Sterile inflammation induced by respirable micro and nano polystyrene particles in the pathogenesis of pulmonary diseases

Abstract

Sterile inflammation is involved in the lung pathogenesis induced by respirable particles, including micro- and nanoplastics. Their increasing amounts in the ambient and in indoor air pose a risk to human health.

In two human cell lines (A549 and THP-1) we assessed the proinflammatory behavior of polystyrene nanoplastics (nPS) and microplastics (mPS) (Ø 0.1 and 1 μm). Reproducing environmental aging, in addition to virgin, the cells were exposed to oxidized nPS/mPS. To study the response of the monocytes to the inflammatory signal transmitted by the A549 through the release of soluble factors (e.g. alarmins and cytokines), THP-1 cells were also exposed to the supernatants of previously nPS/mPS-treated A549. After dynamic-light-scattering (DLS) analysis and protein measurements for the assessment of protein corona in nPS/mPS, real-time PCR and enzyme-linked-immunosorbent (ELISA) assays were performed in exposed cells. The pro-inflammatory effects of v- and ox-nPS/mPS were attested by the imbalance of the Bax/Bcl-2 ratio in A549, which was able to trigger the inflammatory cascade, inhibiting the immunologically silent apoptosis. The involvement of NFkB was confirmed by the overexpression of p65 after exposure to ox-nPS and v- and ox-mPS. The fast and higher levels of IL-1β, only in THP-1 cells, underlined the NLPR3 inflammasome activation.

Introduction

Sterile inflammation is one of the first steps involved in the lung pathogenesis induced by respirable micro- and nanosized abiotic particles, such as fine and ultrafine particulate matter, asbestos, DEF emission, engineered nanoparticles, etc., ^1–4 which remain in the human alveolar region for a long time. Due to the clearance mechanism based only on phagocytosis by alveolar macrophages, the half life of particles is estimated to be approximately up to 700 days, causing long-lasting tissue damage that contributes to the development and exacerbation of inflammatory lung disorders.^5,6 Although the goal of sterile inflammation is tissue repair and healing and restoration of homeostasis, limited particle-induced cellular damage can be exacerbated by innate immune cell recruitment and the generation of pro-inflammatory cytokines and chemokines, causing systemic responses.^7,8 In the lungs, oxidative burst by professional phagocytes induces chronic obstructive pulmonary disorder (COPD), silicosis, asbestosis etc.^6,9,10, as well as, the release of proteases and growth factors, causes fibrosis due to fibroblast proliferation and collagen accumulation.¹¹

Among the air-borne respirable particles, micro- and nanoplastics raise considerable concern, posing a risk to human health due to their increasing amounts that can be found in the ambient air and, above all, in indoor environments.^12,13

Their distribution in the air is influenced both by intrinsic properties (shape, size, and density) and by extrinsic factors such as population size and winds. The low density, ranging from 0.85 to 1.41 g/cm³, favors the long stay in the air, which is estimated to be 5 years for synthetic textile fibers, increasing human exposure by inhalation.^14,15 Several types of microplastics have been identified in the lung tissue of living humans.¹⁶ Plastic particles, once inhaled, can be translocated by active cellular uptake, which occurs through contact with the bronchial epithelium after penetration of the lung lining fluid, while nanoplastics infiltrate the pulmonary epithelial barrier and pass easily into the bloodstream.¹⁷

Previously, our in vitro studies were aimed at assessing the potential pathogenic effects of these emergent ubiquitous xenobiotics^18–20 which, similarly to engineered nanoparticles^21–23 can trigger cellular damages in almost all body districts. The pro-oxidant power of nano and microplastics is unanimously recognized as the basis of the pathogenetic mechanism, causing redox imbalance due to the overproduction of ROS, such as singlet oxygen, super-oxide anion radicals, oxygen radicals, peroxide ions, hydrogen peroxide, and hydroxyl radicals. This common denominator is due to surface-induced particle reactions that, interacting with biomolecules and organelles, cause biochemical and morphological damages, such as lipid peroxidation, protein carboxylation, DNA damages, mitochondrial dysfunction and changes in the endocytic apparatus.^24,25

