Tobler I, Hanagasioglu M (1984) Effect of sleep deprivation on sleep and EEG power spectra in the rat. Behav Brain Res 14:171–182. 10.1016/0166-4328(84)90186-4 [DOI] [PubMed] [Google Scholar]

[B9] Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77:71–94. 10.1093/genetics/77.1.71 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] Campbell SS, Tobler I (1984) Animal sleep: a review of sleep duration across phylogeny. Neurosci Biobehav Rev 8:269–300. 10.1016/0149-7634(84)90054-X [DOI] [PubMed] [Google Scholar]

[B11] Cassata G, Kagoshima H, Andachi Y, Kohara Y, Dürrenberger MB, Hall DH, Bürglin TR (2000) The LIM homeobox gene ceh-14 confers thermosensory function to the AFD neurons in Caenorhabditis elegans. Neuron 25:587–597. 10.1016/s0896-6273(00)81062-4 [DOI] [PubMed] [Google Scholar]

[B12] Chalfie M, Sulston JE, White JG, Southgate E, Thomson JN, Brenner S (1985) The neural circuit for touch sensitivity in Caenorhabditis elegans. J Neurosci 5:956–964. 10.1523/JNEUROSCI.05-04-00956.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] Chávez-Pérez C, Jafari N, Keenan BT, Raizen DM, Rohacek AM (2021) Motivated displacement assay distinguishes ALA neuron mutants from RIS neuron mutants during recovery from heat stress in Caenorhabditis elegans. MicroPubl Biol 2021. 10.17912/micropub.biology.000468 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] Chen K, Franz CJ, Jiang H, Jiang Y, Wang D (2017) An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18:303. 10.1186/s12864-017-3689-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] Chung S, et al. (2017) Identification of preoptic sleep neurons using retrograde labeling and gene profiling. Nature 545:477. 10.1038/nature22350 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] Churgin MA, Szuperak M, Davis KC, Raizen DM, Fang-Yen C, Kayser MS (2019) Quantitative imaging of sleep behavior in Caenorhabditis elegans and larval Drosophila melanogaster. Nat Protoc 14:1455–1488. 10.1038/s41596-019-0146-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] Davis MW, Somerville D, Lee Ryn, Lockery S, Avery L, Fambrough DM (1995) Mutations in the Caenorhabditis elegans Na,K-ATPase alpha-subunit gene, eat-6, disrupt excitable cell function. J Neurosci 15:8408–8418. 10.1523/JNEUROSCI.15-12-08408.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] DeBardeleben H, Lopes LE, Nessel M, Raizen DM (2017) Stress-induced sleep after exposure to ultraviolet light is promoted by p53 in Caenorhabditis elegans. Genetics 207:571–582. 10.1534/genetics.117.300070 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] Deboer T (2013) Behavioral and electrophysiological correlates of sleep and sleep homeostasis. Curr Top Behav Neurosci 25:1–24. 10.1007/7854_2013_248 [DOI] [PubMed] [Google Scholar]

[B20] Fang J, Sanborn CK, Renegar KB, Majde JA, Krueger JM (1995) Influenza viral infections enhance sleep in mice. Proc Soc Exp Biol Med 210:242–252. 10.3181/00379727-210-43945 [DOI] [PubMed] [Google Scholar]

[B21] Fay D (2006) Genetic mapping and manipulation: chapter 7-making compound mutants. WormBook 1:1–4. 10.1895/wormbook.1.96.2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] Félix M-A, et al. (2011) Natural and experimental infection of Caenorhabditis nematodes by novel viruses related to nodaviruses Hodgkin J, ed. PLoS Biol 9:e1000586. 10.1371/journal.pbio.1000586 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] Franz CJ, Renshaw H, Frezal L, Jiang Y, Félix M-A, Wang D (2014) Orsay, Santeuil and Le Blanc viruses primarily infect intestinal cells in Caenorhabditis nematodes. Virology 448:255–264. 10.1016/j.virol.2013.09.024 [DOI] [PubMed] [Google Scholar]

