Skip to main content
NCBI home page
Plant Biotechnology Journal logoLink to Plant Biotechnology Journal
. 2015 Apr 10;14(1):206–214. doi: 10.1111/pbi.12374

Co‐expression of NCED and ALO improves vitamin C level and tolerance to drought and chilling in transgenic tobacco and stylo plants

Gegen Bao 1, Chunliu Zhuo 1, Chunmei Qian 1, Ting Xiao 1, Zhenfei Guo 1,2,✉, Shaoyun Lu 1,✉
PMCID: PMC11388907  PMID: 25865630

Summary

Abscisic acid (ABA) regulates plant adaptive responses to various environmental stresses, while l‐ascorbic acid (AsA) that is also named vitamin C is an important antioxidant and involves in plant stress tolerance and the immune system in domestic animals. Transgenic tobacco (Nicotiana tabacum L.) and stylo [Stylosanthes guianensis (Aublet) Swartz], a forage legume, plants co‐expressing stylo 9‐cis‐epoxycarotenoid dioxygenase (SgNCED1) and yeast d‐arabinono‐1,4‐lactone oxidase (ALO) genes were generated in this study, and tolerance to drought and chilling was analysed in comparison with transgenic tobacco overexpressing SgNCED1 or ALO and the wild‐type plants. Compared to the SgNCED1 or ALO transgenic plants, in which only ABA or AsA levels were increased, both ABA and AsA levels were increased in transgenic tobacco and stylo plants co‐expressing SgNCED1 and ALO genes. Compared to the wild type, an enhanced drought tolerance was observed in SgNCED1 transgenic tobacco plants with induced expression of drought‐responsive genes, but not in ALO plants, while an enhanced chilling tolerance was observed in ALO transgenic tobaccos with induced expression of cold‐responsive genes, but not in SgNCED1 plants. Co‐expression of SgNCED1 and ALO genes resulted in elevated tolerance to both drought and chilling in transgenic tobacco and stylo plants with induced expression of both drought and cold‐responsive genes. Our result suggests that co‐expression of SgNCED1 and ALO genes is an effective way for use in forage plant improvement for increased tolerance to drought and chilling and nutrition quality.

Keywords: abiotic stress, antioxidant, forage legume

Introduction

Plants are often exposed to multiple environmental stresses, such as drought, salinity and extreme temperatures (cold and heat), during a plant's life cycle. These abiotic stresses result in both general and specific effects on plant growth and development and are the major cause of reducing crop productivity and quality (Mahajan and Tuteja, 2005). Photosynthesis is greatly inhibited under abiotic stresses, which lead to elevated accumulation of reactive oxygen species (ROS) and oxidative damage on membranes and thus affecting cell viability. Plants have evolved adaptation mechanisms in response to stress conditions. Abscisic acid (ABA) is a phytohormone critical for diverse physiological and developmental processes and plays an important role in integrating various stress signals and regulating downstream stress responses (Fujita et al., 2011; Roychoudhury et al., 2013). Abscisic acid level is triggered in response to various stress signals, mainly due to the induction of the genes responsible for ABA synthesis (Xiong and Zhu, 2003). 9‐cis‐Epoxycarotenoid dioxygenase (NCED) is the key enzyme involved in ABA synthesis in higher plants (Nambara and Marion‐Poll, 2005; Qin and Zeevaart, 1999). NCED expression is induced by water‐deficit, salinity and chilling stresses (Iuchi et al., 2000; Qin and Zeevaart, 1999; Yang and Guo, 2007). Overexpression of NCED gene resulted in ABA accumulation and increased tolerance to drought and salinity in transgenic plants (Iuchi et al., 2001; Qin and Zeevaart, 2002; Zhang et al., 2008, 2009), while Arabidopsis NCED3 knockout mutant exhibit drought‐sensitive phenotype with reduced ABA level (Iuchi et al., 2001).