The resulting damages can cause cellular death; unlike apoptosis, which is immunologically silent, in pyroptosis and necrosis the rupture of plasma membranes releases intracellular contents (e.g. alarmins such as heat shock proteins (HSPs), endogenous DNA and RNA, chromatin-associated protein high-mobility group box 1 (HMGb1), able to trigger inflammation as an innate host defense response. These potent inflammogens, termed damage-associated molecular patterns (DAMPs), activate innate immune cells through transmembrane proteins, named toll-like receptors (TLRs). However, other host receptors that are not necessarily involved in pathogen recognition, such as cytoplasmic NOD-like receptors (NLRs), including NLRP3 that activates the inflammasome pathway, and receptor for advanced glycation end products (RAGE), can also sense sterile stimuli triggering inflammatory responses. In addition, pyroptotic and necrotic cells can release intracellular cytokines, such as interleukin-1α (IL-1α), that are promoters of the sterile inflammatory response.²⁶ Moreover, oxidative stress plastic-particle-induced, can allow the activation of cell signaling pathways such as nuclear factor kappa-light-chain enhancer of activated B cells (NF-κB) by the proteasome degradation of ikBα and the expression of inflammatory cytokines.²⁷

The aim of this in vitro study was to investigate the proinflammatory behavior of polystyrene nanoplastics (nPS) with a diameter of 0.1 μm and polystyrene microplastics (mPS) with a diameter of 1 μm in two different human cell lines, such as the alveolar epithelial cells (A549) and the monocyte cells (THP-1). Reproducing environmental aging processes, in addition to virgin, both cell types were exposed to in house oxidized nPS/mPS, in order to better simulate actual exposure conditions.²⁸ Considering that the biological effects of particles are mainly due to surface-mediated reactions, it is plausible to believe that the higher presence of oxygen groups, due to photo-oxidative reactions UV-mediated, increases the reactivity of the particles.

In order to evaluate the possible response of the monocytic cells to the inflammatory signal transmitted, after inhalation, by the alveolar epithelial cells through the release of soluble factors, including alarmins and cytokines, additional experiments in THP-1 cells were performed after exposure to supernatants of previously nPS/mPS-treated A549.

Materials and methods

Exposure conditions and cell models

Both polystyrene microparticles mPS (average size 1 μm) and nanoparticles nPS (average size 100 nm) were purchased from Merck Life Science S.r.l. (Milan, Italy; code: BCC8557 and BCC9279). Stock suspensions (10 mg mL⁻¹) in phosphate-buffered saline (PBS) were used as virgin n/mPS. Aliquots of these stock suspensions were treated at 80 °C for 2 h²⁹ to obtain the “in house aged n/mPS” (ox-n/mPS). As previously reported, this oxidative treatment caused the presence of carboxyl, alkoxyl and hydroxyl groups on the particle surface, simulating the photoaging due to ultraviolet (UV) radiation to which airborne particles are exposed. Both v- and ox- n/mPS were characterized by Fourier-Transform Infrared (FT-IR) spectrometry, dynamic light-scattering (DLS), scanning electron microscopy (SEM) and UV–Vis spectrophotometry.¹⁹ While UV–Vis and FTIR spectra highlighted the presence of oxygen functionalities, SEM observations and Dynamic light-scattering (DLS) analyses confirmed the same average size of the functionalised microplastics. The results suggested that the only particles’ surfaces were oxidised and there was no aggregation of the particles, also thanks to electrostatic repulsion. In this study further DLS analyses were performed by using as solvent the same cell media used in experiments to assess possible aggregates, due to protein-particle interactions. Although the presence of proteins could partially neutralize the effect of the particles due to the so-called “protein corona” (PC), we believe that this protocol best simulates the pathophysiological effects nPS/mPS-induced in the biological environment. The corona effect could hinder intake due to their increased bulk and the loss of hydrophobicity, which is known to promote the interaction of particles with cell membranes.³⁰ In addition to DLS analyses, we measured the proteins adsorbed to nPS/mPs by the Bradford method.³¹ In particular, these were dosed in v- and ox-nPS/mPS suspensions in cell media after contact for 30′ at 37 °C. After centrifugation at 18,000 g for 8′, the pellets were resuspended in PBS to perform the analysis.

To assess the proinflammatory effects of v- and ox nPS/mPS suspensions, we used the human alveolar cell line A549 (ATCC-CCL-185^Tm) and the human monocytic cell line THP-1 (ATCC-TIB-202^Tm). The first is the model of choice for in vitro studies of airborne pollutants, and the cells were cultured in F-12 K medium (Gibco™ 21127022) supplemented with 2 mM of L-glutamine, 10% of inactivated fetal bovine serum (FBS), and 1% penicillin/streptomycin/amphotericin. In particular the final concentrations were 100 IU, 0.1 mg and and 0.25 μg mL⁻¹ for penicillin, streptomycin and amphotericin B, respectively. THP-1 cells were cultured in RPMI 1640 medium (Merck Life Science S.r.l.; Milan, Italy) supplemented with 2 mM of L-glutamine, 10% of inactivated fetal bovine serum (FBS), 1% penicillin/streptomycin/amphotericin, HEPES (10 mM), sodium pyruvate (1 mM), glucose (2.5 g L⁻¹) and 2-mercaptoethanol (0.05 mM). Both cell cultures were incubated at 37 °C in a 5% CO₂/95% air-humidified atmosphere. The passage numbers ranged between 10 and 20 and between 20 and 30 for A549 and THP-1 cells, respectively.

For all experiments in A549, the exposure treatment was performed in semiconfluent monolayers (i.e. 9 x 10⁴/cm²) grown for 24–36 h and incubated with v- and ox-nPS/mPS suspensions (100 μg mL⁻¹ for 6 and 24 h) that were set up in cell medium containing 2% FBS (maintenance cell medium). THP-1 cells, which were morphologically roundish, were grown in suspension and subcultured or treated with sample suspensions in their maintenance cell medium (as above reported) when the density was equal to 9 × 10⁵ mL⁻¹. In order to assess the cross-talk between epithelial and monocytic cells to orchestrate the inflammatory cascade, some experiments were performed exposing THP-1 cells for 3 h to the supernatant of the previously exposed A549. This allowed to highlight as, through the release of specific cytokines and alarmins, the inflammatory signals were transmitted, triggering the activation of innate immune cells.

Gene expression analyses

The pro-inflammatory effects of mPS/nPS exposure in both cell lines were assessed by studying the changes in the expression of some key genes. As cellular markers of inflammation, we measured, performing a Real Time PCR, the gene expression of some cytokines. In particular, the transcript levels of interleukins −6 and -1β (IL-6, IL-1β), tumor necrosis factor-alfa (TNF-α) and interferon gamma (IFN-γ) were assessed. As components of the inducible transcription factor NFkB, the mRNA levels of p50 (NF-κB1) and p65 (RelA) were measured, while the gene expression of Bax and Bcl-2 was tested for the assessment of genes involved in cell survival.

In the pellets of exposed cells, total RNAs were isolated using TRIzol (Life Technologies), a reagent consisting of a monophasic solution of phenol and guanidine thiocyanate that maintains RNAs integrity while cells were destroyed and cellular components were dissolved. For each sample, 2 μg of total RNA were reverse-transcribed with High-Capacity cDNA Archive kit (Life Technologies) following the manufacturer’s instructions. Then, IL-6, IL-1β, TNF-α, IFN-γ, p50, p65, Bax and Bcl-2 mRNA levels were analyzed by Sybr Green Real-Time PCR using β-actin as an endogenous control. Real-Time PCRs were set up in duplicate in a 96-well plate with a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) by using a 10 μL reaction volume containing 1 × Sybr Green Mastermix (Life Technologies), 0.1 μM specific primers and 25 ng of RNA converted into cDNA. The following process was used: one cycle at 50 °C for 2 min, 95 °C for 10 min, 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. A standard dissociation stage was added to assess primer specificity. The primer sequences, including the one of β- Actin used as internal reference gene, are reported in Table 1.

Table 1.

Primers used for real-time PCR analysis of gene expression.

Target	Primer Sequence 5′ > 3′
	Forward	Reverse
IL-6	TGAGAGTAGTGAGGAACAA	CGCAGAATGAGATGAGTT
IL-1β	GCTTATTACAGTGGCAATGA	TAGTGGTGGTCGGAGATT
TNF-α	GTGAGGAGGACGAACATC	GAGCCAGAAGAGGTTGAG
IFN-γ	GCAGCCAACCTAAGCAAGAT	TCACCTGACACATTCAAGTTCTG
NF-κB1 (p50)	ACACTGGAAGCACGAATGACAGA	CCTCCACCTTCTGCTTGCAA
RelA (p65)	CAGGCGAGAGGAGCACAGATAC	TCCTTTCCTACAAGCTCGTGGG
Bax	GGACGAACTGGACAGTAACATGG	GCAAAGTAGAAAAGGGCGACAAC
Bcl-2	ATCGCCCTGTGGATGACTGAG	CAGCCAGGAGAAATCAAACAGAGG
β- Actin	TTGTTACAGGAAGTCCCTTGCC	ATGCTATCACCTCCCCTGTGTG

Data were analyzed using the 2 − ΔΔCt relative quantification method, and values are presented as fold changes relative to controls.

Detection of secreted cytokines

To evaluate quantitative measurement of human TNF-α, IFN-γ, IL-1β and IL-6 in cell culture supernatants, we used the Enzyme-Linked Immunosorbent Assay kit (Sigma-Aldrich, Milan, Italy). The protocol was the same for all proteins investigated and followed the manufacturer’s instructions. Spectrophotometric measurements at 450 nm were performed using a microplate reader (Tecan Italia, Milan- Italy). For each sample the protein’s amounts were obtained by reading the optical density value on the respective calibration curve, constructed using scalar dilutions of the standards (i.e. positive controls) provided in the kits.

Statistical analyses

All data are presented as mean ± standard error (SE) based on at least three independent experiments. Data were analyzed by one-way analysis of variance (ANOVA) and multiple comparisons of the means were performed by the Tukey–Kramer test (Graf PAD Software for Science). The relationships between different parameters were assessed by the Pearson correlation coefficient. Significance was accepted at P < 0.05.

Results

DLS analyses for the assessment of protein corona

For a better characterization of the assayed plastic particles in biological conditions, DLS analyses and the protein dosage on the particle surfaces were performed in v- and ox-nPS/mPS suspensions in maintenance cell media.

Figure 1 reports the results of DLS analyses. The absence of aggregates due to protein interaction is clearly observable and all particles, both virgin and oxidized, show a normal distribution that was centered at 116.6 nm in v-nPS and at 160.7 nm in ox-nPS, while for v- and ox-mPS the values were 1,450 and 1,239 nm respectively. In comparison to nPS/mPS suspended in PBS the values increased by 16.0 and 48.8% in v- and ox-nPS. Instead, in v- and ox-mPS the increases were 61.1 and 36.3% respectively, highlighting as particle-protein interactions allow the presence on the surfaces of all plastic particles of protein corona. This was confirmed by the Bradford test and in experimental conditions (e.g. 2% SFC in maintenance cell media) the amounts of proteins in 1 mg mL⁻¹ of v- and ox-nPS/mPS were 3.44, 4.49, 9.00 and 7.48 μg mL⁻¹ respectively. Considering the total protein amounts in cell media, equal to 328.7 μg mL⁻¹, the percentages adsorbed to the particles ranged from 1.05 to 2.74% underscoring a different particle capability to absorb proteins. Despite the fair overlap between DLS and Bradford results, the percentage increase in diameter was not related to the amount of proteins. No significant differences were observed between v- and ox polystrene particles, while the amount of proteins present on the mPS was greater, despite, for unit mass the surface area of the nPS was higher.

Fig. 1.

DLS spectra for the assessment of v- and ox- nPS/mPS sizes, suspended in maintenance cell medium (e.g. 2% SFC). The absence of aggregates due to protein interaction is clearly observable and all particles, both virgin and oxidized, show a normal distribution that was centered at 116.6 nm in v-nPS and at 160.7 nm in ox-nPS, while for v- and ox-mPS the values were 1,450 and 1,239 nm respectively.

Pro-inflammatory effects and regulation of cell survival induced by nPS/mPS

The inflammatory cascade triggered by v- and ox- nPS/mPS was tested on the alveolar cells A549 as well as on the monocytic THP-1 cells, exposed to nPS/mPS suspensions.

The results, obtained by performing Real-Time PCR on A549 and THP-1 cells are reported in Fig. 2A and B. The transcript levels of each gene were generally measured after 6 and 24 h of exposure to assess the timing of triggering the inflammatory response. In both cell lines, after treatment, the expression levels were clearly diversified as a function of the particle types (sizes and virgin or oxidized) in comparison to control cells.

Fig. 2.

Results of gene expression analyses, performed by Sybr green real-time PCR, of A549 (A) and THP-1 cells (B) treated with v- and ox-mPS/nPS suspensions (100 μg mL⁻¹) for 6 and 24 h.

As cellular markers of inflammation, the gene expression of interleukins −6 and -1β (IL-6, IL-1β), tumor necrosis factor-alfa (TNF-α) and interferon gamma (IFN-γ) were assessed. As components of the inducible transcription factor NFkB, the mRNA levels of p50 and p65 were measured.

In A549 cells, the inflammatory effect of the assayed samples was always precocious and greater changes in RNA levels compared to control cells were observed after 6 h (Fig. 2A). The involvement of NFkB was confirmed by the early overexpression of p65 after exposure to ox-nPS and mPS, both v- and ox-. While mRNA values were on average threefold higher after 6 h (P < 0.01), the values decreased at 24 h. Regarding cytokine genes, only the ones of TNF-α and IFN-γ were overexpressed. The mPS caused more marked increases in mRNA (up to 4 times; P < 0.01), while for the nPS the transcript values on average doubled.

In the monocytic cells, the v-nPS promoted the inflammatory cascade also activating NFkB (Fig. 2B). In cells exposed for 6 h to v-nPS, the mRNA levels of both p50 and p65 were significantly increased (P < 0.05) while no differences were observed for ox-nPS, v- and ox-mPS. A similar behavior was observed in the expression of IL-6, TNF-α and IFN-γ which were overexpressed only in cells exposed to v- and ox-nPS. In particular, for all these genes the mRNA levels were, already after 6 h, at least double (P < 0.05) in cells exposed to v-nPS, while ox-nPS caused a later (24 h) increase in mRNA. In THP-1 cells, the proinflammatory effect of mPS was observed exclusively by the increased expression of IL-1β (P < 0.01), induced only after exposure to ox-mPS. Also, v- and, above all ox-nPS, produced an increase in the transcript levels of this cytokine.

Further, experiments were performed on both cell lines treated with v-nPS/mPS for only 3 h to assess the earliest effects and highlight the speed of transmission of signals between different cells, able to trigger the inflammatory cascade (Fig. 3A and B). The regulation of cell survival in A549 exposed to v-nPS and mPS was studied by quantifying the mRNA of Bax and Bcl-2, both of which play a key role in the homeostatic balance between growth and cell death (Fig.3A). The Bax/Bcl-2 ratio, calculated to assess the balance between proapoptotic Bax and antiapoptotic Bcl-2 levels, underlined a severe imbalance in the exposed alveolar cells. After exposure for 3 h, nPS and mPS induced antiapoptotic signal increasing consistently the expression of Bcl-2 in comparison to Bax. In particular, the imbalance was more marked in nPS exposed cells, which showed a Bax expression 20 lower than that of Bcl-2 at the time tested.

Fig. 3.

Results of gene expression analyses in both cell lines treated for 3 h with v- mPS/nPS (A and B). In addition to THP-1 cells directly exposed (de) to mPS/nPS, the experiments were performed in THP-1 treated with the supernatant obtained from A549 cells that had been exposed to mPS/nPS (ie) for the same time. Bax and Bcl-2 was tested for the assessment of genes involved in cell survival and reported as Bax/Bcl-2 ratio to highlight the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins.

Furthermore, the results obtained in THP-1 cells exposed to soluble components released by A549 cells treated with v-nPS/mPS were intriguing. Unlike the monocytic cells directly exposed to v-nPS/mPS, in these experiments the expression of TNF-α and IFN-γ was very early (Fig. 3B). In particular, already after 3 h of exposure to the supernatant of A549 treated with v-nPS as well as v-mPS, the mRNA levels of TNF-α in THP-1 cells were on average sixfold higher, while the ones of IFN-γ were 5 and 3 fold higher (P < 0.01). As reported in the Fig. 3B, in the same times no changes in gene expression were observed in THP-1 cells directly treated with v-nPS and v-mPS. Unlike the A549, the expression of proapoptotic Bax and antiapoptotic Bcl-2 in monocytic cells directly exposed to nPS/mPS as well as treated with the supernatant of exposed A549 was far less strong and without marked differences between nano- and micro-plastics, underscoring the greater homeostatic capacity of these cells, which is physiologically responsible for neutralizing foreign agents.

The results of ELISA test confirmed in A549 cells the increased levels exclusively for TNF-α, already after exposure for 6 h and for IFN-γ after 24 h for all examined PS particles. The increased expression of IL-1β exclusively in THP-1 cells was confirmed by the protein values obtained by the ELISA test, which were sixfold higher after exposure to ox- nPS/mPS (P < 0,01). The more marked pro-inflammatory effect in monocytic cells of nPS both v-and ox- was confirmed by the higher levels of Il-6, TNF-α and IFN-γ recorded by ELISA test.

Discussion

In biological environments, almost all abiotic particles interact with biomolecules, mainly proteins, which form a “protein corona” (PC) layer, also named “biomolecular corona” around foreign particles. These molecules either get loosely attached and form soft protein corona or are tightly adsorbed and hard protein corona “hard PC” formation occurs. Accordingly, this dynamic multilayered covering is formed by high-affinity proteins that are rapidly and directly adsorbed onto the particle surfaces, changing their native conformation while, outside, they weakly interact forming “soft PC,” which does not show conformation changes.^32–34

The particle features such as size, surface chemistry and charge are the critical factors influencing the protein corona which in turn modulate the biological behavior, giving a new identity and features to the particles that, however, change over time, due to dynamic processes such as adsorption and desorption. As reported by Li et al.,³⁴ first the quantitatively most present proteins are adsorbed to particle which, after desorption, are replaced by those with greater affinity.

Considering the role of nanoparticles in drug delivery, recently many studies on protein corona have been performed in order to assess how protein corona composition affects pharmacokinetic activity, biodistribution, half-life, safety and, above all, the cellular uptake of these carriers, which are used to facilitate targeted delivery of the drugs.^32,35,36 Despite the protein corona also plays a pivotal role in modulating particle pathogenesis, this aspect is still poorly considered in environmental and occupational toxicology.

Even if partially, in vitro studies aimed at assessing the biological effects of corpuscular xenobiotics simulate the interaction with cells in different body compartments (extracellular matrix, interstitial fluid) thanks to the use of media that must guarantee cellular metabolism. Our results highlight how the interaction between biological molecules present in cell media and particles modified their size without causing particle aggregations, which hindered internalization. Surprisingly, we found that, despite the smaller surface area developed, the quantity of proteins was greater in mPS and, particularly in v-mPS. Even if the size observed in DLS analyses was due to all biological molecules that were adsorbed to particle surfaces, only protein dosage was performed and no significant differences were observed between virgin and oxidized particles, despite the presence of functional groups in the latter, which could favor the interactions with biomolecules present in the medium. The higher increases in size and protein amounts in mPS are presumably attributable to the surface curvature, considering that protein adsorption is inversely related to this parameter, as reported by Gu et al.³⁷ and Mesaric et al.³⁸ The authors stated that surface curvature is generally believed to restrain adsorption capacity, which reaches its maximum on flat particles such as graphene sheets. However, this thesis is not unanimously accepted, and several authors believe that the stronger curvature of small particles optimizes the packing of proteins on the surface, preventing steric hindrances, due to lateral interaction between neighboring proteins.^33,39 Also, hydrophobicity influences the PC formation, increasing the protein amounts as this parameter increases,³¹ explaining what we observed in the v-mPS with greater hydrophobicity.

However, the presence of corona proteins does not preclude their uptake in different cell types, as we and other authors have already demonstrated.^6,19,20,40 This causes pathogenic effects, including the proinflammatory behavior assessed by us in this study which highlighted the inflammatory cascade triggered by v- and ox-nPS/mPS both on the alveolar and monocytic cells. Despite inflammation is an efficient mechanism of innate immunity activated for defense against foreign agents and to restore tissue integrity, it is well known that it represents a double-edged sword when the inflammatory process becomes chronic, causing more or less extensive tissue and organ damage. This most likely happens when long-half-life abiotic particles, including nano and microplastics, trigger the inflammation.⁶

The pro-inflammatory effects of v- and ox-nPS/mPS were attested by the fast and severe imbalance of the Bax/Bcl-2 ratio in the alveolar cells. The antiapoptotic signal, due to the increased expression of Bcl-2 protein, highlighted as, the exposure to nPS/mPS, inhibiting the immunologically silent apoptosis, clearly trigger the inflammatory cascade. The results obtained in the monocytic cells treated with the soluble factors released from the v-nPS/mPS-exposed alveolar cells would seem to highlight the activation of this pathway. In lytic cell death, such as pyroptosis, induced by the pore-forming gasdermin proteins, and necrosis, the loss of plasma membrane integrity releases intracellular contents (alarmins) which, interacting with membrane receptors in the cells of innate immunity, trigger the host response.⁴¹ The failure of apoptosis in alveolar cells could be the trigger causing chronic airway inflammation. As stated by Hallett et al.,⁴² there is a clear imbalance between the pro- and anti-apoptotic proteins in the inflammation process, and the level of pro-apoptotic Bax is inversely related to the severity of the host response. Unlike monocytic cells directly exposed to v- and ox-nPS/mPS, in those indirectly exposed, the soluble factors released by alveolar cells are sensed by the inflammatory cells that, more effectively, change their phenotype and orchestrate the inflammatory process. The early and markedly increased expression of TNF-α and IFN-γ in THP-1 highlighted the efficiency of cross talk between epithelial cells and innate immunity cells in the inflammatory cascade involving several checkpoints and triggered by exposure to these xenobiotic particles.

The fast and higher levels of IL-1β released only by exposed THP-1 cells underlined the activation of NLPR3 inflammasome, needful to production of mature IL-1β. Indeed, activation of this protein intracellular complex in turn activates caspase-1 that, after proteolytic cleavage of pro-IL-1 β, allows the release of mature IL-1β. Inflammasome activation induces different cellular events, including K⁺ efflux, Ca²⁺ signaling, mitochondrial and lysosomal damages that release substances such as ROS, oxidized mitochondrial DNA and lysosomal proteases. Some of which were previously observed in the same cell lines exposed to v- and ox-nPS/mPS.^19,20 The most powerful inflammasome activators were ox-nPS, followed by ox-mPS and v-nPS, while no effect was observed for v-mPS. However, it is to be highlighted that in monocytic cells the release of IL-1β by inflammasome activation needs upstream of the activation of the inducible transcription factor NF-κB. This, is a central mediator of the priming signal of NLRP3 inflammasome activation⁴³ since the promoter region of inflammasome genes contains NF-κB-binding sites.⁴⁴ Moreover, NF-κB induces the expression of a large number of inflammatory genes, including those encoding TNF-α, pro-IL-1 β, IL-6, IL-12p40 and cyclooxygenase-2 and regulates, also in alveolar cells, multiple aspects of inflammatory responses. In A549, the early overexpression of p65 after exposure to ox-nPS and mPS both v- and ox- confirmed the involvement of NF-κB.

The early induction of TNF-α in alveolar cells clearly shows its role in the initiation of inflammatory cascades, able to the recruitment and activation of inflammatory cells. Similarly, to other particles, such as coal dust, crocidolite and chrysotile,⁴⁵ the result highlighted the role of nPS/mPS to trigger respiratory tract’s inflammation.

Conclusion

Recently, some progress has been made in identifying the pathogenic mechanisms triggered by the ubiquitous pollutants nano- and microplastics, to which humans are daily exposed both through inhalation and ingestion and also via the dermal route. Although we are still far from quantifying the risk, further pieces are gradually added to allow for more in-depth knowledge of the potential damage to human health attributable to nano- and microplastics. In this study in particular, the pro-inflammatory effect of these pollutants is highlighted, which is known to further aggravate the effects when the foreign agents remain in the host for a long time.

Author contributions

A.L. Validation, Formal analysis. G.V. Conceptualization, Validation, Formal analysis, Investigation. A.F. Formal analysis, Investigation. C.S. Investigation. M.P.B. Investigation. B.B. Investigation. D.I. Resources, Formal analyses. C.C. Formal analyses. a.d. Methodology, Writing and Supervision.

Funding

The study was supported by a grant from University of Messina.

 

Conflict of interest statement.The authors declare that there are no conflicts of interest.