[B24] Fry AL, Laboy JT, Huang H, Hart AC, Norman KR (2016) A conserved GEF for Rho-family GTPases acts in an EGF signaling pathway to promote sleep-like quiescence in Caenorhabditis elegans. Genetics 202:1153–1166. 10.1534/genetics.115.183038 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] Grubbs JJ, Lopes LE, van der Linden AM, Raizen DM (2020) A salt-induced kinase is required for the metabolic regulation of sleep. PLoS Biol 18:e3000220. 10.1371/journal.pbio.3000220 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] Han SK, Lee D, Lee H, Kim D, Son HG, Yang J-S, Lee SV, Kim S (2016) OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget 7:56147–56152. 10.18632/oncotarget.11269 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] Harmon JL, Barroso J, Pence BW, Leserman J, Salahuddin N (2008) Demographic and illness-related variables associated with HIV-related fatigue. J Assoc Nurses AIDS Care 19:90. 10.1016/j.jana.2007.08.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] Hart AC, Kass J, Shapiro JE, Kaplan JM (1999) Distinct signaling pathways mediate touch and osmosensory responses in a polymodal sensory neuron. J Neurosci 19:1952–1958. 10.1523/JNEUROSCI.19-06-01952.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] Hendricks JC, Finn SM, Panckeri KA, Chavkin J, Williams JA, Sehgal A, Pack AI (2000) Rest in Drosophila is a sleep-like state. Neuron 25:129–138. 10.1016/S0896-6273(00)80877-6 [DOI] [PubMed] [Google Scholar]

[B30] Hill AJ, Mansfield R, Lopez JMNG, Raizen DM, Van Buskirk C (2014) Cellular stress induces a protective sleep-like state in C. elegans. Curr Biol 24:2399–2405. 10.1016/j.cub.2014.08.040 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] Houthoofd K, Braeckman BP, Lenaerts I, Brys K, Matthijssens F, De Vreese A, Van Eygen S, Vanfleteren JR (2005) DAF-2 pathway mutations and food restriction in aging Caenorhabditis elegans differentially affect metabolism. Neurobiol Aging 26:689–696. 10.1016/j.neurobiolaging.2004.06.011 [DOI] [PubMed] [Google Scholar]

[B32] Huber R, Deboer T, Tobler I (2000) Effects of sleep deprivation on sleep and sleep EEG in three mouse strains: empirical data and simulations. Brain Res 857:8–19. 10.1016/S0006-8993(99)02248-9 [DOI] [PubMed] [Google Scholar]

[B33] Husson SJ, Janssen T, Baggerman G, Bogert B, Kahn-Kirby AH, Ashrafi K, Schoofs L (2007) Impaired processing of FLP and NLP peptides in carboxypeptidase E (EGL-21)-deficient Caenorhabditis elegans as analyzed by mass spectrometry. J Neurochem 102:246–260. 10.1111/j.1471-4159.2007.04474.x [DOI] [PubMed] [Google Scholar]

[B34] Iannacone MJ, Beets I, Lopes LE, Churgin MA, Fang-Yen C, Nelson MD, Schoofs L, Raizen DM (2017) The RFamide receptor DMSR-1 regulates stress-induced sleep in C. elegans. Elife 6:377–391. 10.7554/eLife.19837 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] Iwanir S, Tramm N, Nagy S, Wright C, Ish C, Biron D (2013) The microarchitecture of C. elegans behavior during lethargus: homeostatic bout dynamics, a typical body posture, and regulation by a central neuron. Sleep 36:385–395. 10.5665/sleep.2456 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] Jacob TC, Kaplan JM (2003) The EGL-21 carboxypeptidase E facilitates acetylcholine release at Caenorhabditis elegans neuromuscular junctions. J Neurosci 23:2122–2130. 10.1523/JNEUROSCI.23-06-02122.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] Konietzka J, et al. (2020) Epidermal growth factor signaling promotes sleep through a combined series and parallel neural circuit. Curr Biol 30:1–16.e13. 10.1016/j.cub.2019.10.048 [DOI] [PubMed] [Google Scholar]

[B38] Kroeger D, et al. (2018) Galanin neurons in the ventrolateral preoptic area promote sleep and heat loss in mice. Nat Commun 9:4129. 10.1038/s41467-018-06590-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] Krueger JM, Kubillus S, Shoham S, Davenne D (1986) Enhancement of slow-wave sleep by endotoxin and lipid A. Am J Physiol 251:R591–R597. 10.1152/ajpregu.1986.251.3.R591 [DOI] [PubMed] [Google Scholar]