Antioxidant defence system including both antioxidant enzymes and nonenzymatic antioxidants plays an important role in abiotic stress tolerance. It functions to scavenge the elevated ROS, including superoxide radicals, hydrogen peroxide (H2O2) and hydroxyl radicals, in plant cells resulted from abiotic stresses for protection against oxidative damages on cell membranes. Superoxide radicals are usually detoxified by superoxide dismutase (SOD), while H2O2 is scavenged by catalase (CAT) and the ascorbate–glutathione cycle that includes ascorbate peroxidase (APX), glutathione reductase (GR), ascorbate (AsA) and glutathione (GSH) (Foyer and Noctor, 2009; Gill and Tuteja, 2010). Numerous studies indicate that activities of antioxidant enzymes are correlated with plant tolerance to abiotic stresses such as drought and chilling stress (Gill and Tuteja, 2010; Guo et al., 2006; Lu et al., 2013). Ascorbic acid is an important component of the plant antioxidant system, regulating ROS levels, plant defence gene expression and responses to environmental stresses (Chen and Gallie, 2005; Conklin and Barth, 2004; Hemavathi et al., 2010; Smirnoff and Wheeler, 2000). Ascorbic acid is synthesized through multiple biosynthetic pathways in plants (Gallie, 2013), while the major pathway is Smirnoff–Wheeler pathway (Wheeler et al., 1998). Overexpression of d‐galacturonic acid reductase, GDP‐l‐galactose phosphorylase, l‐galactono‐1,4‐lactone dehydrogenase and GDP‐l‐galactose guanyltransferase genes resulted in increased AsA levels (Agius et al., 2003; Bulley et al., 2009, 2011; Liu et al., 2013; Tokuna et al., 2005) and tolerance to paraquat and salinity stresses (Liu et al., 2013). d‐Arabinono‐1,4‐lactone oxidase (ALO) is a key enzyme for synthesis of d‐erythroascorbic acid in yeast. This enzyme can use l‐galactono‐1,4‐lactone as efficiently as d‐arabinono‐1,4‐lactone to produce AsA (Huh et al., 1994; Lee et al., 1999). Overexpression of ALO resulted in elevated AsA levels and tolerance to paraquat and high light‐induced oxidative stress and aluminium toxicity (Chen et al., 2014). Ascorbic acid is also essential for domestic animals. Although domestic animals can synthesize AsA in their liver, the amount of AsA produced by the animals may be insufficient to meet its requirements under specific physiological conditions. Lactating dairy cattle may predispose AsA deficiency due to the huge use of glucose and galactose, precursor of AsA synthesis, for production of milk (Matsui, 2012). It is hypothesized that an elevated AsA level will improve both tolerance to abiotic stresses and nutrition quality in forage plants.

Stylo is an important forage legume and cover crop in tropical and southern subtropical regions with great tolerance to soil acidity and good adaptation to infertile soil (De La Rue et al., 2003; Jiang et al., 2005), but it is sensitive to cold. Low temperature in winter is the major factor limiting its growth and survival in subtropical regions. Stylo seedlings are damaged upon exposure to low temperature at 10 °C in growth chamber (Zhou et al., 2005a). Chilling tolerance of stylo is associated with regulation of antioxidant system under low temperature. Higher activities of SOD, CAT and APX and contents of AsA and GSH were observed in chilling tolerant mutants of stylo as compared to the wild type under low temperature conditions (Lu et al., 2013). Chilling tolerance of stylo is increased by the exogenous application of ABA through induced antioxidant defence system (Zhou et al., 2005a), with the involvement of signal molecules nitric oxide (NO) (Zhou et al., 2005b) and Ca2+ (Zhou and Guo, 2009). In addition, enhancing drought tolerance is important for a cover crop. However, there is no investigation on improvement of abiotic stress tolerance and vitamin C content in stylo.

Although Agrobacterium‐mediated transformation of stylo was reported using bar gene as selective marker (Sarra et al., 1994), the transformation efficiency was low, and thus, microparticle bombardment protocol was examined later (Quecini et al., 2006). It is important to establish an effective transformation protocol in stylo for its improvements by transgenics. The objective of this study was to generate transgenic stylo plants with improvements in abiotic stress tolerance and vitamin C content by co‐expressing SgNCED1 and ALO genes, using Agrobacterium‐mediated transformation. In addition, transgenic tobacco plants overexpressing SgNCED1 or ALO and co‐expressing SgNCED1 and ALO were analysed for understanding effectiveness of SgNCED1 and ALO genes.

