Skip to main content
BMC Infectious Diseases logoLink to BMC Infectious Diseases
. 2024 Sep 9;24:942. doi: 10.1186/s12879-024-09817-9

Pan-genome analysis reveals novel chromosomal markers for multiplex PCR-based specific detection of Bacillus anthracis

Tuvshinzaya Zorigt 1,2,✉, Yoshikazu Furuta 1,2, Atmika Paudel 1,2,3, Harvey Kakoma Kamboyi 1,2, Misheck Shawa 1,2, Mungunsar Chuluun 1,2, Misa Sugawara 1, Nyamdorj Enkhtsetseg 4, Jargalsaikhan Enkhtuya 5, Badgar Battsetseg 6, Musso Munyeme 7, Bernard M Hang’ombe 8, Hideaki Higashi 1,2
PMCID: PMC11385494  PMID: 39251928

Abstract

Background

Bacillus anthracis is a highly pathogenic bacterium that can cause lethal infection in animals and humans, making it a significant concern as a pathogen and biological agent. Consequently, accurate diagnosis of B. anthracis is critically important for public health. However, the identification of specific marker genes encoded in the B. anthracis chromosome is challenging due to the genetic similarity it shares with B. cereus and B. thuringiensis.

Methods

The complete genomes of B. anthracis, B. cereus, B. thuringiensis, and B. weihenstephanensis were de novo annotated with Prokka, and these annotations were used by Roary to produce the pan-genome. B. anthracis exclusive genes were identified by Perl script, and their specificity was examined by nucleotide BLAST search. A local BLAST alignment was performed to confirm the presence of the identified genes across various B. anthracis strains. Multiplex polymerase chain reactions (PCR) were established based on the identified genes.

Result

The distribution of genes among 151 whole-genome sequences exhibited three distinct major patterns, depending on the bacterial species and strains. Further comparative analysis between the three groups uncovered thirty chromosome-encoded genes exclusively present in B. anthracis strains. Of these, twenty were found in known lambda prophage regions, and ten were in previously undefined region of the chromosome. We established three distinct multiplex PCRs for the specific detection of B. anthracis by utilizing three of the identified genes, BA1698, BA5354, and BA5361.

Conclusion

The study identified thirty chromosome-encoded genes specific to B. anthracis, encompassing previously described genes in known lambda prophage regions and nine newly discovered genes from an undefined gene region to the best of our knowledge. Three multiplex PCR assays offer an accurate and reliable alternative method for detecting B. anthracis. Furthermore, these genetic markers have value in anthrax vaccine development, and understanding the pathogenicity of B. anthracis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-024-09817-9.

Keywords: Bacillus anthracis, Pan-genome, Anthrax, Specific genes, PCR

Background

Bacillus anthracis is a Gram-positive, spore-forming bacterium that can cause a fatal infection called anthrax in animals and humans [1]. It is the most likely bioterrorism agent due to its history of being intentionally released against civilians, and yet spores are easily found in nature and can be utilized for large-scale production and dissemination [2]. Depending on the route of exposure, B. anthracis infection in humans manifests in three forms; cutaneous, gastrointestinal, and inhalational. Once the disease reaches a critical stage, treatment becomes ineffective, and the patient eventually dies from bacteremia and toxic shock. This is due to B. anthracis releasing various toxins, including edema factor (EF), lethal factor (LF), and protective antigen (PA), which are encoded on a plasmid pXO1. In addition, proteins (CapB, CapC, and CapA) for capsule biosynthesis encoded on another plasmid called pXO2 are required for the complete virulence of B. anthracis [3]. B. anthracis Sterne 34F2 strain, lacking the pXO2, serves as a commercial vaccine strain utilized in anthrax immunization for animals [4].

B. anthracis is a well-known member of the Bacillus cereus sensu lato group, which also includes other species such as B. thuringiensis, B. mycoides, B. weihenstephanesis, and B. cereus. Among the species in the B. cereus s.l group, B. anthracis, B. cereus, and B. thuringiensis share a close genetic relationship and are challenging to distinguish from one another [5]. However, their phenotypes and the diseases they cause differ significantly. While B. anthracis causes anthrax, B. cereus causes foodborne illnesses in humans, often associated with the consumption of contaminated food. In contrast, B. thuringiensis, primarily influences insects, acting as an effective biological pesticide. Given the public health threat posed by anthrax, it is essential to identify B. anthracis-specific genes and develop rapid diagnostics capable of accurately distinguishing it from other B. cereus s.l species.

Two main diagnostic methods are commonly employed in the differentiation of these species. The first method involves phenotypic traits such as colony characteristics, motility, antibiotic susceptibility, and hemolytic activity on blood agar [6–8]. B. anthracis colonies exhibit a characteristic appearance, often described as Medusa head with a concentrated center and indistinct borders. Additionally, unlike B. cereus and B. thuringiensis, B. anthracis is non-motile, penicillin-susceptible, and does not cause hemolysis. However, these bacteriological methods necessitate the use of specific blood agar plates and overnight incubation for colony formation. It also requires proper training to judge colony morphology accurately.

The second method utilizes genetic markers for molecular diagnostics. The two virulence plasmids have been the main target of various molecular diagnostics to detect B. anthracis and differentiate it from other closely related species [9]. However, it is important to note that B. anthracis strains can lose either one or both plasmids, as described previously [10]. In addition, unusual B. cereus strains have emerged that cause anthrax-like disease in humans and animals by acquiring virulence plasmids highly similar to pXO1 and pXO2 of B. anthracis [11]. Consequently, identifying B. anthracis-specific chromosomal markers is crucial to distinguish it from closely related B. cereus group species and remains a focal point of research for many scientists. However, certain chromosomal markers (e.g., BA813, gyrA, gyrB, and rpoB) initially identified as specific to B. anthracis were later found in some B. cereus strains, leading to false positive results [12–14]. B. anthracis, B. cereus, and B. thuringiensis all possess the plcR gene, a transcriptional activator that is active in B. cereus and B. thuringiensis but inactivated in B. anthracis due to thymine insertion at nucleotide position 640. This mutation enables the use of plcR to distinguish B. anthracis from its close relatives. However, detecting this single nucleotide mutation using standard methods is challenging and often results in false positives [15, 16]. Although the melt curve analysis with the mismatch amplification mutation assay [17], improved detection accuracy, there remains a need for a new alternative marker suitable for cost-effective, standard PCR applications.

This study aimed to find B. anthracis-specific chromosomal marker sequences or genes using pan-genome analysis, which captures the entire range of genetic variation within or between species, reduces the bias in genetic analysis and develops rapid diagnostic tools applicable in the field.

Methods

Pan-genome analysis for identifying genes potentially unique to B. anthracis

A total of 151 complete genomes were downloaded from the National Center for Biotechnology Information (NCBI) for analysis (Additional file 1). This dataset included 50 genomes, which were selected randomly from each of the following species: B. anthracis, B. cereus, and B. thuringiensis. Additionally, one complete genome of B. weihenstephanensis was included as an outgroup control species. The genomes were de novo annotated with Prokka version 1.11 [18]. Roary version 3.13.0 [19] was used to deduce the pan-genome of the dataset. The Roary utilized the Prokka annotations as input, generating a gene-presence-absence spreadsheet (Additional file 2). Finally, the Perl script was employed to count the genes present in B. anthracis strains but absent in the genomes of B. cereus and B. thuringiensis strains.

Heap’s law

Heap’s law was used to determine the pan-genome status (openness or closedness) of B. anthracis (n = 115) in comparison to its genetically close relatives, B. cereus (n = 142) and B. thuringiensis (n = 93), utilizing all available complete sequences for each species from the GenBank database (Additional file 1).

