Protocatechuic aldehyde promotes the functional recovery of spinal cord injury by activating the Wnt/β-catenin signaling pathway

Abstract

Context/objective

This study aimed to explore the anti-inflammatory and neuroprotective effects of protocatechuic aldehyde (PCA) in rats with spinal cord injury (SCI) and to clarify the molecular mechanisms underlying its pharmacological effects.

Design

Male Sprague Dawley rat model of moderate spinal cord contusion were established.

Setting

Third-class first-class hospital.

Outcome measures

The Basso, Beattie, and Bresnahan scores and performance on the inclined plane test were evaluated. Histological analyses were performed via hematoxylin and eosin staining. Apoptosis in the spinal cord and neurons was detected by 5 terminal deoxynucleotidyl-transferase-mediated dUTP nick end labeling staining. Apoptotic factors (Bax, Bcl-2, and cleaved caspase-3) were also evaluated. INOS, IL-1β, IL-10, TNF-α, Wnt-3α, β-catenin, iBA-1, and NeuN were assessed by real-time reverse transcription-polymerase chain reaction (RT–PCR), western blotting (WB), and enzyme-linked immunosorbent assay. Cell viability and the immunofluorescence of IL-1β were measured in PC-12 cells.

Results

Using WB and quantitative reverse transcription-PCR, we confirmed that PCA treatment activated the Wnt/β-catenin signaling axis in vivo and in vitro. Hematoxylin and eosin staining and hindlimb motor functional evaluation revealed that treatment with PCA improved tissue protection and functional recovery via the Wnt/β-catenin axis. The upregulation of TUNEL-positive cells, downregulation of neurons, elevated apoptosis-associated factors in rats, and increased apoptotic rates were observed in microglia and PC-12 after PCA application. Finally, PCA mitigated SCI-induced inflammation by targeting the Wnt/β-catenin axis.

Conclusion

This study provided preliminary evidence that PCA inhibits neuroinflammation and apoptosis through the Wnt/β-catenin pathway, thereby attenuating the secondary injury after SCI and promoting the regeneration of injured spinal tissues.

GRAPHICAL ABSTRACT

1. Introduction

Traumatic spinal cord injury (SCI) seriously affects the physical and mental health of the individuals affected by it and aggravates the burden on families and society. Previous data indicate that the annual incidence of SCI is approximately over 20,000 cases per billion people, and a gradual aging trend was reported (1). The pathophysiological process of SCI is generally accepted to be divided into two periods. Broken bone fragments, intervertebral discs, and ligament compression directly destroy the spinal microvasculature, causing tissue ischemia, which is a process that is known as primary injury. Patients who survive the primary injury may face various multisystem complications mediated by secondary injury, including apoptosis and inflammation; moreover, secondary injury has been considered as the main target of treatment to promote functional recovery in patients with SCI (2). During the secondary injury cascade, excessive microglial activation is harmful and is associated with the aggravation of neuronal damage (3).

The Wnt/β-catenin pathway is involved in cell proliferation, neurogenesis, and apoptosis (4). Previous research reported that the widespread expression of the Wnt family of glycoproteins plays an important role in SCI and neurodegenerative diseases (5). Wnt-3α, which is one of the components of the classical Wnt/β-catenin signaling pathway, promotes the proliferation and differentiation of spinal neurons, reduces neuronal death, and finally promotes locomotive functional recovery (6). β-catenin is combined with nuclear transcription factors and eventually leads to the expression of target genes (7). The literature reports that the activation of the Wnt/β-catenin pathway exerts anti-apoptotic and anti-inflammatory effects in SCI (8, 9).

Danshen, the medical term for Salvia miltiorrhiza, has a long history as a herbal medicine in China. Danshen includes phenolic acid and tanshinone, both of which have been proven to exist in cardiovascular and cerebrovascular diseases. Protocatechuic aldehyde (PCA) is an extract of phenolic acid that can improve isoproterenol-triggered cardiac hypertrophy via the suppression of JAK2/STAT3(10). In diseases of the central nervous system, PCA ameliorated dystrophy and dopaminergic cell death, the latter of which is related to the pathogenesis of Parkinson’s disease (11). Moreover, recent research demonstrated that PCA mitigated the phosphorylation of the mitogen-activated protein kinase pathway to exert its anti-inflammatory action (12). The studies mentioned above strongly imply various pharmacological properties for PCA; however, the potential effects of this reagent against SCI have not been explored.