Results

Analysis of transgenic tobacco plants co‐expressing SgNCED1 and ALO

Transgenic tobacco plants co‐expressing SgNCED1 and ALO under control of the CaMV35S promoter (Figure 1a) were generated after selection on basta‐containing medium. DNA hybridization showed that bar gene was integrated into the genomes of transgenic plants (lines NA1 and NA2), whereas no cross‐hybridization was observed in the wild type (Figure 1b). Transcripts of SgNCED1 and ALO genes in two homozygous plant lines (T2) were further analysed, in comparison with the transgenic tobacco plants overexpressing SgNCED1 (lines N16 and N61) or ALO (lines A53 and A75) under control of the CaMV35S promoter (Chen et al., 2014; Zhang et al., 2009). Real‐time quantitative RT‐PCR data showed that SgNCED1 transcripts could be detected in lines NA1, NA2, N16 and N61, while ALO transcripts could be detected in lines NA1, NA2, A53 and A75. In addition, higher levels of SgNCED1 transcripts were observed in lines NA1 and NA2 than in lines N16 and N61 (Figure 1c).

Figure 1.

Figure 1

Open in a new tab

Map of the construct (pZG103‐SgNCED1‐ ALO ) driven by CaMV 35S (a) and analysis of transgenic tobacco plants overexpressing ALO (A53 and A75) and SgNCED1 (N16 and N61) or co‐expressing SgNCED1 and ALO (NA1 and NA2) in comparison with the wild‐type control (WT). Fifteen micrograms of DNA was digested with Eco RI for DNA hybridization using digoxigenin labelled bar as probe (b). Relative expression of SgNCED1 and ALO was measured by quantitative RT‐PCR (c). Abscisic acid (d) and ascorbic acid (e) were measured using enzyme‐linked immunosorbent assay and HPLC, respectively. Means of three repeats and standard errors are presented; the same letter above the column indicates no significant difference at P < 0.05.

In consistent with previous observations (Chen et al., 2014; Zhang et al., 2009), higher levels of ABA were observed in lines N16 and N61, while higher levels of AsA were observed in lines A53 and A75 than in the wild type (Figure 1d,e). Both ABA and AsA levels were higher in transgenic lines NA1 and NA2 than in the wild‐type plants; compared to that, ABA level was not affected in lines A53 and A75, and AsA level was not affected in lines N16 and N61 (Figure 1d,e).

Analysis of plant tolerance to drought and chilling stresses

Relative water content and ion leakage were at about 95% and 10%, respectively, in leaves of all tobacco plants under normal growth conditions (data not shown). Relative water content was decreased from 30% to 38%, and ion leakage was increased from 39% to 41% in the wild‐type and transgenic lines A53 and A75 after withholding irrigation, and they showed no significant difference between the wild‐type and transgenic lines A53 and A75. Transgenic lines N16, N61, NA1 and NA2 had significantly higher levels of RWC and lower levels of ion leakage than the wild type (Figure 2a,b). Moreover, MDA levels showed the similar pattern to ion leakage in response to withholding irrigation. No significant difference in MDA levels between the wild‐type and transgenic lines A53 and A75 was observed, but lower levels of MDA were observed in transgenic lines N16, N61, NA1 and NA2 as compared to the wild‐type plants (Figure 2c). When the wild‐type and transgenic lines A53 and A75 became died after withholding irrigation, transgenic lines N16, N61, NA1 and NA2 were survived after the recovery of water supply. The results indicated that drought tolerance was increased in transgenic plants overexpressing SgNCED1 or co‐expressing SgNCED1 and ALO, but not affected in transgenic plants overexpressing ALO gene alone.

Figure 2.

Figure 2

Open in a new tab

Assessment of drought tolerance in transgenic tobacco in comparison with the wild‐type plants (WT). Relative water content (RWC, a), ion leakage (b), and malondialdehyde (MDA, c) were measured when WT plants showed wilting after withholding irrigation. Means of three independent samples and standard errors are presented. The same letter above the columns indicates no significant difference at P < 0.05.