[B40] Kuo T-H, Pike DH, Beizaeipour Z, Williams JA (2010) Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFκB Relish. BMC Neurosci 11:17. 10.1186/1471-2202-11-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] Kuo T-H, Williams JA (2014a) Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. Sleep 37:859–869. 10.5665/sleep.3648 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] Kuo T-H, Williams JA (2014b) Increased sleep promotes survival during a bacterial infection in Drosophila. Sleep 37:1077–1086. 10.5665/sleep.3764 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] Labrousse A, Chauvet S, Couillault C, Kurz CL, Ewbank JJ (2000) Caenorhabditis elegans is a model host for Salmonella typhimurium. Curr Biol 10:1543–1545. 10.1016/S0960-9822(00)00833-2 [DOI] [PubMed] [Google Scholar]

[B44] Lapshina KV, Ekimova IV (2010) Effects of sleep deprivation on measures of the febrile reaction and the recovery of somatovisceral functions and sleep in endotoxemia. Neurosci Behav Physiol 40:381–388. 10.1007/s11055-010-9268-6 [DOI] [PubMed] [Google Scholar]

[B45] McClanahan PD, Dubuque JM, Kontogiorgos-Heintz D, Habermeyer BF, Xu JH, Ma AM, Raizen DM, Fang-Yen C (2020) A quiescent state following mild sensory arousal in Caenorhabditis elegans is potentiated by stress. Sci Rep 10:4140. 10.1038/s41598-020-60994-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] Mullington J, Korth C, Hermann DM, Orth A, Galanos C, Holsboer F, Pollmächer T (2000) Dose-dependent effects of endotoxin on human sleep. Am J Physiol Regul Integr Comp Physiol 278:947–955. 10.1152/ajpregu.2000.278.4.R947 [DOI] [PubMed] [Google Scholar]

[B47] Nath RD, Chow ES, Wang H, Schwarz EM, Sternberg PW (2016) C. elegans stress-induced sleep emerges from the collective action of multiple neuropeptides. Curr Biol 26:2446–2455. 10.1016/j.cub.2016.07.048 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] Nelson MD, Lee KH, Churgin MA, Hill AJ, Van Buskirk C, Fang-Yen C, Raizen DM (2014) FMRFamide-like FLP-13 neuropeptides promote quiescence following heat stress in Caenorhabditis elegans. Curr Biol 24:2406–2410. 10.1016/j.cub.2014.08.037 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] Nowak N, et al. (2021) Rapid and reversible control of human metabolism by individual sleep states. Cell Rep 37:109903. 10.1016/j.celrep.2021.109903 [DOI] [PubMed] [Google Scholar]

[B50] Palikaras K, Tavernarakis N (2016) Intracellular assessment of ATP levels in Caenorhabditis elegans. Bio Protoc 6:2048. 10.21769/BioProtoc.2048 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] Pokala N, Liu Q, Gordus A, Bargmann CI (2014) Inducible and titratable silencing of Caenorhabditis elegans neurons in vivo with histamine-gated chloride channels. Proc Natl Acad Sci U S A 111:2770–2775. 10.1073/pnas.1400615111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] Portal-Celhay C, Bradley ER, Blaser MJ (2012) Control of intestinal bacterial proliferation in regulation of lifespan in Caenorhabditis elegans. BMC Microbiol 12:49. 10.1186/1471-2180-12-49 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] Proal AD, VanElzakker MB (2021) Long COVID or post-acute sequelae of COVID-19 (PASC): an overview of biological factors that may contribute to persistent symptoms. Front Microbiol 12:698169. 10.3389/fmicb.2021.698169 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] Pujol N, Torregrossa P, Ewbank JJ, Brunet JF (2000) The homeodomain protein CePHOX2/CEH-17 controls antero-posterior axonal growth in C. elegans. Development 127:3361–3371. 10.1242/dev.127.15.3361 [DOI] [PubMed] [Google Scholar]

[B55] Raizen DM, Zimmerman JE, Maycock MH, Ta UD, You Y, Sundaram MV, Pack AI (2008) Lethargus is a Caenorhabditis elegans sleep-like state. Nature 451:569–572. 10.1038/nature06535 [DOI] [PubMed] [Google Scholar]

[B56] Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER (2017) An intracellular pathogen response pathway promotes proteostasis in C. elegans. Curr Biol 27:3544–3553. 10.1016/j.cub.2017.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] Riddle DL, Blumenthal T, Meyer BJ, Priess JR (1997) Section II: Feeding. In: C. elegans II, Ed 2, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]