The total number of unique genes identified through sequencing additional genomes can be modeled by Heap’s law (n = kNγ), which follows the power law function [20]. Where n is the number of genes; N is the number of genomes; k is intercept, represents the initial number of unique genes when one genome is considered; and γ is a parameter that characterizes the rate at which new genes are added as more genomes are included. If γ is closer to 1, it indicates an open pangenome, meaning the number of unique genes continues to increase significantly with additional genomes. Conversely, if γ is closer to 0, it suggests a closed pangenome, where most genetic diversity is captured with the current dataset.

Nucleotide BLAST search and local BLAST alignment

To ensure the specificity of the genes identified from the initial pan-genome comparison among 151 genomes, each gene was submitted to a nucleotide BLAST (BLASTn) search against the NCBI database, excluding B. anthracis, to verify that the identified genes were not present in other organisms.

Additionally, to confirm the presence and consistency of the identified genes across various B. anthracis strains, a local BLAST alignment was performed incorporating the chromosomally complete 132 genomes of B. anthracis strains currently available in GenBank (Additional file 3).

String analysis

To predict potential physical and functional protein-protein interactions among the proteins encoded by the identified genes derived from non-prophage regions in B. anthracis, the STRING v.12.0 database was employed [21]. STRING integrates known and predicted protein-protein association data for a large number of organisms using various sources of information, including genomic context, high-throughput experiments, co-expression, and literature mining. The interactions were analyzed using default settings, with a confidence score cutoff of 0.7 to ensure high-confidence interactions. The results were visualized and interpreted to elucidate the potential roles of the proteins in the biological pathways and processes relevant to B. anthracis.

Bacterial strains

A total of 62 bacterial strains originating from diverse sources, were utilized to evaluate the efficacy and specificity of multiplex PCR. This collection of strains included 17 strains of B. anthracis, encompassing one commercial vaccine strain and 16 virulent strains previously isolated from wildlife, livestock, and humans infected with anthrax in Zambia and Mongolia, countries known for their endemic anthrax status in Africa and Asia, respectively. These strains were selected to represent the temporal and geographic diversity of the respective countries. In Zambia, nine strains were isolated from Lower Zambezi National Park, South Luangwa National Park, and Western province over a decade from 2011 to 2021. In Mongolia, seven strains were collected from five distinct provinces, namely Selenge, Khuvsgul, Uvurkhangai, Khentii, and Ulaanbaatar over a period of years from 2001 to 2015. Only genomic DNA of virulent B. anthracis strains was transported from Zambia and Mongolia to Japan. Additionally, the collection included 29 B. cereus strains formerly isolated from nosocomial infection cases in Japanese hospitals [22] or obtained from reputable repositories such as the American Type Culture Collection and the Biodefense and Emerging Infections Research Resources Repository. Moreover, the strains extended to include Bacillus species, namely B. thuringiensis, B. licheniformis, and B. subtilis, as well as Gram-positive and negative non-Bacillus species. The bacterial strains used in the present study and their sources are given in Table 4.

Table 4.

Bacterial strains used in this study and their possessions of B. anthracis chromosome-encoded genes and two other plasmid markers

Bacterial species Sample ID Strains Sources (Referencesa, b) Target genes for PCR amplification
BA1698c BA5354c BA5361c pagc capAc
Bacillus anthracis 1 CZC5 Hippoa + + + + +
2 shH20 Human + + + + +
3 LZH18 Hippo + + + + +
4 SLI21 Impala + + + + +
5 SLH21 Hippo + + + + +
6 LZH20b Hippo + + + + +
7 WPC18 Cattle + + + + +
8 WPC20 Cattle + + + + +
9 LZH20a Hippo + + + + +
10 Sterne 34F2 Commercial vaccine strain + + + +
A1 Selenge01 Cattle + + + + +
A2 Khuvsgul07 Goat + + + + +
A3 Uvurkhangai08 Cattle + + + + +
A4 Ulaanbaatar09 Cattle + + + + +
A5 Khentii10 Cattle + + + + +
A6 Khentii13 Cattle + + + + +
A7 Khuvsgul15 Horse + + + + +
Bacillus cereus 11 MRY14-0045 Patient bloodb
12 MRY14-0057 Patient bloodb
13 MRY14-0060 Patient bloodb
14 MRY14-0074 Hospital towelb
15 MRY14-0075 Hospital towelb
16 MRY14-0079 Hospital towelb
17 MRY14-0100 Hospital towelb
18 MRY14-0105 Hospital microwave ovenb
19 J1 Infusionb
20 J2 Infusionb
21 J7 Patient skinb
22 J10 Hospital sheetb
23 J39 Patient bloodb
24 J51 Patient bloodb
25 J62 Hospital linen room washed towelb
26 J75 Hospital linen room washed towelb
27 30040 Patient bloodb
28 30043 Patient bloodb
29 30048 Patient bloodb
30 30052 Patient bloodb
31 30075 Patient bloodb
32 30077 Patient bloodb
33 30090 Patient bloodb
34 30102 Patient bloodb
35 14579 ATCC
36 10987 ATCC
37 Yonago40 Patient bloodb
38 G9241 BEI Resources +
39 E33L BEI Resources
Bacillus thuringiensis 40 4A10 BGSC
41 4A12 BGSC
42 4D1 BGSC
43 4D24 BGSC
Bacillus licheniformis 44 10716 ATCC
Bacillus subtilis 45 168 BGSC
Staphylococcus aureus 46 RN4220 BEI Resources
47 USA300-0114 BEI Resources
48 71080 BEI Resources
49 F003B2N-C BEI Resources
Enterococcus faecalis 50 S613 BEI Resources
51 V587 BEI Resources
52 UAA714 BEI Resources
53 UAA945 BEI Resources
Pseudomonas aeruginosa 54 PA14 BEI Resources
Escherichia coli 55 MG1655 NEB

ATCC American Type Culture Collection, BEI Resources The Biodefense and Emerging Infections Research Resources Repository, BGSC The Bacillus Genetic Stock Center, NEB New England BioLabs

aStrains isolated in reference [33]

bStrains isolated in reference [22]

cIf target genes were amplified; +, if not empty

Genomic DNA extraction

Glycerol stocks of bacterial cultures were inoculated on Lysogeny broth (LB) agar and grown overnight at 37ºC with aeration. Genomic DNA was isolated using the QIAamp PowerFecal DNA Kit (Qiagen, Germany) according to the manufacturer’s protocol. The concentration and purity of extracted genomic DNA were assessed by NanoDrop OneC (Thermo Fisher Scientific, USA) spectrophotometer.

Oligonucleotide primers and multiplex PCR conditions

Oligonucleotide primers targeting B. anthracis-specific genes encoded on its chromosome and two common marker genes, pag and capA, on pXO1 and pXO2 plasmids, respectively, were designed using SnapGene 5.0.8. Nucleotide sequences of sets of primers, along with the expected size of the PCR products, are shown in Table 1. A common primer set was utilized for amplifying the pag gene across all three multiplex PCRs, while for the capA gene, two different primer sets were designed, considering the size of co-amplified gene products within each multiplex PCR to ensure distinct band sizes for clear differentiation on agarose gel electrophoresis.

Table 1.