The maximum photochemical efficiency (F v/F m) was usually 0.85 in tobacco plants under normal growth conditions (Sambe et al., 2015). It was decreased from 0.26 to 0.27 in the wild type and N16 and N61 after 3 days of chilling stress at 3 °C, while higher levels of F v/F m were observed in transgenic lines A53, A75 NA1 and NA3 than in the wild type (Figure 3a). Similar to MDA, ion leakage showed no significant difference between the wild‐type and transgenic lines N16 and N61, and lower levels were observed in the transgenic lines A53, A75, NA1 and NA3 than in the wild type after chilling treatment (Figure 3b,c). The results indicated that chilling tolerance was increased in transgenic plants overexpressing ALO or co‐expressing SgNCED1 and ALO, but not affected in transgenic plants overexpressing SgNCED1 alone.

Figure 3.

Figure 3

Open in a new tab

Assessment of chilling tolerance in transgenic tobacco in comparison with the wild‐type plants. The maximum photochemical efficiency (F v/F m, a), ion leakage (b), and malondialdehyde (MDA, c) were measured after 3 days of chilling treatment at 3 °C. Means of three independent samples and standard errors are presented. The same letter above the columns indicates no significant difference at P < 0.05.

Analysis of transgenic stylo plants co‐expressing SgNCED1 and ALO

Our preliminary experiment data had shown that callus could not been induced when cotyledons of stylo were placed on callus induction medium containing 0.6 mg/L of basta for 5 weeks (data not shown). Thus, 0.6 mg/L of basta was used as selection pressure for transformants in this study. Transgenic stylo plants co‐expressing SgNCED1 and ALO genes were further generated using cotyledons from stylized 1‐week‐old seedlings as explants and bar as selective marker gene. After the regenerated plants were analysed by PCR (data not shown), PCR‐positive plants were further analysed by DNA blot hybridization. The data showed that bar gene was integrated into the genomes of the 15 transgenic plants; among them, 11 plants had one copy of transgene, three plants had two copies, and one plant had four copies, whereas no cross‐hybridization was observed in the wild type (Figure 4a). Real‐time quantitative RT‐PCR data showed that SgNCED1 and ALO transcripts could be detected in most of the transgenic lines (Figure 4b). Three lines (2, 15 and 17) were selected for the analysis of ABA and AsA levels. Levels of ABA, AsA and total AsA (AsA + DHA) were all significantly increased in transgenic lines as compared to the wild type. Compared to the wild type, 2.31‐ to 3.38‐fold higher levels of AsA were observed in transgenic lines (Figure 5).

Figure 4.

Figure 4

Open in a new tab

Analysis of transgenic stylo plants co‐expressing SgNCED1 and ALO in comparison with the wild‐type control (WT). Fifteen micrograms of DNA was digested with Eco RI for DNA hybridization using digoxigenin labelled bar as probe (a). Relative expression of SgNCED1 and ALO was measured using quantitative RT‐PCR (b).

Figure 5.

Figure 5

Open in a new tab

Abscisic acid (ABA) and ascorbic acid (AsA) levels of transgenic stylo plants co‐expressing SgNCED1 and ALO (lines 2, 15 and 17) in comparison with the wild‐type control (WT). ABA (a) and AsA (b) were measured using enzyme‐linked immunosorbent assay and HPLC, respectively. Means of three repeats and standard errors are presented; the same letter above the column indicates no significant difference at P < 0.05.

Evaluation on tolerance to drought and chilling in transgenic stylo plants

Compared to the wild type, transgenic stylo plants had higher levels of F v/F m after 5 days of chilling stress at 6 °C (Figure 6a). In consistence, lower levels of ion leakage and MDA were observed in transgenic plants than in the wild type after chilling treatment (Figure 6b,c). Transgenic plants were survived after 5 days of recovery at room temperature, when most of the wild‐type plants were died (Figure 6d). The results suggest that transgenic plants had increased chilling tolerance.

Figure 6.

Figure 6

Open in a new tab

Assessment of chilling tolerance in transgenic stylo in comparison with the wild‐type (WT) plants. The maximum photochemical efficiency (F v/F m, a), ion leakage (b), and malondialdehyde (MDA, c) were measured after 3 days of chilling treatment at 3 °C. (d) Photography was taken 5 days after recovery at room temperature. Means of three independent samples and standard errors are presented. The same letter above the columns indicates no significant difference at P < 0.05.

Drought tolerance was also assessed by measuring RWC, ion leakage and MDA. RWC and ion leakage were at about 95% and 5%, respectively, in stylo leaves under normal growth conditions (Zhou et al., 2005a). Relative water content was decreased to 21.4% in the wild type, while 45.6 to 55.7% RWC was maintained in transgenic plants after 7 days of withholding irrigation (Figure 7a). In addition, lower levels of ion leakage and MDA were observed in transgenic plants than in the wild type (Figure 7b,c). In contrast to the wild‐type plants which could not survive after the drought treatment, most of the transgenic plants survived 5 days after recovery by resupplying water (Figure 7d). The results suggest that transgenic plants had increased drought tolerance.

Figure 7.

Figure 7

Open in a new tab

Assessment of drought tolerance in transgenic stylo in comparison with the wild‐type (WT) plants. Relative water content (RWC, a), ion leakage (b), and malondialdehyde (MDA, c) were measured when WT plants showed wilting after withholding irrigation. (d) Photography was taken 5 days after recovery under irrigation conditions. Means of three independent samples and standard errors are presented. The same letter above the columns indicates no significant difference at P < 0.05.

Analysis of antioxidant enzyme activities and expression of abiotic stress response genes in transgenic tobacco and stylo plants

Compared to those in the wild type, SOD, CAT and APX activities were not altered in ALO transgenic tobacco plants, while they were increased in transgenic tobacco overexpressing SgNCED1 or co‐expressing SgNCED1 and ALO (Figure 8a–c). Similarly, higher levels of SOD, CAT and APX activities were also observed in transgenic stylo plants than in the wild type (Figure 8d–f).

Figure 8.

Figure 8

Open in a new tab

Analysis of antioxidant enzyme activities in transgenic tobacco (a–c) and stylo plants (d–f). Enzyme activities were measured from plant leaves under normal growth conditions. Means of three independent samples and standard errors are presented. The same letter above the columns indicates no significant difference at P < 0.05.

Eight abiotic stress‐responsive genes were analysed in transgenic lines in comparison with the wild type. P5CS1 (encoding delta‐pyrroline‐5‐C synthase), TIP (encoding tonoplast intrinsic protein) and ERD10B (encoding dehydrin) are drought‐ and ABA‐responsive genes (Yamaguchi‐Shinozaki and Shinozaki, 2006). Their transcript levels were higher in transgenic plants expressing SgNCED1 or co‐expressing SgNCED1 and ALO than in the wild type, while NtP5CS transcript level was lower and NtTIP and NtERD10B levels showed no significant difference in transgenic plants expressing ALO as compared to the wild type (Figure 9a–c), indicating that these genes were induced by ABA as a result of expression of SgNCED1. NtCOR15a, NtDREB1, NtDREB2, NtDREB3 and NtDREB4 are cold‐responsive genes. NtDREB1, 2, 3 and 4 belong to C‐repeat binding factor (CBFs)/DREB1s as they had the conserved PKKP/RAGR×KF×ETRHP and DSAWR, two signature sequences of CBFs located immediately upstream and downstream of the AP2 domain, respectively (He et al., 2015). Compared to the higher levels of NtCOR15a in all transgenic plants (Figure 9d), levels of NtDREB1, NtDREB2, NtDREB3 and NtDREB4 transcripts were higher in transgenic plants expressing ALO or co‐expressing SgNCED1 and ALO than in the wild type, but they were not altered in SgNCED1 transgenic plants (Figure 9e–h). The results indicate that expression of NtCOR15a, NtDREB1, NtDREB2, NtDREB3 and NtDREB4 was induced by AsA as a result of expression of ALO.

Figure 9.

Figure 9

Open in a new tab

Analysis of transcript levels of NtP5CS (a), NtTIP (b), NtERD10B (c), NtCOR15a (d), NtDREB1 (e), NtDREB2 (f), NtDREB3 (g), NtDREB4 (h) in the transgenic tobacco plants in comparison with the wild‐type control (WT). Relative expression was measured using qRT‐PCR using actin was as a reference gene. The same letter above the columns indicates no significant difference at P < 0.05.