[B58] Robinson B, Goetting DL, Desir JC, van Buskirk C (2019) aptf-1 mutants are primarily defective in head movement quiescence during C. elegans sleep. MicroPubl Biol 2019. 10.17912/micropub.biology.000148 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] Saper CB, Fuller PM, Pedersen NP, Lu J, Scammell TE (2010) Sleep state switching. Neuron 68:1023. 10.1016/j.neuron.2010.11.032 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] Schmidt MH (2014) The energy allocation function of sleep: a unifying theory of sleep, torpor, and continuous wakefulness. Neurosci Biobehav Rev 47:122–153. 10.1016/j.neubiorev.2014.08.001 [DOI] [PubMed] [Google Scholar]

[B61] Shaw PJ, Cirelli C, Greenspan RJ, Tononi G (2000) Correlates of sleep and waking in Drosophila melanogaster. Science 287:1834–1837. 10.1126/science.287.5459.1834 [DOI] [PubMed] [Google Scholar]

[B62] Singh K, et al. (2011) C. elegans notch signaling regulates adult chemosensory response and larval molting quiescence. Curr Biol 21:825–834. 10.1016/j.cub.2011.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] Sinner MP, Masurat F, Ewbank JJ, Pujol N, Bringmann H (2021) Innate immunity promotes sleep through epidermal antimicrobial peptides. Curr Biol 31:564–577.e12. 10.1016/j.cub.2020.10.076 [DOI] [PubMed] [Google Scholar]

[B64] Stiernagle T (2006) Maintenance of C. elegans. WormBook 1:1–11. 10.1895/wormbook.1.101.1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] Stucynski JA, Schott AL, Baik J, Chung S, Weber F (2022) Regulation of REM sleep by inhibitory neurons in the dorsomedial medulla. Curr Biol 32:37–50.e6. 10.1016/j.cub.2021.10.030 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B66] Szentirmai É, Krueger JM (2014) Sickness behaviour after lipopolysaccharide treatment in ghrelin deficient mice. Brain Behav Immun 36:200–206. 10.1016/j.bbi.2013.11.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] Tabara H, Sarkissian M, Kelly WG, Fleenor J, Grishok A, Timmons L, Fire A, Mello CC (1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123–132. 10.1016/S0092-8674(00)81644-X [DOI] [PubMed] [Google Scholar]

[B68] Tilley A, Donohoe F, Hensby S (1987) Homeostatic changes in slow wave sleep during recovery sleep following restricted nocturnal sleep and partial slow wave sleep recovery during an afternoon nap. Sleep 10:600–605. [PubMed] [Google Scholar]

[B69] Tobler I (1983) Effect of forced locomotion on the rest-activity cycle of the cockroach. Behav Brain Res 8:351–360. 10.1016/0166-4328(83)90180-8 [DOI] [PubMed] [Google Scholar]

[B70] Tononi G, Cirelli C (2003) Sleep and synaptic homeostasis: a hypothesis. Brain Res Bull 62:143–150. 10.1016/j.brainresbull.2003.09.004 [DOI] [PubMed] [Google Scholar]

[B71] Toth LA (1995) Sleep, sleep deprivation and infectious disease: studies in animals. Adv Neuroimmunol 5:79–92. 10.1016/0960-5428(94)00045-P [DOI] [PubMed] [Google Scholar]

[B72] Toth LA, Krueger JM (1988) Alteration of sleep in rabbits by Staphylococcus aureus infection. Infect Immun 56:1785–1791. 10.1128/iai.56.7.1785-1791.1988 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] Toth LA, Opp MR, Mao L (1995a) Somnogenic effects of sleep deprivation and Escherichia coli inoculation in rabbits. J Sleep Res 4:30–40. 10.1111/j.1365-2869.1995.tb00148.x [DOI] [PubMed] [Google Scholar]

[B74] Toth LA, Rehg JE, Webster RG (1995b) Strain differences in sleep and other pathophysiological sequelae of influenza virus infection in naive and immunized mice. J Neuroimmunol 58:89–99. 10.1016/0165-5728(94)00193-R [DOI] [PubMed] [Google Scholar]

[B75] Turek M, Besseling J, Spies JP, König S, Bringmann H (2016) Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep. Elife 5. 10.7554/eLife.12499 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B76] Turek M, Lewandrowski I, Bringmann H (2013) An AP2 transcription factor is required for a sleep-active neuron to induce sleep-like quiescence in C. elegans. Curr Biol 23:2215–2223. 10.1016/j.cub.2013.09.028 [DOI] [PubMed] [Google Scholar]