List of primers used in newly developed multiplex PCR assays and previously developed PCR tests for B. anthracis detection

Primer name Target gene Primer sequence 5′ – 3′ PCR product (bp) Reference
MPCRa-1 for detecting B. anthracis chromosome-encoded gene and plasmids
 TZ_3 BA1698 CGAGTTTATTAAAAGAAGTTCCAGA 293 this study
 TZ_4 − 1 CGAATATGGACCTGATGTTG
 TZ_1 pag CCAGACCGTGACAATGATGG 612 this study
 TZ_2 TGGTAACACGTTGTAGATTGGAG
 TZ_7 capA CACGTAAATGATATTGCACAAGTGC 152 this study
 TZ_8 GGCAGATATTATTGTGGGACACC
MPCRa-2 for detecting B. anthracis chromosome-encoded gene and plasmids
 TZ_9 BA5354 ATGAATGAAGATAAGCATTGTAA 192 this study
 TZ_10 CTATTCTTCATCAGCAATTTGAA
 TZ_1 pag CCAGACCGTGACAATGATGG 612 this study
 TZ_2 TGGTAACACGTTGTAGATTGGAG
 TZ_7 − 1 capA AGTTGTTGTCTCCACTGATAC 100 this study
 TZ_8 − 1 AAATCATAAACATGTTATTGAA
MPCRa-3 for detecting B. anthracis chromosome-encoded gene and plasmids
 TZ_11 BA5361 CCCCAATATATTAACAATAGAC 392 this study
 TZ_12 GTTTTTGAATGTTTTTTGGTTC
 TZ_1 pag CCAGACCGTGACAATGATGG 612 this study
 TZ_2 TGGTAACACGTTGTAGATTGGAG
 TZ_7 capA CACGTAAATGATATTGCACAAGTGC 152 this study
 TZ_8 GGCAGATATTATTGTGGGACACC
Duplex PCR assay for detecting pXO1 and pXO2 plasmids, as recommended by WHOb guideline
 CAP1234 cap CTGAGCCATTAATCGATATG 846 [23]
 CAP1301 TCCCACTTACGTAATCTGAG
 PA5 pag TCCTAACACTAACGAAGTCG 596 [24]
 PA8 GAGGTAGAAGGATATACGGT
A single PCR assay for targeting B. anthracis chromosome encoded gene, as recommended by WHOb guideline
 S-layer-Upper sap CGCGTTTCTATGGCATCTCTTCT 639 [25]
 S-layer-Lower TTCTGAAGCTGGCGTTACAAAT
B. anthracis PCR Detection kit by Takarac
 MO11 cap GACGGATTATGGTGCTAAG 591 [26]
 MO12 GCACTGGCAACTGGTTTTG
 PA7 pag ATCACCAGAGGCAAGACACCC 211 [24]
 PA6 ACCAATATCAAAGAACGACGC

aMPCR, Multiplex PCR

bWHO, World Health Organization

cTakara, commercial kit

Multiplex PCR assays were performed using a TaKaRa Ex Taq Hot Start Version (TaKaRa, Japan), which consists of PCR buffer, dNTPs, and Ex taq DNA polymerase separately. PCR reactions were carried out using AB Applied Biosystem 2720 thermal cycler (Applied Biosystem, USA) in 50 µl volumes with genomic DNA as template and containing 1 µM of each primer. A gradient PCR with different annealing temperatures was performed to optimize assay conditions.

The conditions of multiplex PCR (MPCR) assays differ depending on the sets of primers. The thermocycling condition of MPCR-1 for amplifying BA1698, pag, and capA consisted of initial denaturation at 98ºC for 2 min, followed by 25 cycles of denaturation at 98º for 5 s, annealing at 59ºC for 30 s, extension at 72ºC for 30 s, and final extension at 72ºC for 8 min. The condition of MPCR-2 for amplifying BA5354, pag, and capA included an initial denaturation at 98ºC for 2 min, followed by 25 cycles of denaturation at 98º for 5 s, annealing at 52ºC for 30 s, extension at 70ºC for 30 s, and final extension at 70ºC for 8 min. The reaction of MPCR-3 for amplifying BA5361, pag, and capA goes an initial denaturation at 98ºC for 2 min, followed by 25 cycles of denaturation at 98º for 5 s, annealing at 56ºC for 30 s, extension at 72ºC for 30 s, and final extension at 72ºC for 8 min. The amplified PCR products were observed on a 1.5% agarose gel by electrophoresis. PCR products were purified using MinElute PCR Purification Kit (Qiagen, Germany), and Sequencing PCR was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA), followed by Sanger sequencing using a 3130 Genetic Analyzer (Applied Biosystems, USA). In addition, previously developed PCR assays with specific primers (Table 1) for the molecular detection of B. anthracis were used for comparison with our newly developed multiplex PCRs to confirm their specificity. The reactions were conducted under specified conditions described in previous studies [23–25] or according to the manufacturer’s instructions (Takara Bio Inc., Japan). The commercial PCR kit for B. anthracis detection manufactured by Takara Bio Inc. targets pag encoded on pXO1 and cap encoded on pXO2 plasmids. The expected size of the amplified PCR product is 591 bp for cap and 211 bp for pag. Additionally, this PCR system consists of control bands (409 bp for pag, 98 bp for cap) which would be visible after agarose gel electrophoresis.

To determine the detection limit of multiplex PCR assays, serial dilutions (640, 320, 160, 80, 40, 20, and 10 pg/µl) of genomic DNA of B. anthracis CZC5 were examined with MPCRs or the previous PCR methods and analyzed on agarose gel electrophoresis. Sterile water served as a negative control.

Furthermore, multiplex PCRs were performed directly using a colony of B. anthracis Sterne 34F2 strain grown on LB agar to evaluate the practical usage of the assays.

Results

Pan-genome analysis and identification of B. anthracis-specific genes

The pan-genome status, whether open or closed, reflects the likelihood of discovering a new gene or gene family when a new genome sequence is added to the analysis. An open pan-genome is likely to grow with new gene discoveries, whereas a closed pan-genome is unlikely to add more. The status of the pan-genome is modeled by Heap’s law estimation, of which exponent parameter γ value between 0 and 1 reflects the openness of a given pan-genome [20]. The pan-genome of B. anthracis, which includes genomes of 115 diverse strains, yielded a γ value of 0.09 (Fig. 1A), indicating a more closed pan-genome. In contrast, the pan-genomes of B. cereus (n = 142) and B. thuringiensis (n = 93) showed more open characteristics, with γ values of 0.51 and 0.52, respectively (Fig. 1B, C). Additionally, unlike B. cereus and B. thuringiensis, where accessory genes constitute the majority, the pan-genome of B. anthracis is primarily composed of core genes.

Fig. 1.

Fig. 1

Pan-genome analysis of B. anthracis and its closely related species, B. cereus and B. thuringiensis, with Heap’s law estimation. A The pan-genome of 115 B. anthracis strains and the corresponding Heap’s law estimation. B The pan-genome of 142 B. cereus strains, along with its Heap’s law estimation. C The pan-genome of 93 B. thuringiensis strains with Heap’s law estimation. Each Heap’s law estimation was conducted with 1000 permutations. The blue dots in the Heaps law graphic represent the observed number of unique genes as genomes are incrementally added. The red line represents the fitted Heap’s law curve based on the observed data. The x-axis represents the number of genomes. The y-axis represents the count of unique genes. k is intercept, representing the initial number of unique genes when only a few genomes are considered. γ is an exponent parameter that characterizes the rate at which new genes are added as more genomes are included in the analysis.If γ is closer to 1, it indicates an open pangenome, meaning the number of unique genes continues to increase significantly with additional genomes. Conversely, if γ is closer to 0, it suggests a closed pangenome, where the most genetic diversity is captured with the current dataset

Furthermore, to investigate the B. anthracis-specific genes, we choose 50 strains from each species, B. anthracis, B. cereus, and B. thuringiensis. Additionally, one complete genome of B. weihenstephanensis was incorporated in the combined dataset as an outgroup control. The pan-genome of the 151 strains consisted of 66,052 genes, of which 1,490 were core genes present in at least 99% of the sampled genomes, and 686 were soft-core genes present in at least 95% of all genomes analyzed. The non-core genomes were further divided into 6,221 shell genes, present in 15-95% of the genomes, and 57,655 accessory genes, present in less than 15% of the genomes.

Further, based on the strains clustering on the phylogenetic tree, we defined three groups of B. cereus s.l group: Bce1, Bce2, and Ban (Fig. 2 and Additional file 4). The Bce1 group consists of B. thuringiensis and B. cereus strains. Bce2 group also comprised B. cereus and B. thuringiensis strains, however, this group included unusual B. cereus strains such as G9241 and B. thuringiensis 97 − 27, which were previously known to cause anthrax-like diseases in humans and animals due to acquisition of plasmids highly similar to B. anthracis pXO1 and pXO2 [11]. All B. anthracis strains were categorized into one group named Ban.

Fig. 2.

Fig. 2

The pan-genome analysis illustrates the clustered presence or absence of genes and the distribution of accessory genes among the 151 Bacillus strains

A heatmap displays the core and accessory genes. The core-genome phylogeny is categorized into three distinct groups: the Ban group, which comprises B. anthracis strains; the Bce1 group, including common B. cereus and B. thuringiensis strains; and the Bce2 group, consisting of B. cereus and B. thuringiensis strains closely related to B. anthracis.

A Perl script was employed to extract the genes that are exclusively present in B. anthracis strains and absent in the other two groups of genomes. This initial analysis identified a total of 136 genes that are potentially exclusive to the genomes of B. anthracis strains (Table 2).

Table 2.

Number of group-specific genes

Bana Bce1a Bce2a Number of genesb
+ + + 1060
+ + - 0
+ - + 17
+ - - 136
- + + 0

aIf the group is included in the calculation of group-specific genes; +, If not -,

bThe number of genes found in groups corresponding to conditions

Among these, 88 genes corresponded to previously identified four prophage regions [27], and the remaining 48 genes were located outside these regions (Additional file 5). Notably, we observed a gene region spanning coordinates between 1,596,297 and 1,605,500 that was previously undefined (Fig. 3). This region contains genes BA1693-BA1699, which encode hypothetical proteins belonging to the glycosyltransferase family and BA1701, coding for a hypothetical protein in the 5’-monophosphate dehydrogenase family. Additionally, two transposases, BA1703 and BA1704, were found within this region (Fig. 4).

Fig. 3.

Fig. 3

The localization of genes identified from pan-genome analysis on the chromosome of B. anthracis Ames. Red lines indicate the genes identified in this study, while blue boxes represent the lambda prophage regions described in a previous study [27]. An additional new region was identified between the coordinates 1,596,297 and 1,605,500

Fig. 4.

Fig. 4

Undefined specific gene region in the B. anthracis chromosome. B. anthracis Ames represents the Ban group; B. cereus ATCC14579 and B. thuringiensis ATCC10792 represent the Bce1 group; while B. cereus G9241 and B. thuringiensis 97-27 represent the Bce2 group, as categorized in this study. Green arrows indicate genes that are common among the bacterial species and red arrows indicate genes exclusive to B. anthracis

To verify the specificity of the 136 genes identified from the pan-genome comparative analysis, each gene was used as a query and subjected to a BLASTn search with an expected threshold of 0.05 (E-value = 0.05) against the NCBI database. Genes that matched only with B. anthracis or its phage and not with other bacterial species were considered specific or partially specific to B. anthracis if the query coverage of the nucleotide sequence alignment was less than 50% (Table 3).

Table 3.

Genes identified as specific or partially specific to B. anthracis through a BLASTn search against the NCBI database

Gene regions*,# Locus taga, b,1–4 Coding product
Undefined gene region* BA1693b Glycosyltransferase, group 2 family
BA1694a Hypothetical protein, glycosyltransferase family protein
BA1695a Hypothetical protein, glycosyltransferase family protein
BA1696a Hypothetical protein, glycosyltransferase family protein
BA1697a Hypothetical protein, glycosyltransferase family protein
BA1698a,1 TPR/glycosyltransferase domain protein
BA1699a Hypothetical protein
BA1701a Hypothetical protein, inosine 5’-monophosphate dehydrogenase family protein
BA1703b Transposase
BA1704b Transposase
Prophage region 1# BA0444a Hypothetical protein
BA0454a Hypothetical protein
GBAA_RS02495a Hypothetical protein
BA0455b DUF3983 domain-containing protein
BA0463a Hypothetical protein
BA0479a,2 Prophage tail endopeptidase domain-containing protein
BA0480a Hypothetical protein
Prophage region 2# BA5340a Conserved domain protein
BA5344a HNH Endonuclease
BA5345a,3 Glycosyl-4,4’-diaponeurosporenoate acyltransferase
BA5346b DUF2513 domain-containing protein
BA5347a Conserved domain protein
BA5351b Hypothetical protein
BA5354a Hypothetical protein
BA5355a Terminase
BA5357a,4 Conserved domain protein
BA5361a Phage major capsid protein
BA5362a Conserved domain protein
Prophage region 3# BA4071a Hypothetical protein
BA4098b Conserved domain protein

aGenes without matches in non-Bacillus spp, and other bacteria

bGenes partially specific to B. anthracis, if the query coverage of the nucleotide sequence alignment was less than 50%

*Previously undefined gene region described in this study

#Lambda prophage region previously described in reference [27]

1Chromosomal markers have been described in reference [28]

2Chromosomal markers have been described in reference [29]

3Chromosomal markers have been described in reference [30]

4Chromosomal markers have been described in reference [31]

Local BLAST alignment further confirmed that 127 out of 132, chromosomally complete genomes of B. anthracis strains available in the GenBank database, possess all the identified genes listed in Table 3. Five B. anthracis strains, MCCC 1A02161, MCCC 1A01412, HDZK-BYSB7, CMF9, and Mn106-1 head 2chi found lacking any of those genes. These five strains have been reported to be misidentified as B. anthracis, due to their lack of several conserved B. anthracis-specific SNPs [32].

Development of Multiplex PCR using the identified B. anthracis-specific genes

We developed three distinct multiplex PCR assays (MPCR-1–3), each targeting a specific chromosome-encoded gene and two known markers, pag, and capA, encoded on the pXO1 and pXO2, respectively, plasmids of B. anthracis. Due to the predominance of prophage genes and genes coding glycosyltransferases, we proportionally selected BA1698, BA5354, and BA5361 as representatives of the chromosome-encoded genes, which were identified as specific to B. anthracis in the present study. A total of 62 bacterial strains, listed in Table 4, were utilized to evaluate the efficacy and specificity of multiplex PCR.

The efficacy of multiplex PCRs was examined using virulent B. anthracis strains previously isolated from various sources, including humans, livestock, and wildlife in endemic regions of Zambia and Mongolia. Additionally, a non-virulent B. anthracis Sterne 34F2 strain was included in the examination. All B. anthracis strains generated distinct and bright PCR products corresponding to the BA1698, BA5354, and BA5361 genes found on the chromosome, as well as the pag and capA genes encoded on the pXO1 and pXO2 plasmids, respectively, in Figs. 5, 6 and 7. Sterile distilled water instead of template DNA in the reaction mixture served as a negative control, which resulted in no PCR product.

Fig. 5.

Fig. 5

MPCR-1 targets BA1698, pag, and capA. M is a 100 bp DNA ladder used as a marker. Lanes 1–10, and A1-A7 are amplicon results of B. anthracis strains (Strain ID in Table 4, 1–10, A1-A7), lane NC no-template negative control. Lanes 11–55 are amplicon results of non-B. anthracis strains (Strain ID in Table 4, 11–55). We used 1.5% agarose gel

Fig. 6.

Fig. 6

MPCR-2 targets BA5354, pag, and capA. M is a 100 bp DNA ladder used as a marker. Lanes 1–10, and A1-A7 are amplicon results of B. anthracis strains (Strain ID in Table 4, 1–10, A1-A7), lane NC no-template negative control. Lanes 11–55 are amplicon results of non-B. anthracis strains (Strain ID in Table 4, 11–55). We used 1.5% agarose gel

Fig. 7.

Fig. 7

MPCR-3 targets BA5361, pag, and capA. M is a 100 bp DNA ladder used as a marker. Lanes 1–10, and A1-A7 are amplicon results of B. anthracis strains (Strain ID in Table 4, 1–10, A1-A7), lane NC no-template negative control. Lanes 11–55 are amplicon results of non-B. anthracis strains (Strain ID in Table 4, 11–55). We used 1.5% agarose gel

Moreover, the specificity of multiplex PCRs was tested using 35 other Bacillus spp. and 10 Gram-positive and negative non-Bacillus species. None of these bacterial species generated a PCR product for the chromosome-encoded genes that were identified as specific to B. anthracis. Notably, an atypical B. cereus, specifically the G9241 strain (Sample ID 38), showed a PCR product for the pag gene of B. anthracis, which is encoded on its pXO1 plasmid (Figs. 5, 6 and 7). This strain of B. cereus was found to harbor a plasmid that resembles the pXO1 of B. anthracis, carrying genes for major toxins responsible for anthrax, namely PA, LF, and EF [11].

The sensitivity of multiplex PCRs was determined using genomic DNA from B. anthracis CZC5 strain. MPCR-1 and 3 yielded detectable amplicons on agarose gel at a minimum DNA concentration of 80 pg/µl, while MPCR-2 exhibited a lower limit of 160 pg/µl for (Fig. 8).

Fig. 8.

Fig. 8

Sensitivity of multiplex PCRs analyzed by agarose gel electrophoresis. M is a 100 bp DNA ladder used as a marker. Lanes 1–7 are amplicon results of B. anthracis CZC5 strain (640, 320, 160, 80, 40, 20, 10 pg/μl), lane NC no-template negative control

Additionally, colony PCR performed directly using B. anthracis Sterne 34F2 colony without the need for DNA extraction, effectively yielded the desired amplicons for chromosome-encoded genes and the pag gene encoded on pXO1 plasmid (Additional file 6).

Further, to verify the specificity and overall ability of the newly developed multiplex PCR assays to accurately detect the presence of B. anthracis, the panel of Bacillus species, as well as other common environmental bacterial species listed in Table 4 were also tested by previous PCR assays recommended by the World Health Organization [23–25] and commercially available PCR kit (Takara Bio Inc., Japan) for B. anthracis detection. Consistent with our developed assays, each of these PCR methods detected pag and cap genes encoded on pXO1 and pXO2 plasmids in B. anthracis strains (Sample ID 1–10) and detected pag in atypical B. cereus G9241 (Sample ID 38) (Additional file 7, 8, and 9). Although the sensitivity of these methods was relatively high, capable of detecting DNA concentration 10 pg/ml or less (Additional file 10), PCR targets B. anthracis chromosome encoded sap gene was cross-reactive with B. cereus strains (Sample ID 33 and 39) and produced non-specific band (Sample ID 36) (Additional file 8). Despite the internal controls, the commercial kit also produced non-specific amplifications with non-target organisms (Additional file 9), which may indicate cross-reactivity with closely related bacterial species or the presence of similar sequences in non-target organisms.

Discussion

B. anthracis is highly pathogenic and can cause fatal infections in humans and animals. Due to its potential threat to national security, public health, and socioeconomic stability driven by a consequential loss of livestock, it is classified as a high-priority biological agent. B. anthracis has a significant overlap in genetic content with B. cereus and B. thuringiensis, making it challenging to distinguish from the other species. These Bacillus species are widespread and naturally occurring in nature. Identifying the genetic differences specific to B. anthracis is crucial for understanding its pathogenicity and designing accurate DNA-based detection methods.

We investigated chromosome-encoded genes specific to B. anthracis, employing whole genome comparison analyses that incorporated pan-genome of the three most genetically related species in the B. cereus s.l group: B. cereus, B. anthracis, and B. thuringiensis. Here, we demonstrated chromosome-encoded genes specific to B. anthracis and developed a PCR method utilizing some of these genes for the detection of B. anthracis.

Over the years, the increasing number of sequenced bacterial genomes has made it possible to capture genomic variation both among diverse strains within the same species and between different species. In this study, we analyzed the complete genomes of 115 diverse B. anthracis strains to further characterize their pan-genome. The core genes predominate in the pan-genome of B. anthracis, and they are well-conserved among strains. This high conservation of core genes and low genetic variability may reflect a stable evolutionary history and a lack of significant changes or adaptations in this species. Heap’s law estimation supports this conclusion, showing that the pan-genome of B. anthracis is closed; most genes have already been captured, and the discovery rate of new genes approaches zero (Fig. 1A). This aligns with the earlier work of Tettelin et al., [34], who analyzed the genomes of eight B. anthracis strains and similarly concluded that its pan-genome is closed, suggesting a highly clonal species with low genomic variability. This consistent genetic variability in B. anthracis could be advantageous for diagnosing this species, as it reduces the likelihood of significant genetic variations affecting diagnostic markers. On the other hand, the pan-genome of B. cereus and B. thuringiensis present a high percentage of accessory genes and a much smaller proportion of core genes. Their pan-genome statuses are open (Fig. 1B, C), implying that substantial genetic diversity continues to expand as more strains are sequenced, increasing the number of unique genes. This result aligns with previous study [35] that reported the openness of B. cereus s. l. group pan-genome. Identifying strain-specific genes among diverse B. cereus and B. thuringiensis strains could be valuable for predicting pathogenicity, enhancing diagnostic accuracy, and treatment strategies.

Studies have been searching for genomic differences between B. anthracis and its closest relative in the B. cereus group using different approaches. Read et al., reported that four lambda prophage regions are absent in the chromosome of B. anthracis Ames compared to its 19 close neighbors via comparative genomic hybridization [27]. These regions contain various specific and non-specific genes, and further studies determined species-specific genetic markers for B. anthracis by designing multiple primers targeting prophage regions [29], suggesting BA0479, BA5356, BA4094, and BA3805 as possible gene markers for identifying B. anthracis. Radnedge et al., revealed BA5345, located in prophage region 2, through amplified fragment length polymorphism (AFLP), and suppression subtractive hybridization (SSH) methods [30]. In addition, BA5357 [31] and BA5358 [36] also encoded in prophage region 2, and BA1698 [28] were previously described as specific to B. anthracis by comparative genome analysis. In agreement with these former studies, our pan-genome analysis also recognized all those previously reported specific genes and further expanded the number of B. anthracis-specific genes in the prophage regions and beyond (Additional file 5 and Table 3). This underscores the robustness and reliability of our method in B. anthracis-specific gene identification. We identified 136 genes that are present in the genomes of B. anthracis strains and absent in the B. cereus and B. thuringiensis strains included in our dataset for pan-genome comparison. Eighty eight out of 136 genes locate in prophage regions and 48 genes were found from other locations in the B. anthracis chromosome. This number was further reduced to 30 after global BLASTn in NCBI, because to ensure the gene specificity, we removed the genes that matched any organism other than B. anthracis or its phage. We found 20 genes in prophage regions, including those formerly reported genes. As prophage regions contain both specific and non-specific genes that can complicate the development of diagnostic tools, our study addresses this challenge by precisely indicating each specific gene with its unique locus tag. Also, similar to the previous studies [29], we observed that each of the four lambda prophage regions incorporates genes encoding site-specific recombinases (BA5363, BA4075, BA3832, and BA0427), which catalyze the recombination event therefore might facilitate the phage integration into the genome of B. anthracis (Additional file 5).

Further, our approach has enabled us to discover an additional unique gene region range from 1,596,297–1,605,500, which include BA1693-BA1699, encoding hypothetical proteins belonging to the glycosyltransferase family, BA1701, encoding a putative inosine 5′-monophosphate dehydrogenase, and two transposases, BA1703 and BA1704 (Fig. 4). To elucidate the potential role of proteins encoded by these genes in B. anthracis, we employed STRING v.12.0 [21], which predicts potential physical and functional protein-protein interactions. A significant interaction was found only for glycosyltransferase encoded by BA1698 and it was predicted to interact with enzymes involved in various biological processes, namely, the 4-alpha-glucan branching enzyme, which is key in glycogen formation; dTDP-4-dehydrorhamnose 3,5-epimerase, dTDP-glucose 4,6-dehydratase, and glucose-1-phosphate thymidylyltransferase, crucial for the biosynthesis of rhamnose, an essential component of the bacterial cell wall, and UDP-glucose 6-dehydrogenase, integral to the formation of the antiphagocytic capsule formation, respectively (Additional file 11). In fact, previous research has shown that the glycosyl residue composition of cell walls vary between different clades of B. cereus strains and is distinct from that of B. anthracis [37]. However, B. cereus strains (G9241, 03BB102, 03BB87), which are phylogenetically closest to B. anthracis, exhibit glycosyl compositions that closely resemble the cell walls of B. anthracis strains [38]. Considering this, the hypothetical proteins belonging to glycosyltransferases found only in B. anthracis may be associated with distinct cell-surface characteristics and virulence of the bacterium. Furthermore, the predicted interactions with those of enzymes and proteins not only underline the role of the glycosyltransferase encoded by BA1698 in synthesizing and modifying essential polysaccharides for cell wall and capsule formation but also suggest a broader involvement in the organism’s energy accumulation and stress response via glycogen metabolism. Glycogen, as a primary storage form of glucose, its metabolism, and accumulation might be critical for B. anthracis, enabling it to remain viable during the dormant spore state, which can last for decades. Like other dormant bacterium [39], B. anthracis could strategically conserve energy to transition back to an active, vegetative state from dormancy. Thus, understanding the role of the glycosyltransferases found to be unique to B. anthracis may have important implications in improving our knowledge regarding this bacterium’s survival. Further experimental studies, such as gene knockout, enzyme activity, sporulation, and virulence tests in animal models, would be necessary to conclusively determine the biological role and importance of the specific glycosyltransferases in B. anthracis. Such studies could also reveal potential targets for drugs or antigens for vaccines against anthrax.

The main criteria for designing a DNA-based method to detect B. anthracis is to prevent false-positive results from its closely related species and ensure the presence of specific genes or sequences in all B. anthracis isolates to avoid false-negative outcomes. We confirmed the presence of all genes identified from our analysis among the complete genomes of 132 B. anthracis strains through local BLAST alignment. However, five strains, MCCC 1A02161, MCCC 1A01412, HDZK-BYSB7, CMF9, and Mn106-1 head 2chi lacked any of the genes we identified (Additional file 3). This agrees with Lyu et al., who indicated that strains MCCC 1A02161 and MCCC 1A01412 were misidentified as B. anthracis in the NCBI genome database, due to the absence of several conserved B. anthracis-specific SNPs in their genome [32]. Accordingly, we verified the absence of thymine at nucleotide position 640 of the plcR gene, a chromosomal signature for distinguishing B. anthracis from its closely related neighbors, thus confirming that these strains are not B. anthracis. Altogether, these results indicate that the genes identified in prophage regions and newly identified gene region are highly conserved among globally diverse B. anthracis strains.

Further, we used three of the identified genes to establish three multiplex PCR assays for detecting B. anthracis. Each multiplex PCR targets one chromosome-encoded gene and two plasmid-encoded markers. Despite the presence of plasmid-encoded markers, pag, and capA in unusual B. cereus and B. thuringiensis strains, we included these markers in the multiplex PCRs as they are clinically relevant targets for anthrax diagnosis. Moreover, to account for the potential emergence of atypical Bacillus species that possess one or more chromosome-encoded genes our assays targeted, we developed three distinct PCR assays. These assays enable cross-validation and ensure reliable detection and differentiation of B. anthracis from atypical strains when necessary.

Due to the high pathogenicity of B. anthracis and strict international regulations governing its use and transportation, obtaining a diverse set of B. anthracis strains was challenging. Nevertheless, we obtained 16 virulent strains from two different anthrax endemic regions, Africa, and Asia through our collaborative partners. From Zambia, we received genomic DNA of nine virulent strains previously isolated from wildlife, livestock, and humans infected with anthrax, and seven from Mongolia. These strains were carefully selected to reflect the temporal and geographic diversity from each country, as they were isolated from various locations at different times. Additionally, one vaccine strain was examined to assess the efficacy of the multiplex PCR assays.

All B. anthracis strains were accurately detected by the multiplex PCRs. This supports the effectiveness of our assay across a wider range of genetic variants but also demonstrates its potential applicability in diverse geographical settings.

Furthermore, we tested the specificity of these newly developed PCR assays against 45 bacterial stains, including B. anthracis closely related Bacillus species, and common environmental bacteria (Table 4). This collection included B. cereus G9241, and E33L, which were previously defined to be very closely related to B. anthracis [40]. Moreover, the phylogenetic tree (Additional file 4) constructed based on the core-genome alignment of strains of the three Bacillus species, showed that B. cereus strains that have previously been associated with nosocomial infection (e.g., MRY14-0074, J2, 30052) exhibit even higher genetic resemblance to B. anthracis [41]. Despite their close genetic similarities, none of these strains yielded false-positive results in our PCR assays, underscoring the specificity of our methods. Based on the comparative ratio between the number of true negatives (n = 45) and the sum of true negatives (n = 45) and false positives (n = 0), the specificity of the multiplex PCRs was determined to be 99.9%. All true positive samples (n = 17) were detected within the detection limit of DNA concentration (Fig. 8).

Our experimental results, in silico analysis, and previous studies have indicated that B. anthracis strains are genetically highly monomorphic [42, 43], which could reduce the likelihood that our assay would fail to detect genetically divergent strains. However, the current study has a limitation in sample size; therefore, further validation is required to assess reproducibility and consistency by incorporating more B. anthracis strains isolated from different geographical regions and clinical backgrounds to ensure the robustness of these assays. So far, multiplex PCRs developed in this study offer alternative specific and practical tools for early diagnosis of anthrax. Particularly, we established a standard multiplex PCR assay, recognizing the urgent need for anthrax diagnosis in developing countries such as Zambia and Mongolia, where resources are limited, and anthrax prevalence is high. Our assay provides a cost-effective, accurate, and easy-to-implement solution, suitable for settings with limited laboratory infrastructure. It only requires standard PCR equipment, which is widely available in these regions, thereby enhancing its diagnostic utility. In the future, our current assays would be developed to include isothermal amplification techniques to further facilitate the diagnostic process.

Conclusion

The chromosome-encoded specific genes of B. anthracis identified in this study offer an advantage over previously defined marker genes, which often result in false-positive results. Our pan-genome analysis successfully captured all known specific genes in previously described lambda prophage regions and further expanded the number of specific genes within these regions.

Additionally, our research has revealed a previously undefined gene region coding ten B. anthracis-specific genes, of which nine were reported for the first time, to our knowledge. These findings contribute to our current knowledge of the unique genetic attributes of B. anthracis in comparison to its genetically similar neighboring species, and provide distinct markers that distinguish B. anthracis from other closely related Bacillus species.

In the future, in-depth analyses of these genes unique to B. anthracis could potentially lead to unveil metabolic pathways that enable the bacterium to survive in prolonged nutrient-poor conditions, as well as their roles in the sporulation and germination life cycle. This research could serve as a foundation for exploring potential vaccine candidates and drug targets for the treatment of anthrax.

Supplementary Information

Supplementary Material 1. (23.8KB, xlsx)
Supplementary Material 3. (13.5KB, xlsx)
Supplementary Material 5. (17.1KB, xlsx)
Supplementary Material 6. (213.2KB, docx)
Supplementary Material 11. (219.1KB, docx)

Acknowledgements

We thank the Microbiology Unit, Paraclinical Studies University of Zambia, Hokkaido University Center for Zoonosis Control in Zambia, and Institute for Veterinary Medicine Mongolia for their cooperation in providing genomic DNA of Bacillus anthracis. We would like to acknowledge the support of BEI Resources in providing the bacterial strains necessary for our study. The following reagents were obtained through BEI Resources, NIAID, NIH: Enterococcus faecalis, Strain V587, NR-31979; Enterococcus faecium, Strain UAA714, NR-32065; Enterococcus faecium, Strain UAA945, NR-32094; Pseudomonas aeruginosa, Strain PA14, NR-50573; Staphylococcus aureus, Strain F003B2N-C, NR-30546; Bacillus cereus, Strain G9241, NR-9564; Bacillus cereus, Strain E33L, NR-12264. The following reagent was obtained through BEI Resources, NIAID, NIH as part of the Human Microbiome Project: Enterococcus faecalis, Strain S613, HM-334. The following reagents were provided by the Network on Antimicrobial Resistance in Staphylococcus aureus (NARSA) for distribution by BEI Resources, NIAID, NIH: Staphylococcus aureus, Strain RN4220, NR-45946; Staphylococcus aureus, Strain USA300-0114, NR-46070; Staphylococcus aureus, Strain 71080, NR-46418.

Authors' contributions

T.Z., Y.F., and H.H. conceptualized the study. T.Z. and Y.F. analyzed the data. T.Z. and M.Sh. conducted the experiments. A.P., J.E., N.E., B.B., H.K.K., M.M., and B.M.H. provided resources. M.Ch. and M.S. contributed with technical assistance. T.Z. wrote the manuscript, which was corrected and approved by all other co-authors. All authors read and approved the final manuscript.

Funding

This work was supported by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) in Japan and Japan Society for the Promotion of Science (JSPS) under Grants-in-Aid for Scientific Research (KAKENHI) to T.Z. (Grant Number 23K19460), H.H. (Grant Number 18K19436), and A.P. (Grant Number 21K15430)., The Japan Program for Infectious Diseases Research and Infrastructure (JIDRI) to H.H. (Grant Number JP23wm0125008) from the Japan Agency for Medical Research and Development (AMED). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

Complete genome datasets of bacterial strains used in the pan-genome analysis and B. anthracis strains used for local BLAST alignment were downloaded from NCBI and their accession numbers were listed in Additional file 1 and Additional file 3.

Declarations

Ethics approval and consent to participate

Ethical approval was granted by Excellence in Research Ethics Converge with reference number 2021-Nov-024.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Carlson CJ, Kracalik IT, Ross N, Alexander KA, Hugh-Jones ME, Fegan M, Elkin BT, Epp T, Shury TK, Zhang W, et al. The global distribution of Bacillus anthracis and associated anthrax risk to humans, livestock and wildlife. Nat Microbiol. 2019;4(8):1337–43. 10.1038/s41564-019-0435-4 [DOI] [PubMed] [Google Scholar]
  • 2.Kyriacou DN, Adamski A, Khardori N. Anthrax: from antiquity and obscurity to a front-runner in bioterrorism. Infect Dis Clin North Am. 2006;20(2):227–51, viii. 10.1016/j.idc.2006.03.009 [DOI] [PubMed] [Google Scholar]
  • 3.Mock M, Fouet A. Anthrax. Annu Rev Microbiol. 2001;55(1):647–71. 10.1146/annurev.micro.55.1.647 [DOI] [PubMed] [Google Scholar]
  • 4.Turnbull PC. Anthrax vaccines: past, present and future. Vaccine. 1991;9(8):533–9. 10.1016/0264-410X(91)90237-Z [DOI] [PubMed] [Google Scholar]
  • 5.Baldwin VM. You can’t B. cereus – a review of Bacillus cereus strains that cause anthrax-like disease. Front Microbiol. 2020;11: 1731. 10.3389/fmicb.2020.01731 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Logan NA, Carman JA, Melling J, Berkeley RC. Identification of bacillus anthracis by API tests. J Med Microbiol. 1985;20(1):75–85. 10.1099/00222615-20-1-75 [DOI] [PubMed] [Google Scholar]
  • 7.Mohammed MJ, Marston CK, Popovic T, Weyant RS, Tenover FC. Antimicrobial susceptibility testing of Bacillus anthracis: comparison of results obtained by using the national committee for clinical laboratory standards broth microdilution reference and Etest agar gradient diffusion methods. J Clin Microbiol. 2002;40(6):1902–7. 10.1128/JCM.40.6.1902-1907.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Odendaal MW, Pieterson PM, de Vos V, Botha AD. The biochemical, morphological and virulence profiles of Bacillus anthracis isolated in the Kruger National Park. Onderstepoort J Vet Res. 1991;58(1):21–6. [PubMed] [Google Scholar]
  • 9.Ramisse V, Patra G, Garrigue H, Guesdon JL, Mock M. Identification and characterization of Bacillus anthracis by multiplex PCR analysis of sequences on plasmids pXO1 and pXO2 and chromosomal DNA. FEMS Microbiol Lett. 1996;145(1):9–16. 10.1111/j.1574-6968.1996.tb08548.x [DOI] [PubMed] [Google Scholar]
  • 10.Turnbull PCB, Hutson RA, Ward MJ, Jones MN, Quinn CP, Finnie NJ, Duggleby CJ, Kramer JM, Melling J. Bacillus anthracis but not always anthrax. J Appl Bacteriol. 1992;72(1):21–8. [DOI] [PubMed] [Google Scholar]
  • 11.Hoffmaster AR, Ravel J, Rasko DA, Chapman GD, Chute MD, Marston CK, De BK, Sacchi CT, Fitzgerald C, Mayer LW, et al. Identification of anthrax toxin genes in a Bacillus cereus associated with an illness resembling inhalation anthrax. Proc Natl Acad Sci U S A. 2004;101(22):8449–54. 10.1073/pnas.0402414101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Qi Y, Patra G, Liang X, Williams LE, Rose S, Redkar RJ, DelVecchio VG. Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Appl Environ Microbiol. 2001;67(8):3720–7. 10.1128/AEM.67.8.3720-3727.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hurtle W, Bode E, Kulesh DA, Kaplan RS, Garrison J, Bridge D, House M, Frye MS, Loveless B, Norwood D. Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. J Clin Microbiol. 2004;42(1):179–85. 10.1128/JCM.42.1.179-185.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ramisse V, Patra G, Vaissaire J, Mock M. The Ba813 chromosomal DNA sequence effectively traces the whole Bacillus anthracis community. J Appl Microbiol. 1999;87(2):224–8. 10.1046/j.1365-2672.1999.00874.x [DOI] [PubMed] [Google Scholar]
  • 15.Easterday WR, Van Ert MN, Simonson TS, Wagner DM, Kenefic LJ, Allender CJ, Keim P. Use of single nucleotide polymorphisms in the plcR gene for specific identification of Bacillus anthracis. J Clin Microbiol. 2005;43(4):1995–7. 10.1128/JCM.43.4.1995-1997.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Easterday WR, Van Ert MN, Zanecki S, Keim P. Specific detection of Bacillus anthracis using a TaqMan mismatch amplification mutation assay. Biotechniques. 2005;38(5):731–5. 10.2144/05385ST03 [DOI] [PubMed] [Google Scholar]
  • 17.Birdsell DN, Pearson T, Price EP, Hornstra HM, Nera RD, Stone N, Gruendike J, Kaufman EL, Pettus AH, Hurbon AN, et al. Melt analysis of mismatch amplification mutation assays (Melt-MAMA): a functional study of a cost-effective SNP Genotyping Assay in bacterial models. PLoS ONE. 2012;7(3): e32866. 10.1371/journal.pone.0032866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30(14):2068–9. 10.1093/bioinformatics/btu153 [DOI] [PubMed] [Google Scholar]
  • 19.Page AJ, Cummins CA, Hunt M, Wong VK, Reuter S, Holden MT, Fookes M, Falush D, Keane JA, Parkhill J. Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics. 2015;31(22):3691–3. 10.1093/bioinformatics/btv421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tettelin H, Riley D, Cattuto C, Medini D. Comparative genomics: the bacterial pan-genome. Curr Opin Microbiol. 2008;11(5):472–7. 10.1016/j.mib.2008.09.006 [DOI] [PubMed] [Google Scholar]
  • 21.Szklarczyk D, Kirsch R, Koutrouli M, Nastou K, Mehryary F, Hachilif R, Gable AL, Fang T, Doncheva NT, Pyysalo S, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023;51(D1):D638-46. 10.1093/nar/gkac1000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Akamatsu R, Suzuki M, Okinaka K, Sasahara T, Yamane K, Suzuki S, Fujikura D, Furuta Y, Ohnishi N, Esaki M, et al. Novel sequence type in Bacillus cereus strains associated with nosocomial infections and bacteremia, Japan. Emerg Infect Dis. 2019;25(5):883–90. 10.3201/eid2505.171890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hutson RA, Duggleby CJ, Lowe JR, Manchee RJ, Turnbull PC. The development and assessment of DNA and oligonucleotide probes for the specific detection of Bacillus anthracis. J Appl Bacteriol. 1993;75(5):463–72. 10.1111/j.1365-2672.1993.tb02803.x [DOI] [PubMed] [Google Scholar]
  • 24.Beyer W, Glöckner P, Otto J, Böhm R. A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol Res. 1995;150(2):179–86. 10.1016/S0944-5013(11)80054-6 [DOI] [PubMed] [Google Scholar]
  • 25.World Health Organization. Guidelines for the Surveillance and Control of Anthrax in Human and animals. 3rd ed. Geneva: WHO; 1998. [Google Scholar]
  • 26.Makino SI, Cheun HI, Watarai M, Uchida I, Takeshi K. Detection of anthrax spores from the air by real-time PCR. Lett Appl Microbiol. 2001;33(3):237–40. 10.1046/j.1472-765x.2001.00989.x [DOI] [PubMed] [Google Scholar]
  • 27.Read TD, Peterson SN, Tourasse N, Baillie LW, Paulsen IT, Nelson KE, Tettelin H, Fouts DE, Eisen JA, Gill SR, et al. The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature. 2003;423(6935):81–6. 10.1038/nature01586 [DOI] [PubMed] [Google Scholar]
  • 28.홍석현.: A new Bacillus anthracis specific gene and its diagnostic application. Seoul National University Graduate School. 2016.
  • 29.Sozhamannan S, Chute MD, McAfee FD, Fouts DE, Akmal A, Galloway DR, Mateczun A, Baillie LW, Read TD. The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages. BMC Microbiol. 2006;6(1): 34. 10.1186/1471-2180-6-34 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Radnedge L, Agron PG, Hill KK, Jackson PJ, Ticknor LO, Keim P, Andersen GL. Genome differences that distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis. Appl Environ Microbiol. 2003;69(5):2755–64. 10.1128/AEM.69.5.2755-2764.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Létant SE, Murphy GA, Alfaro TM, Avila JR, Kane SR, Raber E, Bunt TM, Shah SR. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples. Appl Environ Microbiol. 2011;77(18):6570–8. 10.1128/AEM.00623-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lyu Y, Wang D, Yuan L, Feng E, Zhu L, Pan C, Guo Y, Liu X, Wang H. Rapid Identification of bacillus anthracis in silico and on-site using novel single-nucleotide polymorphisms. Microbiol Spectr. 2022;10(3):e0228521. 10.1128/spectrum.02285-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ohnishi N, Maruyama F, Ogawa H, Kachi H, Yamada S, Fujikura D, Nakagawa I, Hang’ombe MB, Thomas Y, Mweene AS, et al. Genome sequence of a Bacillus anthracis outbreak strain from Zambia, 2011. Genome Announc. 2014;2(2):e0016-0014. 10.1128/genomeA.00116-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, et al. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial pan-genome. Proc Natl Acad Sci U S A. 2005;102(39):13950–5. 10.1073/pnas.0506758102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bazinet AL. Pan-genome and phylogeny of Bacillus cereus sensu lato. BMC Evol Biol. 2017;17(1):176. 10.1186/s12862-017-1020-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wielinga PR, Hamidjaja RA, Ågren J, Knutsson R, Segerman B, Fricker M, Ehling-Schulz M, de Groot A, Burton J, Brooks T, et al. A multiplex real-time PCR for identifying and differentiating B. Anthracis virulent types. Int J Food Microbiol. 2011;145:S137-44. 10.1016/j.ijfoodmicro.2010.07.039 [DOI] [PubMed] [Google Scholar]
  • 37.Forsberg LS, Choudhury B, Leoff C, Marston CK, Hoffmaster AR, Saile E, Quinn CP, Kannenberg EL, Carlson RW. Secondary cell wall polysaccharides from Bacillus cereus strains G9241, 03BB87 and 03BB102 causing fatal pneumonia share similar glycosyl structures with the polysaccharides from Bacillus anthracis. Glycobiology. 2011;21(7):934–48. 10.1093/glycob/cwr026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leoff C, Saile E, Sue D, Wilkins P, Quinn CP, Carlson RW, Kannenberg EL. Cell wall carbohydrate compositions of strains from the Bacillus cereus group of species correlate with phylogenetic relatedness. J Bacteriol. 2008;190(1):112–21. 10.1128/JB.01292-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Klotz A, Georg J, Bučinská L, Watanabe S, Reimann V, Januszewski W, Sobotka R, Jendrossek D, Hess WR, Forchhammer K. Awakening of a dormant cyanobacterium from nitrogen chlorosis reveals a genetically determined program. Curr Biol. 2016;26(21):2862–72. 10.1016/j.cub.2016.08.054 [DOI] [PubMed] [Google Scholar]
  • 40.Han CS, Xie G, Challacombe JF, Altherr MR, Bhotika SS, Brown N, Bruce D, Campbell CS, Campbell ML, Chen J, et al. Pathogenomic sequence analysis of Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus anthracis. J Bacteriol. 2006;188(9):3382–90. 10.1128/JB.188.9.3382-3390.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Furuta Y, Tsujinouchi M, Shawa M, Zorigt T, Miyajima Y, Paudel A, Suzuki S, Higashi H. Complete genome sequences of 24 strains of Bacillus cereus Isolated from nosocomial infection and bacteremia cases in Japan. Microbiol Resour Announc. 2022;11:e0120321. 10.1128/mra.01203-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kolstø AB, Tourasse NJ, Økstad OA. What sets Bacillus anthracis apart from other Bacillus species? Annu Rev Microbiol. 2009;63:451–76. 10.1146/annurev.micro.091208.073255 [DOI] [PubMed] [Google Scholar]
  • 43.Timofeev V, Bakhteeva I, Khlopova K, Mironova R, Titareva G, Goncharova Y, Solomentsev V, Kravchenko T, Dyatlov I, Vergnaud G. New Research on the Bacillus anthracis genetic diversity in Siberia. Pathogens 2023;12(10). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (23.8KB, xlsx)
Supplementary Material 3. (13.5KB, xlsx)
Supplementary Material 5. (17.1KB, xlsx)
Supplementary Material 6. (213.2KB, docx)
Supplementary Material 11. (219.1KB, docx)

Data Availability Statement

Complete genome datasets of bacterial strains used in the pan-genome analysis and B. anthracis strains used for local BLAST alignment were downloaded from NCBI and their accession numbers were listed in Additional file 1 and Additional file 3.


Articles from BMC Infectious Diseases are provided here courtesy of BMC

RESOURCES