In this study, a previously unreported role for PCA-mediated inhibition of the microglial-induced neuroinflammatory and apoptotic response that occurs after SCI was hypothesized. The effects of PCA on the pro-inflammatory cascades and neuronal apoptosis regulated by the Wnt/β-catenin axis were also explored in rats and in an in vitro model (BV2-PC12 cells).

2. Method

2.1. Animals

A total of 44 male adult Sprague Dawley rats (age: 8–10 weeks; weight: 200–250 g) were purchased from the Animal Center of Jinan Pengyue Company and raised in the Animal Experimental Center of Jining Medical College. The animals were housed in ventilated rooms at constant temperature (22 °C ± 2 °C) at 50% humidity and under a 12-h light/dark cycle. They had free access to food and water. After 1 week of feeding was implemented, a moderate contusion was performed at the T9 segment of the spinal cord. The rats were randomly divided into four treatment groups: sham (n = 6), SCI (n = 8), SCI + PCA (n = 15), and SCI + PCA + XAV939 (n = 15). Animals that underwent laminectomy exclusively were utilized as the sham group. SCI was induced as described previously (13). After the intraperitoneal injection of 50 mg/kg of pentobarbital sodium, an impactor (diameter: 2.0 mm; weight: 10 g) was dropped from a height of 25.0 mm above the exposed spinal cord, to establish a moderate spinal cord contusion model. Congestion of the injured spinal cord and myotonic contraction of the rat hindlimb and tail swinging indicated successful model establishment. PCA (Sigma–Aldrich, USA; dissolved in saline) was administered at 12.5 mg/kg/day via intraperitoneal injection, and the Wnt/β-catenin antagonist XAV939 (MCE, USA); dissolved in dimethyl sulphoxide (DMSO) was administered at 0.3 µg/kg/day via intraperitoneal injection for 3 days after SCI (8, 14). The negative-control group (SCI group) received the same amount of DMSO and saline. The bladder was manually discharged every 12 h after injury.

2.2. BV2 culture and treatment

The BV2 cell line was purchased from Procell Life Science & Technology Company of Wu Han (CL-0493) and cultured in Dulbecco’s Modified Eagle’s Medium containing 10% fetal bovine serum and 1% penicillin–streptomycin at 37 °C in a 5% CO₂ atmosphere. The medium was replaced every other day, and the cells were digested with trypsin and passaged twice a week at a split ratio of 1:2. BV2 is the most commonly used substitute for primary microglia. It was derived from neonatal microglia of raf/myc- immortalized mice (15). To establish a cellular apoptosis and inflammation model, the cells were treated with 500 ng/mL lipopolysaccharides (LPS) for 24 h (16). PCA and XAV939 were configured to various dosages (0.1, 0.5, 1, 2, 5, 10, and 20 mM) and incubated with BV2 cells for 24 h, to select the optimal concentration of the drugs to pre-treat the cells.

2.3. Locomotion recovery evaluation

The Basso, Beattie, and Bresnahan (BBB) open-sport scoring criteria were used to assess motor function prior to injury and recovery on days 1, 3, 7, 14, and 28 post-SCI (17). Three independent investigators who were blinded to the study observed the motor locomotion of rats, including the feet bearing support, coordinated walking using the front and hind legs, and a parallel trunk and upturned tail in an open field. The BBB scores ranged from 0 (complete paralysis of the hind limbs of the rats) to 21 (normal). The recovery reflection of the motor function in each group was based on the average score of each group at each time point. The inclined plane test was also used to evaluate the locomotor function, as described in a previous study (18). For this test, the animal was placed on a slope that could be adjusted to provide a varying angle, followed by the evaluation of the maximum angle of the plane on which the animal could maintain its position without falling. The inclination angle of the maximum plane at which the rats could maintain their state for 5 s was recorded. In the experiment, an angle of 70° indicated normal behavior.

2.4. Western blot assay

Seven days after SCI, the four groups of rats were intraperitoneally injected with 50 mg/kg pentobarbital sodium, followed by dissection of the T9–T10 spinal cord tissue, including the central part of the SCI (2 mm cephalic and caudal around the epicenter). Lysate (RIPA lysis buffer:PMSF = 100:1) was added in accordance with the ratio of addition of 150–250 µl of lysate per 20 mg of tissue, and the injured spinal cord tissue of the experimental rats was homogenized using an ultrasonic crusher until it was fully cracked. Subsequently, centrifugation was carried out in a low-temperature and high-speed centrifuge at 4 °C and 10,000 rpm for 30 min, and the supernatant was absorbed. For the extraction of cellular proteins, the cell culture medium was removed and homogenized in lysate for 10 min on ice before centrifugation. Then, the cells in the culture dish were completely scraped off using a cell scraper and centrifuged for 15 min at 4°C and 10,000 rpm in a low-temperature ultracentrifuge, and the supernatant was absorbed. The concentration of total proteins was determined using the BCA kit, formulated with a uniform concentration protein, and stored at −20 °C. Subsequently, SDS–PAGE was performed by loading each lane of 10% gels with 20 µg of protein, followed by transferring to polyethylene difluoro membranes, which were blocked at 22 °C with 1% BSA for 1 h. The membranes were incubated with the following primary antibodies at 4°C overnight: anti-Wnt-3α (Abcam; 1:1000,ab219412), anti-β-catenin (Affinity; 1:1000, MA1-301), anti-cleaved caspase-3 (CST, 1:1000, #9661), anti-iBA-1 (Abcam; 1:1000, ab178846), anti-iNOS (Abcam; 1:1000, ab178945), anti-NeuN (Abcam; 1:2000, ab104224), anti-Bax (Affinity, 1:100, MA5-14003), anti-Bcl-2 (Affinity, 14-6992-82)and anti-β-actin (Abcam; 1:1000, ab8226). On the following day, polyvinylidene fluoride (PVDF) membranes were incubated with secondary antibodies (Abcam, 1:2000, ab6721, ab6789) for 1 h at 22 °C. Finally, the PVDF membranes were incubated with an ECL chromogenic solution (Millipore) and visualized in a gel imaging system.

2.5. Terminal deoxynucleotidyl–transferase– mediated dUTP nick end labeling (TUNEL)

Spinal cord TUNEL staining: Immunofluorescence analysis was performed as described previously (19). Briefly, at 7 days after the operation, the rats were anesthetized with 50 mg/kg pentobarbital sodium and perfused with 4% paraformaldehyde. Subsequently, spinal cord tissues (T9) were harvested from the rats at 5 mm rostral to the epicenter and fixed in 4% paraformaldehyde. The tissues were immersed in 30% sucrose overnight, cut into cross-sections at a thickness of 10 μm, and stored at −20°C for subsequent experimentation. For antigen retrieval, the sections were placed into a dark box with 0.01 M citric acid, then blocked using a blocking buffer (goat serum blocking solution and 0.3% Triton X-100) at 4°C for 2 h. Next, the sections were washed with PBS three times, each time for 5 min, and incubated with a neuronal primary antibody diluted in normal goat serum (rabbit anti-NeuN antibody, 1:400, Abcam) at 4°C overnight. On the following day, the tissues were incubated with FITC-goat anti-rabbit IgG (1:400, Abcam) at room temperature for 2 h. The sections and the TUNEL reaction mixture were co-incubated at 37°C for 1 h. Finally, the tissues were subjected to staining with DAPI diluted in goat serum blocking solution (1:1).

PC-12 TUNEL staining: First, the cultured cell slides were washed with PBS, and PC-12 cells were fixed with 4% paraformaldehyde at room temperature for 15 min. After 0.5% Triton X-100 was allowed to penetrate the cells at room temperature for 20 min, the slides were blocked with blocking goat serum for 30 min. Subsequently, the sections and the TUNEL reaction mixture were co-incubated at 37 °C in the dark for 1 h, followed by staining of the cell slides with DAPI diluted in goat serum blocking solution (1:1).

After mounting, the sections were blocked with Permount Mounting Medium and observed under a fluorescence microscope (Olympus, Japan) at a magnification of 400×.

2.6. Hematoxylin and eosin (HE) staining

Spinal cord slides were stained with HE to assess histomorphological differences. The degree of SCI was observed under light microscopy at magnifications of 40× and 400× (Olympus, Japan). Spinal cord tissues (T9, 3 mm rostral to the epicenter) sectioned at 10 μm were equilibrated overnight in miscible liquids (alcohol:chloroform = 1:1). On the following day, the sections were processed through 100% alcohol, 95% alcohol, and distilled water. They were then stained with 0.1% tar violet solution and glacial acetic acid at 37 °C for 10 min, then rinsed quickly in distilled water. Subsequently, the sections were dehydrated in 95% ethyl alcohol for 30 min and 100% alcohol for 5 min twice, then cleared in xylene for 5 min twice. The stained slices were observed under a light microscope at 400× magnification (Olympus, Japan) after blocking with Permount Mounting Medium (Solarbio).

2.7. BV2 and PC-12 cell co-culture system

BV2 cells were subjected to LPS treatment in the presence or absence of PCA and XAV939 for 24 h. After stimulation, the BV2 cell culture medium was collected and diluted with an equal volume of PC-12 cell culture medium, to establish a co-medium. PC-12 cells were cultured in the co-culture medium for 24 h at 37 °C in a 5% CO₂ atmosphere.

2.8. Cell viability assay

The viability and cytotoxicity of BV2 cells treated with PA and XAV939 were evaluated using the Cell Counting Kit-8 (CCK-8, Beyotime) according to the manufacturer’s instructions. Briefly, after drug management and transfection were performed, the cells were cultivated with CCK-8 solution for 0.5–4 h, and each aperture of the absorbance was manipulated for measurement using a microplate reader instrument at 450 nm.

2.9. Cellular immunofluorescence

Briefly, PC-12 cells were fixed with 4% paraformaldehyde 15 min after the conduction described above. All cells were then immersed in 0.3% Triton X-100 for 20 min and blocked with a goat serum blocking solution for 30 min. Subsequently, slides of these cells were co-cultivated with primary antibodies at 4 °C overnight (anti-IL-1β, Abcam, 1:400, ab254360). Next, the PC-12 cells were incubated with the corresponding secondary antibody for 1 h at room temperature. The nuclei were stained with DAPI diluted in goat serum blocking solution (1:1). The slides were ultimately blocked with Mounting Medium (Solarbio). The presence of a nucleus surrounded by red fluorescence, as observed using a fluorescence microscope (Olympus, Japan), was defined as a positive cell.

2.10. Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total ribonucleic acid (RNA) was extracted from the spinal cord tissue using the TRIzol reagent (ThermoFisher Scientific, Waltham, MA, USA) in accordance with the manufacturer’s instructions. RNA was quantified by determining the absorbance at 260/280 nm using a spectrophotometer. Reverse transcription was performed using SuperScript II Reverse Transcriptase (Invitrogen). A sample of cDNA was used to quantify gene expression by qPCR using a SYBR Green (Bio-Rad, California, USA)-based PCR reaction mixture on a CFX96 Real-Time system. The sequences of the primers used for the qRT-PCR experiments were as follows: IL-1β, forward: CTCACAAGCAGAGCACAAGC, reverse: AGCTGTCTGCTCATTCACGA; IL-10, forward: AGCAAAGGCCATTCCATCCG, reverse: CACTTGACTGAAGGCAGCCC; Bcl-2, forward: CGGGAGATCGTGATGAAGTAC, reverse: AGGCTGGAAGGAGAAGATGC; Bax, forward: TTGCCCTCTTCTACTTTGC, reverse: GAAGTCCAGTGTCCAGCCCAT; TCF-1, forward: TACGCTAAAGGAGAGCGCAG, reverse: GCTGTCATTCTGGGACCTGT; and LEF-1, forward: GAGCTGCCAACCAAAAAGGG, reverse: CCAGTTGTAGACACGCACCT. The reaction conditions were as follows: initial denaturation at 95° C for 10 min; followed by 40 cycles of denaturation at 95° C for 15 s, annealing at 60° C for 30 s, and extension at 72° C for 30 s. The amount of mRNA for each gene was normalized to β-actin, and the relative expression levels were calculated using the 2^−ΔΔCt method.

2.11. Data analysis and statistics

Statistical data were described as the mean ± standard deviation and analyzed using the GraphPad Prism 8.0 software (GraphPad Software, CA, USA). Comparisons among multiple groups were conducted using one-way analysis of variance, followed by Tukey’s post hoc test. Significance was set at P < 0.05.

3. Results

3.1. PCA enhances the activation of the Wnt/β–catenin signaling axis

Whether PCA activates the Wnt/β-catenin axis in BV-2 cells and spinal cord tissues was primarily determined. The results of western blotting (WB) showed that the PCA treatment extensively upregulated Wnt-3α and β-catenin compared with the SCI group (Fig. 1A–C). In addition, the mRNA levels of LEF-1 and TCF-1 were upregulated after PCA administration (Fig. 1D and E). To determine the toxicity of PCA, the viability of BV-2 cells treated with different doses of PCA was measured by CCK-8 assay at 24 h. The results showed that, at a low concentration of PCA (ranging from 0.1–2 mM), a significant decrease in cell viability was not noticeably observed, whereas a dose of 20 mM significantly reduced BV-2 cell viability (Fig. 1F). Therefore, 2 mM PCA was selected for the examination of its effects. Consistent with the results described above, PCA upregulated these two signaling pathway proteins and the LEF/TCF transcription factors compared with LPS induction (Fig. 1G–J). XAV939, which is an inhibitor of the Wnt/β-catenin axis, was added to the samples during the experiments; as expected, the signaling pathway proteins and transcription factors were downregulated in rats. Furthermore, the cytotoxicity of different doses of XAV939 was determined in BV-2 cells. Our observations indicated that XAV939 decreased cell viability in a dose-dependent manner (Fig. 1 K). Then, 0.5 mM XAV939 was selected for subsequent experiments. The application of XAV939 yielded a negative effect on the Wnt/β-catenin signaling pathway. The PCA treatment activated the Wnt/β-catenin signaling axis in vivo and in vitro.

Figure 1.

PCA enhances the activation of the Wnt/β–catenin signaling axis. (A-C) Western blot analysis Wnt-3α, β-catenin and β-actin expression in spinal cord. (D-E) Representative qRT-PCR results of TCF-1 and LEF-1 in spinal cord. *P < .05; **P < .01, ***P < .001; (F) Toxicity of PCA with various concentrations in BV-2 for 24hr.; (G-H) Western blot analysis Wnt-3α, β-catenin and β-actin expression in BV-2. (I-J) Representative qRT-PCR results of TCF-1 and LEF-1 in BV-2. (K) Toxicity of XAV939 with various concentrations in BV-2 for 24hr.

3.2. PCA relieves histological and functional disorders in vivo

The BBB scores and results of the inclined plane test were utilized to evaluate the motor function of rats, whereas the Wnt/β-catenin axis inhibitor XAV939 was used to determine whether a signaling pathway participated in the recovery of locomotor function. The BBB scores in the SCI + PCA group were higher than those in the SCI group beginning at 7 days following SCI. The inclined plane tests also showed that PCA administration significantly improved the locomotor performance beginning at 7 days after SCI (Fig. 2A and B). In contrast, the XAV939 group exhibited a smaller angle of incline and lower BBB scores than did the PCA group. Furthermore, HE staining and Nissl staining were used to observe the microstructure of the spinal cord tissue after SCI. HE staining performed at 7 days after SCI indicated that treatment with PCA decreased inflammatory-cell infiltration (Fig. 2C). Nissl staining performed at 7 days after SCI showed that PCA application increased greatly the number of neurons in the anterior horns compared with no treatment (Fig 2E). Whereas XAV939 treatment reversed the above results. Taken together, these results indicate that treatment with PCA improved tissue protection and functional recovery after SCI, and that the Wnt/β-catenin axis functioned in the process of SCI.

Figure 2.

PCA relieves histological and functional disorder in vivo (A) The BBB locomotion scales of the sham, SCI, PCA and XAV939 at 1, 3, 7, 14 and 28 days after SCI, #P < .05; (B) Quantification of inclined plane test from day 1 to day 7 after SCI. *P < .05; (C) Representative image from HE staining at 7 dpi, we use arrows to point out inflammatory cell infiltration. Scale bar = 20 µM (400×) and 200 µM (40×). (D-E) Representative image and quantification of neurons from Nissl staining at 7 dpi, we use arrows to point out neurons. Scale bar = 50 µM (200×) and 200 µM (40×).

3.3. PCA inhibits neuronal apoptosis in the spinal cord and LPS-induced microglial cell death

Next, we examined whether PCA could alleviate apoptosis-mediated neuronal cell death in vivo and in vitro. As shown in Fig. 3A and B, immunofluorescence indicated that the number of neurons and TUNEL-positive cells was notably decreased and increased in the SCI rats, respectively. In contrast, PCA administration significantly reduced the apoptotic rate and increased the survival rate of neurons. The expression of apoptosis-associated proteins and mRNAs in vivo was also evaluated. Under SCI stimulation, the expression levels of factors that are positively correlated with apoptosis, namely, Bax and cleaved caspase-3, and of factors that are negatively correlated with apoptosis, namely, NeuN and Bcl-2, increased and decreased, respectively (Fig. 3C–I). These results were reversed after treatment with PCA. Interestingly, as a result of exposure to the medium from LPS-treated microglia, the apoptotic levels of PC-12 cells increased compared with those of the control group, suggesting that microglial activation triggered neuronal damage (Fig. 3J and K). Compared with LPS induction, the introduction of PCA weakened the apoptotic levels. Moreover, a remarkable increase in the viability of PC-12 cells was observed after PCA treatment (Fig. 3L). These findings demonstrated that PCA may inhibit apoptosis in vivo and in vitro. However, blocking the Wnt/β-catenin signaling pathway reversed the process described above, as manifested by the upregulation of TUNEL-positive cells, downregulation of neurons, increase in apoptosis-associated factors in rats, and increase in the apoptotic rate in microglia and PC-12 cells. Therefore, the Wnt/β-catenin axis seems to play a vital role in the treatment of SCI with PCA.

Figure 3.

PCA inhibits neuronal apoptosis of spinal cord and LPS-induced microglial cell death. (A-B) Representative Tunel results of each group in spinal cord(400×). (C-G) Western blot analysis Cleaved-caspase-3, NeuN, Bax, Bcl-2 and β-actin expression. (H-I) Representative qRT-PCR results of Bax and BCL-2 in spinal cord. *P < .05; **P < .01, ***P < .001, ****P < .0001 (J-K) Representative Tunel results of each group in PC-12 (400×). (L) The cell viability was determined by CCK-8 assay in each group. *P < 0.05.

3.4. PCA inhibits the activation and pro-inflammatory effects of microglia by targeting the Wnt/β-catenin axis

The anti-inflammatory effect of PCA was further investigated. INOS, which is an inflammatory marker and part of the M1 phenotype of microglia, was detected by western blot assay. The results notably indicated that the microglia were activated and the iNOS expression was augmented after SCI, whereas subsequent treatment with PCA decreased the levels of the iBA-1 and iNOS proteins (Fig. 4A–C). ELISA was used to evaluate pro-inflammatory cytokines. The level of TNF-α in the PCA group was noticeably lower than that in the SCI group (Fig. 4D). The qRT-PCR assay also indicated that the pro- and anti-inflammatory mediators IL-1β and IL-10 were considerably increased and decreased after PCA application, respectively (Fig. 4E and F). Consistently, the cell immunofluorescence assay revealed that the fluorescence intensity of IL-1β was alleviated by treatment with PCA in PC-12 cells (Fig. 4G and H). Strikingly, rats treated with XAV939 exhibited high levels of TNF-α and IL-1β and a low level of IL-10. Furthermore, the number of IL-1β+/DAPI + neurons increased after XAV9393 administration. The positive effects of PCA were restrained after suppressing the Wnt/β-catenin axis, suggesting that PCA mitigates SCI-induced inflammation by targeting the Wnt/β-catenin axis.

Figure 4.

PCA inhibits activation and pro-inflammatory effects of microglia by targeting the Wnt/β-catenin axis. (A-C) Representative western blot results of iNOS, iBA-1 and β-actin in spinal cord. (D) ELISA assay of TNF-α in spinal cord. *P < 0.05 (E-F) qRT-PCR was used to analyze the expression of IL-10 and IL-1β in spinal cord. (G-H) Photographs of representative cultures measured by immunofluorescence assay (400×).

4. Discussion

This study demonstrated that PCA had a neuroprotective role in SCI-induced neuropathology by negatively modulating the levels of neuroinflammatory and apoptotic factors via the activation of the Wnt/β-catenin axis. SCI is a devastating condition, with almost 120,000 new cases occurring every year, and it tends to affect young people (20). Research showed that the restraint of the cascade of events that is associated with the secondary spinal injury phase, and the regeneration of injured spinal tissue are the current major challenges in this field (21). On the one hand, after a contusion injury, secondary injury occurs via a series of pathophysiological changes that are characterized by the activation of astrocytes, the differentiation of microglia, and the infiltration of macrophages (22). Previous studies have suggested that the recruitment of microglia accelerates the secretion of mediated pro-inflammatory cytokines, which play a prominent role in neuroinflammation (23). On the other hand, excessive proliferation of microglia promotes the formation of glial scars, which obstructs axonal growth (24). Thus, the development of pharmaceuticals to repress the cascade of secondary injury and promote tissue regeneration and motor function recovery was the main strategy of the present study. S. miltiorrhiza Bunge is a widely used Chinese medicinal material, with PCA being one of its components. Because of its complicated chemical constituents, the neuroprotective effects and mechanisms of each component of S. miltiorrhiza Bunge have attracted much attention (14).

In the current in vivo experiment, the rats were administered PCA after SCI. The results demonstrated that the PCA treatment afforded a better recovery of hindlimb motor function after SCI. Consistent with the behavioral scores, the degree of tissue disorder, infiltrating inflammatory cells, and survival of neurons, as histological outcomes, were improved. Moreover, iBA-1, which is a molecular marker of microglial activation, was significantly downregulated after PCA application. The inactivation of microglia resulted in low expression levels of pro-inflammatory factors, such as iNOS, IL-1β, and TNF-α, and a high expression level of IL-10. The previous literature suggests that apoptosis is a programed cell death process that leads to neuronal death during secondary injury after SCI (25). Interestingly, our immunofluorescence findings clearly indicated that PCA application reduced NeuN and TUNEL double-positive rates. Upregulation of Bcl-2 and downregulation of cleaved caspase-3 and Bax were also shown by western blot and RT–PCR assays. In addition, a decrease in TNF-α secreted by BV2 cells and a decrease in the apoptotic rate in PC-12 cells indicated that PCA inhibited inflammation and apoptosis in the in vitro experiment.

The Wnt/β-catenin signaling pathway is a crucial cascade in the nervous system in terms of the regulation of SCI. According to previous reports, β-catenin to the nucleus leads to its interaction with transcription factors of the LEF/TCF family, to provide signals that control the growth of the central nervous system (26). Pioneering research reported that PCA application attenuated the severity of H₂O₂-damaged PC12 cells by enhancing the Wnt/β-catenin signaling pathway (27). The findings of the present study revealed that PCA promoted the expression of Wnt-3α and β-catenin in the spinal cord after SCI and in BV2 cells after LPS induction; moreover, it further enhanced the translocation of β-catenin into the nucleus, as shown by the increased mRNA levels of TCF-1 and LEF-1. Whether the Wnt/β-catenin axis is one of the mechanisms involved in the treatment of SCI with PCA was then investigated. XAV939, which is a Wnt/β-catenin signaling pathway inhibitor, significantly reversed the process described above. These results confirmed that PCA administration exerted its pharmacological effects through the Wnt/β-catenin axis.

In summary, this study demonstrated that PCA promoted functional recovery after SCI by activating the Wnt/β-catenin signaling pathway. Considering that PCA has the pharmacological effect of regulating apoptosis and neuroinflammation, its application may be a therapeutic strategy for SCI. However, this study had several limitations. First, the effects of PCA were not investigated in other neural cells, such as astrocytes, myelin cells, and oligodendrocytes. Moreover, the long-term effects of PCA intervention on SCI were not evaluated. Taken together, the results of this study provided a series of novel insights into the therapeutic benefit of PCA in the context of SCI. Further research on the clinical translation of PCA in patients with SCI is expected.

Funding Statement

This work was supported by Doctor Fund of the First People's Hospital of Jining City: [grant no 2019002].

Conflict of interest

No potential conflict of interest was reported by the author(s).