[B77] Vaccaro A, Kaplan Dor Y, Nambara K, Pollina EA, Lin C, Greenberg ME, Rogulja D (2020) Sleep loss can cause death through accumulation of reactive oxygen species in the gut. Cell 181:1307–1328.e15. 10.1016/j.cell.2020.04.049 [DOI] [PubMed] [Google Scholar]

[B78] Van Buskirk C, Sternberg PW (2007) Epidermal growth factor signaling induces behavioral quiescence in Caenorhabditis elegans. Nat Neurosci 10:1300–1307. 10.1038/nn1981 [DOI] [PubMed] [Google Scholar]

[B79] Van Buskirk C, Sternberg PW (2010) Paired and LIM class homeodomain proteins coordinate differentiation of the C. elegans ALA neuron. Development 137:2065–2074. 10.1242/dev.040881 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B80] Walker JM, Berger RJ (1980) Sleep as an adaptation for energy conservation functionally related to hibernation and shallow torpor. Prog Brain Res 53:255–278. 10.1016/S0079-6123(08)60068-0 [DOI] [PubMed] [Google Scholar]

[B81] Weber F, Chung S, Beier KT, Xu M, Luo L, Dan Y (2015) Control of REM sleep by ventral medulla GABAergic neurons. Nature 526:435. 10.1038/nature14979 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B82] Weber F, Hoang Do JP, Chung S, Beier KT, Bikov M, Saffari Doost M, Dan Y (2018) Regulation of REM and non-REM sleep by periaqueductal GABAergic neurons. Nat Commun 9:354. 10.1038/s41467-017-02765-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[B83] Wisor JP, Rempe MJ, Schmidt MA, Moore ME, Clegern WC (2013) Sleep slow-wave activity regulates cerebral glycolytic metabolism. Cereb Cortex 23:1978. 10.1093/cercor/bhs189 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B84] Wu Y, Masurat F, Preis J, Bringmann H (2018) Sleep counteracts aging phenotypes to survive starvation-induced developmental arrest in C. elegans. Curr Biol 28:3610–3624. 10.1016/j.cub.2018.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B85] Zhang Z, et al. (2019) An excitatory circuit in the perioculomotor midbrain for non-REM sleep control. Cell 177:1293–1307.e16. 10.1016/j.cell.2019.03.041 [DOI] [PubMed] [Google Scholar]

[B86] Zhang Y, Chen D, Smith MA, Zhang B, Pan X (2012) Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity. PLoS One 7:e31849. 10.1371/journal.pone.0031849 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B87] Zielinski MR, Dunbrasky DL, Taishi P, Souza G, Krueger JM (2013) Vagotomy attenuates brain cytokines and sleep induced by peripherally administered tumor necrosis factor-α and lipopolysaccharide in mice. Sleep 36:1227–1238. 10.5665/sleep.2892 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Quiescence Enhances Survival during Viral Infection in Caenorhabditis elegans

Michael J Iannacone

Paul Um

Jeremy I Grubbs

Alexander M van der Linden

David M Raizen

Abstract

Significance Statement

Introduction

Materials and Methods

Worm cultivation

Table 1.

Construction of worm strains

Orsay filtrate preparation/infection protocol

Movement quiescence assays

Table 3.

Feeding quiescence assays

Mechanical stimulation assay

Figure 2.

Olfactory stimulation assay

Homeostatic rebound assay

Post-response quiescence assay

Figure 3.

Intestinal GFP analysis

Longevity assays

Table 4.

Table 5.

Table 6.

Table 7.

Table 9.

Dead bacteria longevity experiment

ATP level determination in Orsay-infected animals

Total RNA isolation

Quantitative reverse-transcription polymerase chain reaction

Table 2.

Experimental design and statistical analysis

Figure 4.

Figure 5.

Results

Orsay virus infection is associated with a sleep-like state

Figure 1.

Virus-induced quiescence is regulated by the ALA neuron which controls sickness induced quiescence

Virus-induced quiescence is beneficial to survival

Figure 6.

Quiescence improves resilience to Orsay virus infection

Figure 7.

Movie 1.

Movie 2.

Movie 3.

Movie 4.

Table 8.

Discussion

References

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases