Mouse models for the study of Borrelia burgdorferi infection

Abstract

Lyme disease, a tickborne illness caused by Borrelia burgdorferi, is an emerging, significant public health concern. B. burgdorferi infections are challenging to study due to their complex life cycle that requires adaptation to both ticks and mammalian hosts for long-term survival and transmission. Bacterial adaptation is accomplished through extensive gene expression alterations in response to environmental cues that remain to be more fully explored. Mouse models of infection serve as valuable tools for studying B. burgdorferi adaptation to the mammalian host and their ability to cause persistent infections and thus to interact with and evade the immune system. This article details three mouse models that differ in their primary methods of infection: infestation with B. burgdorferi infected ticks, intradermal inoculation of culture-grown spirochetes, and infection via subcutaneous transplantation of infected tissue, respectively. Each method offers unique advantages and limitations. Tick infestation is the route of natural transmission but presents logistical challenges. Syringe inoculation is easy and provides precise control over the infectious dose but infection is with culture adapted bacteria. Transplantation of infected tissue introduces mammalian host-adapted B. burgdorferi in precise anatomical locations, but misses transfer of tick factors affecting immunity. Detailed protocols are provided for each of those infection routes and pros and cons of each approach are outlined to help identify the best approach for a research question to be addressed.

INTRODUCTION:

Lyme disease, caused by bacteria of the genus Borrelia burgdorferi sensu lato, is a significant challenge to global public health that continues to increase in prevalence (Cardenas-de la Garza, De la Cruz-Valadez, Ocampo-Candiani, & Welsh, 2019). The intricate interplay between this pathogen, its vector, and mammalian hosts complicates our understanding of disease pathogenesis and immunity (Anguita, Hedrick, & Fikrig, 2003; Donta et al., 2021; Radolf, Caimano, Stevenson, & Hu, 2012). Among the various tools available for studying Lyme disease, animal models are indispensable tools for unravelling the complexities of this infection and for exploring potential therapeutic interventions (Steere, Coburn, & Glickstein, 2004).

Mice serve as valuable models for studying B. burgdorferi infection due to their genetic similarity to humans, ease of handling, and the ability to manipulate their genome, including critical aspects of the immune systems (Steere et al., 2004). By infecting mice with B. burgdorferi, one can closely mimic the natural transmission route of the bacterium, offering insights into mammalian host immune responses, both locally at the site of infection in the skin and in the draining local lymph nodes, both during the bacterial dissemination phase as well as during the persistent phase of infection (Steere et al., 2004). Importantly, mice can serve as natural reservoirs for B. burgdorferi in endemic regions, further highlighting their relevance in understanding the dynamics of B. burgdorferi enzootic transmission cycles between ticks (larvae, nymphs and adults) and their natural reservoir hosts (Simon, Schaible, Wallich, & Kramer, 1991; Wang et al., 2002).

This protocol outlines basic methods for the growth of B. burgdorferi and infection of mice with these spirochetes by three different routes: syringe inoculation, tick infestation, and transplantation of tissue containing host-adapted B. burgdorferi. The particular infection method chosen will depend on the ultimate goals of the research performed, while keeping in mind the limitations that may lead one to choose one method of infection over the others.

STRATEGIC PLANNING:

BIOSAFETY:

Lyme disease spirochetes of the genus B. burgdorferi (including B. burgdorferi sensu stricto, B. afzelii and B. garinii, here referred to simply as B. burgdorferi) are considered Biosafety Level 2 pathogens. Thus, appropriate personal protective gear must be worn and guidelines and regulations must be followed for the use and handling of pathogenic microorganisms. In general, all work with BSL2 level agents requires the use of biosafety cabinets (BSC). The highest likelihood of accidental infection of laboratory personnel is during the handling of spirochete-containing syringes attached to needles. Accidental needle-stick injury requires a visit to the physicians and is usually treated by prophylactic administration of antibiotics.

WORKING WITH TICKS:

Here are some key points when working with ticks to infect mice:

PPE and Lab Practices:

Due to the risk of tick bites, prioritize investigator protection. This includes: Wearing a light-colored lab coat with sleeves tucked into gloves to minimize tick hiding places; tying back long hair and wearing a hair net to prevent ticks from getting entangled; and following careful lab practices to minimize tick escape and potential exposure.

Environmental Modifications:

Adapt the animal housing space for the collection of infected ticks and for avoiding the escape of ticks: Whenever possible use animal procedure and animal holding spaces with light colored surfaces and spaces with membranes placed over drains and airshafts to trap any ticks that might have escaped from leaving the space. Avoid the use of fans in areas in which ticks are used. That also limits the ability to use a BSC for placing ticks onto mice either during initial tick infection or when working with infected ticks. You may use the BSC without activating the ventilation. Utilize specialized racks with cages designed to collect ticks that have detached from the mice. This usually includes the use of cages that have a wire bottom, and which contain underneath the wire a water reservoirs that will trap any ticks that either did not attach or have fed to repletion and dropped off the mice. Finally, consider using sticky pads underneath the racks holding the mouse cages. This will trap any ticks that may have fallen beside the water reservoirs and prevent them from escaping.

BASIC INFECTION PROTOCOL 1:

Syringe inoculation of mice cultured B. burgdorferi and collection of necropsy tissues

Intradermal infection of mice via inoculation of culture-grown bacteria represents the most common and straightforward method for infecting laboratory mice with B. burgdorferi. This technique offers precise control over both the dosage and the site of B. burgdorferi infection, facilitating standardized experimental conditions, ensuring consistent results, and enabling comparative studies. By delivering a controlled dose of bacteria, syringe inoculation ensures the reproducibility of infection among mice within and across experiments. This allows for the study of various aspects of B. burgdorferi pathogenesis, including bacterial dissemination, tissue tropism, and the development of disease manifestations, depending on the murine strain used for experiments.

Furthermore, the controlled nature of syringe inoculation enables the evaluation of potential therapeutic interventions, such as antimicrobial agents or vaccines. However, the infection and host response to the infection may not fully replicate the natural route of B. burgdorferi transmission through tick bites. This limitation could influence the dynamics of host-pathogen interactions observed. An important factor to consider is the differing expression of proteins by B. burgdorferi in culture compared to within a tick or an animal host, which may be of consequence depending on the goals of the experiments to be performed. Successful intradermal inoculation of mice will result in spirochetes disseminating from the inoculation site throughout the mouse, mostly through the lymphatic system or via spread within various tissues (Bockenstedt, Wooten, & Baumgarth, 2021; Hyde, 2017; Tunev et al., 2011) If an uninfected control group is desired, one can inject mice with culture media (BSK II) alone.

Successful infection with B. burgdorferi are achieved also via subcutaneous or intraperitoneal placement of bacteria. However, the natural route of infection via tick bite places the bacteria into the mouse dermis. Therefore, we will describe here the use of intradermal inoculation.

Important Note:

1. Perform this procedure in a biosafety cabinet or other approved methods for handling of BSL2 pathogens.

2. Handle B. burgdorferi with proper PPE according to institutional guidelines. All mouse cages with infected mice must be labeled per BSL2 agent housing policies.

3. Use appropriate devices, e.g., chemical fume hood, non-recirculating BSC, or isoflurane vaporizer with a charcoal gas scavenger canister when using inhalation anesthetics, to limit exposure of personnel.

Materials:

BSK II media (3ml aliquot) (see recipe in Reagents and Solutions, for trouble shooting see Table 1)

Table 1:

BSK II Medium Preparation Troubleshooting Table:

Problem	Possible Cause	Solution
BSK II medium appears cloudy or changes color	Contamination during preparation or aliquoting	Ensure strict aseptic technique during preparation and aliquoting. Use sterile equipment and work in a clean environment. Discard contaminated batches.
pH of BSK II medium is outside the optimal range (around 7.6)	Incorrect addition of NaOH or variability in pH strips	Double-check the addition of NaOH and verify the pH using calibrated pH meter instead of strips for more accurate readings. Adjust pH accordingly.
Mold growth observed in BSK II medium	Poor sterility maintenance during preparation or storage	Ensure proper sterilization of all components and containers. Use sterile technique when handling and aliquoting. Store aliquots at appropriate temperatures.
Inconsistent growth of B. burgdorferi in BSK II medium	Variability in aliquoting volumes or improper storage	Standardize aliquot volumes to ensure consistent nutrient availability. Monitor storage temperature and conditions to maintain medium integrity.
Gelatin solution solidifies after autoclaving	Incomplete dissolving of gelatin; autoclaved gelatin was kept at too low of a temperature prior to addition of liquid media components	Ensure gelatin is fully dissolved prior to autoclaving and that gelatin is maintained on a stir plate at a low heat and stir setting.

Frozen low-passage Borrelia stock (such as B. burgdorferi B31 (Clone 5A1) from BEI Resources catalogue # NR-13251)

Isoflurane

Standard incubator set to 30–35° C.

Falcon 5ml Polystyrene Round-bottom tubes (REF 352054)

BD Insulin Syringes (REF 329424)

Petroff-Hausser Counting Chamber (Hausser Scientific Catalog #3900)

Darkfield Microscope

Hair trimmer such as BravMini+ Cordless Trimmer (Braintree Scientific SKU CLP-41590)

Rodent Anesthesia Machine

CO₂ chamber (or other IACUC approved method of euthanasia)

1cc syringe

25/8g needles (aluminium hub preferred)

Serum separator tubes (BD Microtainer SST ref # 365967)

Dissecting board (such as Epredia Shandon Neoprene Cork Dissecting Board Fisher cat # 36–1)

Bead sterilizer or glass histology jar filled with 95% ethanol and a flame pot

Surgical instruments: 4” serrated dressing forceps, 4” iris scissors, 5 ½” curved Mayo Scissors, 5 ½” Mayo-Still Dissecting Scissors

Grow B. burgdorferi from Frozen Stock and Count Cultures

Thaw Media and B. burgdorferi:

• 1Thaw two 3ml aliquots each of BSK II media in a water bath.
• 2Disinfect the tube exteriors with 70% ethanol after thawing.
• 3Thaw one vial of low-passage B. burgdorferi at room temperature (a common laboratory strain is B31, available through BEI, but others such as N40 are also frequently used). Use of low-passage strains is important to ensure infectivity.

Inoculate Media:

• 4In a biosafety cabinet, add to one of two BSKII aliquots 100μl of thawed B. burgdorferi stock, and 200μl of thawed B. burgdorferi to the other BSKII aliquot. Snap lids on tight, invert the tubes a few times to mix and label tubes with the date, volume, and strain used.

Incubate Cultures:

• 5Place tubes on a rack in a standard lab incubator set to 30–35°C. Allow cultures to grow for 5–7 days. This should allow for cells to grow to mid-log growth phase.

Count Cells:

• 6In a BSC, invert tubes a few times to mix, load 5μl of culture onto a Petroff-Hausser chamber and use dark field microscopy to count cells.

Count the number of viable (assessed by visible motility) B.burgdorferi in 50 small squares of the chamber (10 squares each per corner of the grid and 10 from the middle of the grid) and divide that total number of cells by 50 to arrive at the average number of cells per small square. Multiply the number by 2 × 10⁷ to arrive at the total number of B. burgdorferi/ml. In a culture grown as described above, you can expect to end up with a concentration of B. burgdorferi concentration of between 6 × 10⁶ to 4 × 10⁷ B. burgdorferi/ml.

Dilute Cells:

• 7Dilute cells to 10x the desired cell number for infection. Recommended bacterial density is 1 × 10⁴ − 1 × 10⁶ B. burgdorferi/ml for an inoculation dose of 1 × 10³−1 × 10⁵ in BSK II media for a 100 μl inoculum volume per mouse.
• 8Examine B. burgdorferi under the microscope to ensure viability and motility. When examining B. burgdorferi under the microscope, take care to note the health of the culture by ensuring they have the normal Borrelia corkscrew shape (Figure 1) and good motility (swimming of bacteria in what looks like a twisting motion). Abnormal-looking cultures might indicate suboptimal culture that may not result in a successful infection.

Figure 1: Image of GFP tagged B. burgdorferi strain B31 grown in BSK media at 37°C.

B. burgdorferi strain B31-A3 GFP (kind gift from Dr. Utpal Pal, University of Maryland), passage 4, was grown in BSK media with 6% rabbit serum at 37°C with 5% CO₂ at a starting density of 1 × 10⁶ cells/mL. The image of two spirochetes was taken by confocal microscopy (40x magnification) when cells were at a density of approximately 3 × 10⁷ cells/mL. The image was kindly generated and provided by Linus Wang in the lab of Dr. Peter Searson (Whiting School of Engineering, Johns Hopkins University).

Inoculate Mice

Prepare Syringe:

• 9Draw diluted B. burgdorferi culture into a BD Insulin Syringe (can use one syringe per cage of mice).

Anaesthetize Mice:

• 10Anesthetize mice with a short-acting anaesthetic like isoflurane using an anaesthesia vaporizer system. Verify sufficient anaesthesia depth by checking for a lack of a toe pinch reflex.

Prepare Inoculation Site:

• 11Shave the inoculation site at the dorsal midline between the shoulder blades for better visualization of needle placement.

Perform Injection:

• 12Hold the fully anesthetized mouse securely, creating a taut surface by rolling the skin over your finger, and ensuring the mouse is suspended to prevent the mouse from kicking off the table if it begins to wake up during injection, which increases the risk of needle stick injury. Inject 100μl of diluted B. burgdorferi culture (10³ – 10⁵ spirochetes) intradermally, observing for a visible bubble under the skin to confirm intradermal placement. Uneven dissemination of B. burgdorferi may occur if the bubble is off center.

Mouse Necropsy

B. burgdorferi rapidly disseminates through all tissues of the mouse. We expect full dissemination between days 5–7, perhaps even earlier. Day 14 appears to be the peak of the adaptive immune response in the brachial lymph nodes (Figure 2). The lymph node cellularity dramatically increases by that timepoint (Figure 2B), as are frequencies of GC and plasmablasts (Figure 2A,C,D) as well as frequencies of activated CD4 T cells (Figure 2E) when compared to sham-infected controls. Note the strong contraction in lymph node size and B cell responses by day 28, despite the ongoing presence of B. burgdorferi (Figure 3).

Figure 2: Adaptive immune response development in lymph nodes after B. burgdorferi infection via the syringe inoculation method.

A) Shown are flow cytometry dot plots of (top) live germinal center B cells identified as CD19^hi CD4R^hi single leukocytes prior to gating as CD24^hi CD38^lo and (bottom) extrafollicular plasmablasts, gated on live CD19^lo CD4Rlo lymphocytes prior to gating as CD24^hi CD38^lo at indicated time points post-infection with N40 B. burgdorferi. (B) Mean numbers ± SD of total leukocytes, (C) germinal center B cells and (D) plasmablasts, isolated from the brachial lymph nodes of C57BL/6 mice (n = 3/group) at the indicated time points post-infection with N40 B. burgdorferi. (E) (left) shown are flow cytometry contour plots with outliers from brachial lymph nodes of mice (n = 4–5/group) either infected with B. burgdorferi N40 or sham-infected 11 days prior using the syringe inoculation method. Shown are representative plots showing expression of CD44^hi CD11a^hi cells among CD4 T cells identified by gating on live leukocytes, single cells, CD19− CD4+; (right), scatter plot shows mean frequencies ± SD for each group. Each symbol represents results from an individual mouse. Statistical analysis was done using unpaired Student’s t test. *p < 0.05.

Figure 3: Borrelia burgdorferi tissue burden is controlled by antibodies.

Shown are Borrelia burgdorferi flagellin B copy numbers/mg of tibiotarsal joint tissue (joint), heart base (heart) and right inguinal lymph node (LN) draining the site of infection, assessed by PCR. Analysis was done at day 32 after infection via tissue transplantation with B. burgdorferi N40. Compared are tissues from Igh-a expressing C57BL/6 wildtype controls (WT) and double knock out mice (DKO) (n=4/group), the latter lacking all secreted antibodies due to their inability to undergo class-switch recombination (AID−/−) and secrete IgM (sIgM−/−). Thus, these mice have B cells but no circulating immunoglobulin. Numbers indicate p values obtained by performing individual pairwise comparisons using Student’s t tests.

Euthanize Mice:

• 1Euthanize mice using a method approved by the institution’s IACUC, such as by overexposure to CO₂ gas.

Collect Blood:

• 2Collect blood via cardiac stick with a 1cc syringe and 25 5/8g needle and transfer blood Into a serum separator tube.

Prepare Mouse for Dissection:

• 3Pin mice abdomen side up onto a dissecting board by pinning 18 g needles through all 4 foot pads. Spray the fur of the mouse with 70% ethanol. This avoids loose hair, which increases the risk of contamination.

Collect Tissues such as the Bladder for Culture to Verify Infection:

• 4Sterilize the tip of a pair of forceps and a 5 ½” Mayo-Still Dissecting Scissor using either a bead sterilizer or by dipping the tip of the instruments into 95% ethanol than burning the ethanol off using a flame pot. Caution: If flaming instruments, take care to hold them over a non-flammable surface in case a drop of flaming ethanol drips off the instruments.
• 5Using your forceps, grasp a small amount of skin at the bottom of the abdomen and while continuing to hold the skin with the forceps, make a small snip below the forceps with the 5 ½” Mayo-Still Dissecting Scissors.
• 6Insert the Mayo-Dissecting scissors into the incision and push them up into the space between the skin and peritoneal membrane. Once fully inserted, open up the scissors to separate the skin from the peritoneal membrane. Withdraw the scissors and cut up either side of the abdomen to expose the peritoneal cavity.
• 7Re-sterilize forceps and scissors and wait for them to cool. Cut up either side of the peritoneal membrane to expose the peritoneal cavity.
• 8Loosen cap of 3ml BSK aliquot. Re-sterilize forceps tips and the tips of a 4” iris scissor, cool before use. Take special care to ensure instruments are not too hot before tissue collection so as not to sterilize the tissue, and thus lose the ability to culture B. burgdorferi.
• 9Grasp the tip of the urinary bladder with the forceps and snip it at the base with the scissors. Un-cap the BSK tube with one hand and transfer the tissue to the tube with the other. Re-cap the tube and invert it to ensure the tissue ends up in the media.
• 10On return to the laboratory, store the tissue cultures in the 30–35° C incubator for 10–12 days.

Check for the presence of B. burgdorferi (For trouble-shooting -see Table 2):

• 11After tissue incubation in BSK for 10–12 days, move tubes into a BSC, invert the tubes a few times and place 5ul of culture medium containing bacteria onto a glass slide, then cover with a 25 mm² cover slip.
• 12Using a darkfield microscope inspect the entire slide for the presence of corkscrew shaped B. burgdorferi. Cultures are not considered negative unless the entire field has been scanned and no B. burgdorferi seen. It is advisable to re-scan any negative cultures again after another week of culture to test whether they have remained free of B. burgdorferi.

Table 2:

Contaminated or negative cultures

Problem	Possible Cause	Solution
B. burgdorferi cultures contaminated	Tube lid came into contact with water from water bath	Take care to keep lid away from water and spray tubes with 70% and letting them dry before opening in a BSC
Necropsy cultures contaminated	Insufficient sterile technique during tissue collection	Implement rigorous sterile procedures during tissue collection and instrument sterilization
	Contamination introduced during tissue transfer or handling post-collection	Minimize tissue manipulation, use sterile transfer techniques, and work in a controlled environment
	Environmental contamination in the necropsy area	Maintain cleanliness in the necropsy area, use appropriate disinfectants, and control airflow
B. burgdorferi cultures from infected mice are negative	Tissue was not submerged in BSK media during transfer to incubator	Ensure tissue is fully submerged in media before transferring to the incubator
	Insufficient volume of media in the culture tube	Add an adequate amount of BSK media to fully cover the tissue samples
	Contamination of the media or culture tube	Use aseptic techniques when handling media and culture tubes to prevent contamination
	B. burgdorferi strain used may not be viable	Verify the viability of the B. burgdorferi strain used in the experiment, consider using a fresh culture if necessary
	Instruments were too hot before tissue was collected and tissue was sterilized.	Take care at future necropsies to make sure instruments are sufficiently cool before collecting tissue.

Collect Remaining Desired Tissues:

• 13Collect remaining desired tissues for flow cytometry, for ELISpot, for DNA, for histology, for RNA, etc. We commonly collect the draining lymph node, spleen, and/or bone marrow for flow cytometry and ELISpot assays. The draining lymphatic tissues for an intradermal syringe inoculation along the dorsal midline may include the axillary and brachial lymph nodes (Figure 4) but may also include drainage to the spleen. For Staining Media protocol, see (Tunev, Hastey, Hodzic, Feng, Barthold & Baumgarth, 2011).
• 14Tissues harvested for flow cytometry, ELISPOT analysis or cell cultures should be placed in a 15ml conical tube containing 6ml of staining media. The tubes should be placed on ice until ready for further tissue processing.
• 15To generate single cell suspensions, press lymph nodes or spleen between the frosted ends of two glass slides over a small petri dish, rinsing the slide with staining media, and passing the suspension over nylon mesh into your 15ml conical tube. Bone marrow will need to be flushed from the tibia and femur from one (or both) rear legs into a small petri dish using a 1cc syringe containing staining media and 15 5/8g needle, sucking the flushed bone marrow back into the syring and forcing it back out a few times, then passing the suspension over nylon mesh back into your 15ml conical tube.
• 16For DNA extraction to assess B. burgdorferi tissue burden by PCR, collect a small piece (few mm²) of ear tissue, quadricep muscle, tibiotarsal joint (removing skin from joint first), heart base, lymph nodes, as well as quadriceps muscle, urinary bladder and ear tissue. Weigh tissues, snap freeze in liquid nitrogen and store at −20°C until use.

Figure 4: Lymph node cellularity in mice infected with B. burgdorferi via tick infestation and tissue-transplant.

(A) C57BL/6 mice (n = 4) were infected by the tissue-transplant method with B. burgdorferi N40. Shown are mean numbers of total live cells in indicated lymph nodes (LN) when tissue transplant was inserted into the right hind leg of each mouse. (B) C57BL/6 mice (n= 4/group) were infected via tick-infection method with n = 5 nymph ticks/mouse infected with B. burgdorferi N40 (Bb) placed onto the skin between the shoulder blades. Sham-infected control mice (S) were tick infested in the same way but with non-infected ticks. Shown are mean numbers ± SD of total live cells in indicated LN. Note the similar kinetics of LN size changes with exception of the right inguinal lymph node, draining the site of infection, in mice infected with the tissue transplant method compared to infection via ticks were the site(s) of infection are unknown.

When taking the heart, take care to include the area where the major vessels attach to the heart. Tissues that are useful for histological evaluation are the skinned rear leg and heart to assess the degree of arthritis and carditis, respectively.

PCR for Borrelia detection

Culturing tissues provides the most sensitive way to determine the presence (or not) of B. burgdorferi in infected mouse tissues. For quantification of B. burgdorferi in tissues we recommend using PCR to detect flagellin, as it is expressed by all Borrelia as a single copy gene. For a detailed description please see (Hodzic, Feng, Freet, Borjesson, & Barthold, 2002). To determine the best timepoint for tissue analysis, consider that B. burgdorferi has disseminated by about 7 days post infection and following a peak expansion at 2–3 weeks and contraction, B. burgdorferi tissue loads stabilize by about one months after infection, controlled in part by the ability of infected mice to secrete specific antibodies (Figure 3).

Materials:

Infected mouse tissues stored at −20C

Primers to detect Bb FlaB. FlaB primer/probes (for example from Integrated DNA Technlogies Inc.) that can be used to detect B. burgdorferi strains B31 and N40 are:

• forward primer FL-571F (GCAGCTAATGTTGCAAATCTTTTC)

• reverse primer FL-677R (GCAGGTGCTGGCTGTTGA)

• probe FL-611P (AAACTGCTCAGGCTGCACCGGTTC)

96 well plates for PCR reaction (Applied Biosystems, Cat. No: 4306737)

DNeasy Tissue Extraction Kit (Qiagen, Cat. No. 69504)

Luna Universal Probe qPCR Master Mix (Cat No. M3004L)

Real time PCR machine (For example, Applied Biosystems)

1. Extract DNA from small tissue samples using the DNeasy Tissue Kits (Qiagen, Cat. No. 69504) according to the manufacturer’s protocol. Use one or multiple tissues per mouse.

2. Set-up 20ml PCR reactions in plates with the qPCR Master Mix, following manufacturer’s protocols.

3. Run real-time PCR reaction for 40 cycles using protocols specified by (Hodzic, Feng, Freet, Borjesson, & Barthold, 2002).

Important Caveats:

Seek medical attention immediately if you experience a needle stick injury with B. burgdorferi. Prompt antibiotic treatment can prevent infection.

BASIC INFECTION PROTOCOL 2:

Infection of Mice with B. burgdorferi via Tick Infestation

Infecting mice with B. burgdorferi through the feeding of live ticks provides a method closely resembling the natural transmission route. This approach allows for a thorough examination of the intricate interactions between B. burgdorferi, the tick vector, and the mouse’s immune response to both the tick and the tick-transmitted pathogen. However, implementing this method presents several challenges that may limit feasibility for many laboratories. One significant obstacle is the need for specialized equipment, including mouse cages, racks, and facilities that are designed to prevent the accidental escape of arthropods. Maintaining a tick colony also requires a humidified incubator with precise control over a 16/8 hour light/dark cycle to facilitate tick molting from eggs to larval to nymphal stages and nymphal to adult stages, a process that takes many weeks and requires the infection of tick larvae usually by placing up to 50 larvae onto an initially anaesthetized mouse, collecting them and then using the developing nymphs for infection studies. Moreover, specialized cages are essential to collect ticks that have fed to repletion after they have detached from the mice, while also preventing tick escape into the environment.

Additionally, housing of mice individually is crucial during the infection to prevent them from grooming ticks off each other, which could compromise infection rates. More than one tick has to be placed on the mice, as the rate of infection of the ticks cannot be verified prior to their use, thus it is unknown how often and at what dose mice are infected with. Lastly, the site(s) of tick infection are unknown and thus identification of the “draining” lymph tissue not possible. This can create challenges in determining immune response kinetics and quality. For example, we noted very similar kinetics of changes in cell numbers in each tested lymph node except the draining right inguinal lymph node (Figure 4A) and patterns of IgG antibody-secreting cells (Figure 5A) after infecting mice by the tissue transplant method (see below, basic protocol 3). In contrast, the kinetics were very different for each tested lymph node when we infected mice by placing 5 B. burgdorferi infected ticks in the dorsal midline between the shoulder blades (Figures 4B, 5B). This was not a response to the tick itself, because placing the same number of non-infected larval ticks on mice did not result in sustained responses (Figure 4B).

Figure 5. Kinetics of IgG-secreting cells in the lymph node of mice after infection with B. burgdorferi using the tick infestation or tissue transplantation method.

A) Shown are mean numbers ± SD of total and B. burgdorferi-specific IgG (Bb) antibody-secreting cells (ASC) in right inguinal lymph nodes pooled from 2 C57BL/6 mice infected using the tissue transplantation method with B. burgdorferi N40 for indicated times, as assessed by isotype-specific ELISPOT analysis. For Bb-specific ELISPOTS plates were coated with a mix of 4 B. burgdorferi recombinant antigens (OspC, Arp, BmpA and DbpA), as described (Tunev et al. 2012) and each cell suspension was analyzed by serial 2-fold dilutions. B) Shown are mean numbers ± SD of total IgG ASC in right inguinal lymph nodes pooled from 2 C57BL/6 mice infected using the tick infestation method with 5 nymph ticks/mouse infected with B. burgdorferi N40. Assessment was made by isotype-specific ELISPOT.

However, as B. burgdorferi rapidly disseminates to all lymph nodes this concerns mostly studies on immune response induction and quality. For infection studies using larger species, placement of small containers with ticks glued onto the skin and fitted with membranes that allow ticks to bite through the membrane overcome the challenge of identifying the location of infection. However, the size of such devices usually prevents their ethical use with mice. If the experimental design necessitates a sham treated group, a cohort of uninfected ticks should be reared and fed on the experimental mice similar to infestation done with infected ticks.

Individual Housing of Mice:

Individual housing of mice, contingent upon scientific justification and approval from the Institutional Animal Care and Use Committee (IACUC), is crucial to prevent co-housed mice from grooming ticks off each other, thereby potentially compromising infection rates. Individual housing of mice is necessary only for the duration of the infection (thus about 3–5 days), longer isolation should be avoided.

Important Note:

Ketamine is a Class III controlled substance in some parts of the US, so appropriate approvals will need to be required before its use.

Materials:

Uninfected larval Ixodes spp ticks (BEI Resources NR-44115)

Borrelia-infected immunodeficient mice (e.g., B6-SCID_Jackson)

Ketamine/xylazine cocktail or Isoflurane (use with nose cone in a non-recirculating biosafety cabinet)

Ophthalmic ointment (e.g., Paralube) (If using a long acting anaesthetic such as ketamine/xylazine)

Paint brush

5ml polystyrene tubes with cell strainer caps (Falcon product # 352235)

Tube racks for 5ml tubes

Wire bottom hanging cages with racking system for such cages

Water pans

Sticky mats

Digital humidity monitor

Humidified incubator such as Percival I-30L (16/8 hour light/dark cycle, at or above 90% humidity, 22 degrees Celsius)

Plastic tub containing a saturated solution of Magnesium Sulfate, Anhydrous)

Caging system (see paragraph below)

The caging system described below is one that our lab has been using successfully, but may no longer be readily available. See (Nuss, Mathew, & Gulia-Nuss, 2017) for a potential alternate caging system. Prior to beginning an experiment with ticks, ensure that an incubator is set up for housing ticks before and after infestation. It needs to be adjusted to 22°C, have a 16/8 hour light dark cycle and be humidified to at least 90%. This level of humidity can be achieved by placing a plastic tub containing a saturated solution of Anhydrous Magnesium Sulfate in the bottom of the incubator to inhibit growth of mold, which can kill the ticks.

For an in-depth description of rearing and maintaining tick colonies we refer to the following excellent manual by Levin and colleagues provided on the BEI website (Levin, Schumacher, & Thangamani, 2016).

Generation of Infected Nymphal Ticks:

Prepare cages:

• 1Individual hanging, wire-bottom cages should be suspended from an appropriate racking system set up on top of sticky mats. A gap between cages should be used if spacing on the rack allows. An additional piece of wire mesh with a smaller grid size than is in the bottom of the cage may need to be cut to fit the bottom of each cage to ensure mice are comfortable while standing on the wire.
• 2Place individual pans filled halfway with water underneath each cage. As ticks feed to repletion they will drop off the mice, fall through the wire mesh into the water pan from where they can be collected.

Anesthetize B. burgdorferi-infected mice (generated as outlined for any of the protocols):

• 3Use freshly prepared solution of ketamine/xylazine (10:1 mg/kg administered i. p. in a volume of 100ml) or inhalation of isoflurane to effect, following IACUC guidelines. When using ketamine/xylazine, apply ophthalmic ointment to eyes to prevent corneal drying.
• 4Maintain anaesthetized mice on a heating pad (on a low setting) to prevent hypothermia.

Transfer non-infected larval ticks onto the skin of mice:

• 5Dip a paintbrush into a tube containing non-infected larval ticks (40–50 per tube).
• 6Allow ticks to crawl onto the brush.
• 7Gently place the brush with ticks onto the mouse’s dorsal midline between the shoulder blades and allow larvae to move onto the mouse fur/skin
• 8Ketamin/xylazine anaesthetized mice will maintain anaesthesia for 20 – 45 min. For inhalation anaesthesia, maintain effect for at least 20 minutes to allow tick attachment while avoiding grooming by the mice.
• 9Once the mouse has woken up from anaesthesia, move each mouse to an individual cage prepared as outlined above.

Collect fed larval ticks:

• 10Change water in pans daily, starting at Day 2 to keep the water as clean as possible, which helps with identifying engorged ticks.
• 11Starting at Day 3, check cages (especially water pan) daily for engorged larval ticks that have detached from the mouse.
• 12Use forceps or a paintbrush to collect these larvae and transfer them to labelled tubes with cell strainer caps (limit 20 ticks per tube).

Maintain fed larval ticks in the incubator:

• 13Place tubes in racks into a humidified incubator set for a 12/12-hour light/dark cycle (>90% humidity, set at 22°C room temperature).
• 14Monitor tubes weekly for mold growth under a microscope.
• 15If mold is present, remove ticks with a paintbrush, disinfect them by dipping them in 70% ethanol, rinsing them with sterile water, allowing them to dry on a light-colored paper towel, then transferring them to new 5ml polystyrene tubes and putting them back in the incubator.

Monitor for molting into nymphal ticks:

Molting into nymph ticks can start around 12 weeks, but may take up to 18 weeks. Individual nymphs from batches of infected ticks may be tested by PCR for presence of B. burgdorferi to establish infection rates to indicate number of nymphs needed for transferring infection to mice.

Infesting Mice with Infected Nymphs:

Anesthetize mice:

• 16Use ketamine/xylazine or isoflurane as described above following IACUC guidelines.
• 17Maintain the mouse on a heating pad on a low setting until sternal and ambulatory to prevent hypothermia.
• 18Apply ophthalmic ointment to eyes (if using ketamine/xylazine) to prevent corneal drying.

Transfer nymphs to the mouse:

• 19Dip a paintbrush into a tube containing B. burgdorferi infected nymphal ticks.
• 20Allow up to 5 nymphs to crawl onto the brush (assuming sufficiently high infection rates).
• 21Paint” the ticks onto the mouse’s dorsal midline between the shoulder blades.
• 22Maintain anaesthesia for at least 20 minutes before transferring the mouse to individual cages as described above.

Monitor for fed nymphs:

• 23Starting at Day 3, check water pans daily for engorged nymphs that have detached from the mouse and replace with fresh water at least once a day
• 24Collect these nymph ticks and transfer them to labelled tubes (limit 10 engorged nymphs/tube) for further analysis (optional) or dispose of them in a biohazard container (if not needed) after placing them into a −20C freezer at least overnight.

Maintain fed nymphal ticks in the incubator:

• 25Follow steps from the previous section for tick maintenance and mold control.

Monitor for molting (optional):

• 26Observe tubes for nymphs molting into adults (occurs 12–18 weeks after feeding (optional).

Note: Adult ticks are not suitable for feeding on mice.

Mouse Necropsy

To be performed as outlined under Basic protocol 1.

BASIC PROTOCOL 3:

Infection of Mice with Host-Adapted B. burgdorferi via Tissue Transplant

We have routinely used the below outlined protocol for infection with mammalian host-adapted spirochetes for studies on adaptive immune responses to B. burgdorferi and found the resulting B cell response to be similar to that observed after tick infection (Tunev et al., 2011). We found this protocol advantageous compared to tick infection, because in addition to avoiding the many technical hurdles of tick infections, we aim to study the draining lymph nodes at the site of infection (Figs. 4A, 5A). This is challenging to do with tick infections, as multiple nymph ticks may attach and infect at various parts of the mouse, and with locations changing for each mouse we infect. We prefer the below method also over infection with culture-grown bacteria, because we aim to avoid non-specific, mitogenic activation of B cells via OspA (Tai, Ma, & Weis, 1994) and other surface lipoproteins of B. burgdorferi that are not usually expressed as the spirochetes enter the mammalian host after a tick-bite, but are present on culture-grown bacteria. Tissue transplantation allows us to introduce “host-adapted” B. burgdorferi, thus mimicking the mammalian adapted spirochetes that disseminate from the tick bite side by antigen profile.

For studies requiring a sham-infected group of mice, the below protocol should be followed but isolating tissue from uninfected mice. For general trouble-shooting of infection protocols also see Table 3.

Table 3:

Challenges Associated with B. burgdorferi Infection Protocols

Problem	Possible Cause	Solution
Mice do not appear to have been successfully infected	B. burgdorferi may not have the full complement of required plasmids for survival in a mammalian host	Work with a low passage B. burgdorferi stock containing the essential plasmids required for infection
Non-reproducibility of infection across mice	Variability in inoculation technique or dosage	Standardize inoculation procedure and dosage, and validate efficacy across multiple experiments
	Variability in host immune response	Use genetically homogeneous mouse strains, control for environmental factors, and validate infection outcomes with appropriate controls
	Variability in bacterial strain or culture conditions	Regularly assess bacterial culture quality and virulence, maintain consistent culture conditions, and validate infection outcomes with appropriate control
Difficulty in mimicking natural transmission route	Variability in tick feeding behaviour and attachment sites	Implement meticulous tick handling techniques, and monitor tick feeding behaviour closely
	Complex logistical requirements for tick colony maintenance	Utilize specialized equipment and facilities, ensure precise environmental conditions for tick rearing, and adhere to rigorous tick handling protocols
	Risk of tick escape and environmental contamination	Implement strict containment measures, utilize appropriate housing and handling procedures, and regularly inspect enclosures for potential breaches
	Challenges in tick attachment at preferred inoculation sites	Develop methods to encourage tick attachment at specific sites, such as controlled application or use of tick chambers, and validate attachment locations to ensure consistent infection outcomes

Important Note:

1. The infection route described below constitutes survival surgery, necessitating adherence to institutional guidelines for rodent survival surgery. This includes sanitizing the surgery table, using sterile gloves, a mask, a clean lab coat, and sterile instruments.

2. Survival surgery requires IACUC approval and post-surgical monitoring of mice until the stab incision has healed, typically about 7 days. Instruments must be re-sterilized between mice by inserting the tips into a bead sterilizer for 10–15 seconds. Following sterilization lay instruments on a piece of sterile gauze until they are cool enough for handling to avoid causing thermal burns to the skin of the mouse.

Materials:

Immunocompromised inbred mice as tissue donors. Use mice on the same genetic background as the mice intended for infection (e.g., B6.SCID mice for infecting congenic C57BL6 mice).

Ketamine/xylazine cocktail or isoflurane for anaesthesia administration via nose cone.

Appropriate analgesic such as melaxicam (2mg/kg) s. c. at the time of surgery.

Surgical scrub and 70% ethanol (or sterile water) for sterilization.

Sterile 2×2 cotton gauze.

Pre-sterilized instruments including 4” serrated dressing forceps, 4” iris scissors, and 4” serrated curved tip forceps (at least 2 sets).

Sterile 60 × 15mm petri dishes for procedural use.

Bead sterilizer for instrument sterilization.

#11 Surgical blades (Bard-Parker 371211).

Surgical adhesive for wound closure.

Generation of Infected Tissue

Grow B. burgdorferi:

• 1Grow B. burgdorferi in culture to mid-log phase as described above and dilute B. burgdorferi to a desired concentration. (10⁴ − 10⁶ Bb/ml for an inoculation dose of 10³−10⁵ spirochetes per mouse has worked successfully for us).

Anesthetize mice and remove hairs from inoculation site:

• 2Anesthetize immunocompromised mice (such as B6.SCID mice) with a short acting aesthetic (such as isoflurane), shave mice along the dorsal midline between the shoulder blades.

Infect mice:

• 3Inoculate mice intradermally with B. burgdorferi in a 100μl volume (follow basic protocol 1). Return mice to cage for 2–6 weeks before collecting ear tissue as donor tissue for infections.

Prepare recipient mice for receiving the tissue transplant:

• 4If using ketamine/xylazine cocktail to anesthetize, weigh the mice to determine the dose of cocktail to administer (10mg/kg ketamine and 1mg/kg xylaine in sterile saline). Administer cocktail i. p. with a 1cc tuberculin syringe and return mouse to home cage.
• 5Once mice have lost their toe pinch reflex, remove mice from the cage one at a time and shave the fur of the right rear hock using the cordless trimmer.
• 6Apply eye ointment to each eye using sterile gauze, then lay the mouse on its side with the shaved area facing up on a sterile paper towel. Repeat the shaving and eye ointment application for all mice until completed.
• 7Wipe the shaved leg area with Nolvasan surgical scrub-moistened gauze in one direction, then repeat with 70% ethanol or sterile water. Repeat this process twice and ensure the area is completely dry before proceeding.
• 8If using a pre-surgical analgesic, administer it now.

Prepare the donor tissue containing host-adapted B. burgdorferi:

• 9Euthanize one donor mouse via inhalation of CO₂ or other approved euthanasia protocols.
• 10Clean the skin of each ear by wiping with a piece of sterile gauze wettened with Nolvasan surgical scrub. Clean both sides of the ear from the base towards the edges of the ear. Follow this with a similar treatment of the ear with gauze wettened with 70% ethanol or sterile water. Repeat 2 times then allow the ears to dry completely before proceeding.
• 11Grasp one ear by the tip with forceps. Use iris scissors to snip the ear away from the mouse’s head. Trim a small portion of the outer edge to expose fresh cut sites. Then, cut the ear in half lengthwise and place the pieces in a sterile petri dish. Further divide each ear half into four roughly equal pieces, resulting in a total of eight long, thin ear pieces per ear. Repeat the process with the other ear.

Insert donor tissue:

• 12Use a pair of dressing forceps to grasp piece of the shaved and cleaned portion of skin of the rear hock creating a “tent” in the skin.
• 13Use a sterile surgical blade to make a small stab incision making sure to cut through all layers of the skin.
• 14While continuing the hold the “tent” open, use a pair of curved forceps to grab a piece of the infected, pre-cut ear tissue and poke it through the stab incision into the subcutaneous space between the skin and the muscle. Use the dressing forceps to gently tease the ends of the incision together and apply a very small amount of surgical adhesive.
• 15Return mouse to the cage laying it surgical side up and place mouse on a tissue such as a Kim Wipe to prevent bedding from sticking to the opthalmic ointment.
• 16Repeat with remaining mice, re-sterilizing instruments between animals.
• 17Place cages of recovering mice on a heat pad (on a low setting) to prevent hypothermia and monitor mice at least once every 15 minutes until they are sternal and ambulatory, then twice a day for 7 days.
• 18Monitor the incision site daily for one week to ensure it its healing well.

Antibiotic treatment

B. burgdorferi clearance from infected mice is challenging, independent of the route of infection, and requires a monthlong regiment of antibiotics. When required for experiments we typically start treatment 6 weeks after infection, but B. burgdorferi can be cultured from most mouse tissues by 7 days post infection. We have found that treatment with ceftriaxone using a 30 day regimen can reduce B. burgdorferi tissue loads to undetectable levels by PCR and culture. Reduction in Borrelia loads correlate with a rapid loss of B. burgdorferi-specific serum IgG (Fig. 6).

Figure 6. Effects of antibiotic treatment on T-dependent IgG responses after B. burgdorferi infection using the tissue transplantation method.

Shown are mean titers ± SD of anti-arthritis related protein (Arp) plasma IgG, an antibody response that is induced in a CD4 T cell-dependent manner in C57BL/6 mice (Elsner, Hastey, & Baumgarth, 2015). Plasma was collected from the tail vein of groups of C57BL/6 mice (n = 12–14/group) infected via the tissue transplantation methods with B. burgdorferi N40. Mice were treated starting at day 46 after infection with either PBS or Ceftriaxone antibiotic (16mg/kg). Treatments were given twice a day for 5 days i.p. and then once daily for 25 days. Note the drop in serum anti-Arp IgG in antibiotic treated mice.

Materials:

Infected mice (infected via any protocol)

Scales to weigh mice

Ceftriaxone (such as Cat # 1336542 from Henry Schein)

Sterile saline solution

25 5/8 gauge needles

1cc syringes

1. Prepare a solution of Ceftriaxone to a concentration of 16mg/kg/100ul in saline (calculated based on the average weight of the mice at treatment).

2. Using a 25 5/8 gauge needle attached to a 1cc syringe apply ceftriaxone in saline solution to mice via i.p. administration. Repeat this treatment twice daily for 5 days.

3. After 5 days continue treating mice once daily for 25 days with the same dose of ceftriaxone.

REAGENTS AND SOLUTIONS:

Preparation of BSK II Medium:

Autoclave Gelatin Solution:

• 1Weigh out 14g of gelatin using a sterile spoonula and add it to a sterile 2L bottle along with 200ml of ddH₂O. We have used Gelatin, Laboratory Grade, 275 Bloom (stiffness), Type A (e.g. obtained from either pigs, poultry and/or fish), Cat # G8–500, Fisher. However, product is no longer commercially available. Suggested replacement: Spectrum GE105, a 250 bloom Type A gelatin (Fisher).
• 2Place a sterile stir bar in the bottle and loosely cap it.
• 3Autoclave the bottle on the liquid cycle for 15–20 minutes.
• 4After autoclaving, cool the bottle to room temperature and then transfer to a heated stir plate set to a low stir and low heat setting until gelatin is fully dissolved.

Preparation of Dry Ingredients:

• 5
  In a separate, sterile, 2L bottle, combine the following using sterile spatulas/spoonulas:

  • 6g HEPES (Millipore Sigma H3375)
  • 0.7g Sodium Citrate (Fisher S279–500)
  • 5g D+ Glucose (Millipore Sigma G8270)
  • 0.8g Sodium Pyruvate, stored in a desiccator at 4°C (Millipore Sigma P2256)
  • 0.4g N-acetyl-D-glucosamine, stored in a desiccator at −20°C (Millipore Sigma A8625)
  • 0.3g Magnesium Chloride, stored in a desiccator at room temperature (Sigma-Aldrich M2393)
  • 2.2g Sodium Bicarbonate (Millipore Sigma S8875–500)
  • 5g Neopeptone (Fisher Scientific DF0119-17-9)
  • 1g Tryptone (Fisher Scientific DF0123-17-3)
  • 1g TC Yeastolate (Fisher Scientific DF5577-15-5)
• 6Recap the bottle, spray the outside with 70% ethanol, and complete the remaining steps in a BSC.

Final Preparation and Sterilization:

• 7
  Add the following to the bottle containing the autoclaved gelatin solution:

  • IL CMRL Media (Thermo Fisher 11530037)
  • 100ml Rabbit Serum (Thermo Fisher 16120099)
  • 143ml 35% BSA (Millipore Sigma A7979)
• 8Mix thoroughly on a stir plate, then add 0.9ml of 10N NaOH and verify the pH is around 7.6 by removing a 20ul and adding it to a pH strip.
• 9Attach a 0.22-micron bottle top filter (containing a pre-filter, rough side down) to the top of the gelatin bottle.
• 10Add the CMRL/rabbit serum/BSA/dry ingredient mixture to the cooled but still warm gelatin solution. Gelatin solution should be continuously slowly stirred on a heated stir plate.
• 11Re-cap the bottle and incubate at 30 – 37°C for 2 days to ensure sterility before aliquoting in a BSC.
• 12Assess sterility by noting color and clarity of the media and by assessing solution under the microscope, checking for mold spores, or visible bacteria.

Aliquoting and Storage:

• 13Aliquot 3 ml sterile BSK II media into 5ml polystyrene snap cap tubes for generating cultures of B. burgdorferi for infecting mice.
• 14Store all aliquots at −20°C until ready to thaw for growing B. burgdorferi.
• 15BSK II medium can be stored at −20°C for several years without apparent loss of ability to grow B. burgdorferi.

COMMENTARY:

BACKGROUND:

In the study of Lyme Disease pathogenesis, the infection of mice with B. burgdorferi can serve as an important model system. Understanding how this bacterium interacts with the mammalian host immune system is paramount for developing effective treatments and preventive measures. Most studies with mice have been performed using laboratory mice, taking advantage of the fact that inbred C3H mice develop arthritis, similar to arthritis development seen in some humans, while other strains of mice, such as C57BL/6 and BALB/c, show little evidence of arthritis, carditis or other signs of disease manifestations. Infection studies have also been performed with “white-footed mice” (Peromyscus leucopus). P. leucopus is the main reservoir species of B. burgdorferi in the northeast and midwest of the US and despite its name, is genetically closer related to rats than mice (Barbour, 2017). The effects of B. burgdorferi infection on P. leucopus seems to mimic those seen in the disease resistant laboratory mouse strains (Barbour et al., 2008), rather than in “accidental hosts” such as humans, dogs and horses. This suggests that infections with inbred mice are a good alternative to studies with P. leucopus, while assessment of the pathophysiology of Lyme disease seen in accidental hosts may be limited and best performed using disease susceptible C3H mice. Weis and colleagues have used the difference in disease susceptibility of inbred mouse strains to explore critical host genetic factors underlying Lyme disease. By crossing disease resistant C57BL/6 mice with C3H mice and generating recombinant inbred lines they identified enzymatic deficiencies causing reduced removal of tissue debris as underlying causes for their arthritis susceptibility. They also demonstrated the induction of Type I IFN as overall detrimental for anti-Borrelia host immunity (Bramwell, Ma, et al., 2014; Bramwell, Teuscher, & Weis, 2014; Lochhead, Strle, Arvikar, Weis, & Steere, 2021).

As outlined in the above protocols (Basic Protocol 2), laboratory mice can be infected with B. burgdorferi through the natural route by infestation with infected ticks, usually using nymph ticks. This method presents a number of logistical challenges, such as obtaining and infecting ticks and maintaining tick colonies for extended periods of time under appropriate biosafety conditions. Moreover, multiple ticks have to be placed on an animal to ensure infection and thus the dose of infection cannot be precisely controlled. However, this approach provides a unique opportunity to study the complex interactions between the bacteria, their arthropod vector, and the mammalian host immune system. Importantly, the tick-bite exposes the mammalian hosts to an array of tick salivary proteins, including components that inhibit blood clotting and complement activation. Not only do these proteins affect the local immune response to the tick-bite, in some species such as hamsters, albeit not mice, they can induce anti-tick immunity. In humans, exposure to the saliva components of Amblyomma ticks has been associated also with induction of allergic reactions to red meat, the so called “Alpha Gal Syndrome” (Jmel et al., 2023; Karim, Leyva-Castillo, & Narasimhan, 2023; Kurokawa et al., 2020).

The most common method employed to infect mice with B. burgdorferi, however, is the intradermal injection of culture-grown bacteria (Basic Protocol 1). This method avoids the need for infected ticks, but required development of rich culture media that provide B. burgdorferi with the complex set of nutrients it requires to survive and expand in vitro. The modified Barbour-Stonner-Kelly-II medium (Barbour, 1984) is the most common one currently used, and we include a recipe for it here. The medium allows growth of all strains of B. burgdorferi, including B. burgdorferi sensu stricto, B. bavariensis, B. afzelii and B. garinii, the latter two the main Borrelia strains causing Lyme disease in Europe (Ruzić-Sabljić & Strle, 2004). This infection method allows for precise control over the dose and site of infection, facilitating standardized experimental conditions and reproducible results. The gene expression profile of tissue grown B. burgdorferi, however, is likely neither representative of that seen in the ticks, nor that expressed in the mammalian host. The latter is exemplified by their expression of outer surface protein A (OspA) in culture, a lipoprotein of Borrelia that is required for tick-transmission, but rapidly lost in the mammalian host (de Silva, Telford, Brunet, Barthold, & Fikrig, 1996). Many aspects of B. burgdorferi pathogenesis have been studied using this method, including B. burgdorferi migration and dissemination, anti-Borrelia innate and adaptive active and passive immunity, and the efficacy of antibiotics.

To overcome the limitation of infecting mice with culture-adapted spirochetes, an alternative tick-free method of infection was developed, described here as Basic Protocol 3. This method uses the subcutaneous placement of small pieces of skin tissues from infected immunocompromised mice, in which Borrelia is present at high concentrations (Barthold, 1993). This method thus allows infection with mammalian-adapted spirochetes, overcoming some of the limitations of infections with culture-grown Borrelia, and also maintaining the ability to identify draining lymph nodes at the site of infection. The method appears to faithfully recapitulate bacterial dissemination and immune response induction in draining lymph nodes seen after a tick-bite, albeit with somewhat faster dissemination kinetics (Tunev et al., 2011). However, this approach requires the use of inbred mice to avoid tissue rejection, and it introduces injury of the skin and thus is best controlled via the use of a control group of sham-infected mice that receive a transplant from non-infected mice.

Successful infection of mice results in dissemination of B. burgdorferi from the site of infection throughout the mouse (Bockenstedt, Wooten, & Baumgarth, 2021; Casselli et al., 2021; Philipp & Johnson, 1994). This can be assessed in live animals by collecting an ear punch for PCR amplification of B. burgdorferi antigens, or noting seroconversion by ELISA or Western Blot following collection of serum from infected mice. At necropsy, various tissues can be taken for data analysis, such as serum for ELISA assays or Western Blots, DNA extraction of any tissue for assessment of B. burgdorferi tissue burden by culture or PCR, RNA extraction of tissues for transcriptional profiling of host or Borrelia, lymph nodes, spleen, bone marrow, and PBMCs for flow cytometry or ELISpot analysis, and joint tissues such as the tibiotarsal joints and the heart base for histopathological evaluation of arthritis and carditis, respectively. The development of GFP-expressing B. burgdorferi (Figure 1) has also allowed studies of bacterial dissemination via two-photon intravital imaging and immunofluorescence staining (Belperron, Mao, & Bockenstedt, 2018; Chaconas, Moriarty, Skare, & Hyde, 2021; Guo et al., 2022).

Gene Expression Dynamics of B. burgdorferi:

B. burgdorferi undergoes significant modulation in gene expression throughout its lifecycle stages, leading to variations in protein expression between culture, tick midgut and salivary glands and vertebrate hosts. These dynamic processes are crucial for host adaptation and understanding of immune responses during infection (Brisson, Drecktrah, Eggers, & Samuels, 2012; Grassmann et al., 2023; Stevenson, 2023).

Inoculation Technique and Dosage:

• Syringe Inoculation: Allows for precise control over the site and dose of inoculation, mimics tick infestation. Use of culture-adapted spirochetes. Lack of tick factors.

• Tick Infestation: Constitutes natural transmission. Difficult to control the infectious dose and the sites of infection.

• Tissue Transplantation: Infection with host-adapted B. burgdorferi at distinct and reproducible site of infection. Potential for non-specific effects introduced via stab-wound. Not a natural route of infection.

Significance of Low Passage Strains:

Utilizing low passage B. burgdorferi strains is paramount due to the loss of essential plasmids with serial passaging. These plasmids play a critical role in infectivity, underscoring the necessity of employing low passage strains for accurate infection models (Grimm, Elias, Tilly, & Rosa, 2003).

Anaesthesia and Animal Welfare:

• Administer appropriate anaesthesia agents and dosages tailored to the experimental requirements and the health status of the animals.

• Provide post-surgical monitoring and pain management as per institutional guidelines and ethical considerations to minimize pain and distress in experimental animals.

Equipment and Environmental Control:

• Use suitable equipment and maintain appropriate environmental conditions tailored to each protocol’s requirements.

• Consider specialized equipment and environmental modifications necessary for tick infestation experiments, such as humidified incubators with controlled light cycles and room set up designed to prevent tick escape.

DATA AVAILABILITY STATEMENT:

The data that support the findings of this study are available from the corresponding author upon reasonable request.