Discussion

Up‐regulation of ABA synthesis by overexpressing NCED gene usually results in enhanced tolerance to drought and salinity in transgenic plants through induced stomata closure and antioxidant enzyme activity (Iuchi et al., 2001; Qin and Zeevaart, 2002; Zhang et al., 2008, 2009). It has been well documented that antioxidant protection system plays an important role in drought and chilling tolerance (Guo et al., 2006; Lu et al., 2013). Abscisic acid levels and drought tolerance were increased in transgenic tobacco plants overexpressing SgNCED1 or co‐expressing SgNCED1 and ALO genes. Activities of SOD, CAT and APX and transcript levels of NtP5CS1, NtTIP and NtERD10B, ABA‐ and drought‐responsive genes were also increased in the above two types of transgenic tobacco, but not in ALO transgenic tobacco. The results indicated that the increased activities were associated with elevated ABA levels as a result of expression of SgNCED1 gene that induces expression of antioxidant enzyme‐encoding genes (Zhang et al., 2009) and other ABA‐responsive genes. Nevertheless, the ABA‐induced antioxidant enzyme activities and expression of ABA‐responsive genes were associated with the elevated drought tolerance in transgenic plants overexpressing ALO or co‐expressing SgNCED1 and ALO genes. However, chilling tolerance was not altered in SgNCED1 transgenic tobacco plants, and expression of some cold‐responsive genes, such as NtDREB1, 2, 3 and 4, was neither altered. On the contrary, exogenous application of ABA increases chilling tolerance of stylo with induced activities of SOD, CAT, APX and GR (Zhou et al., 2005a). The differential effect of ABA on chilling tolerance in tobacco and stylo might be resulted from the difference in sensitivity to ABA among plant species.

An elevated AsA levels and chilling tolerance were observed in transgenic tobacco plants overexpressing ALO or co‐expressing SgNCED1 and ALO genes in this study, but not in SgNCED1 transgenic tobacco, indicating that the increased chilling tolerance was associated with elevated AsA levels due to the expression of ALO gene. In addition, expression of NtCOR15a and four NtDREB genes which belong to CBFs/DREB1s type (He et al., 2015) was induced by AsA as a result of expression of ALO. It is interesting that AsA up‐regulates expression of cold‐responsive genes apart from being an antioxidant. Many defence genes have been found to be up‐regulated by AsA deficiency in vtc1 mutant of Arabidopsis (Pastori et al., 2003). The results revealed that AsA plays an important role in chilling tolerance. Multiple abiotic stresses induce the production of ROS and lead to oxidative damage to plant cells. Ascorbic acid is an abundant antioxidant in plant cell and functions to scavenging to avoid accumulation of ROS under stress conditions (Foyer and Noctor, 2009; Gill and Tuteja, 2010). Exogenous application of AsA increases tolerance to drought, chilling, salinity and Al‐induced oxidative damages in rice and tomato seedlings (Guo et al., 2005; Shatlata and Neumann, 2001). Up‐regulation of AsA synthesis results in enhanced tolerance to salinity, high light‐ and MV‐induced oxidative stress and aluminium toxicity (Chen et al., 2014; Liu et al., 2013). However, drought tolerance was not altered in ALO transgenic plants, which might be resulted from that the elevated AsA levels were not high enough to increase drought tolerance in ALO transgenic tobacco, or expression of some drought‐ and ABA‐responsive genes, such as NtP5CS, NtTIP and NtERD10B, was not altered or even down‐regulated by AsA.

Based on the report that bar is an effective selection marker (Sarra et al., 1994), transgenic stylo plants co‐expressing SgNCED1 and ALO genes were obtained in this study using basta as selection pressure. Similar to the transgenic tobacco, transgenic stylo plants showed elevated ABA and AsA levels and tolerance to drought and chilling with induced antioxidant enzyme activities. In addition, AsA is critical to the effectiveness of the immune system in domestic animals. The antioxidant properties of AsA may enhance immune function in dairy cows (MacLeod et al., 2003) and may also impart improved quality to beef (Yin et al., 1993). Our result suggests that co‐expression of SgNCED1 and ALO genes is an effective way for use in forage plant improvement for increased tolerance to drought and chilling and nutrition quality.

Material and methods

Generation of transgenic plants

The construct pZG103‐SgNCED1‐ALO (Figure 1a) was formed using pCAMBIA3301 as basic plasmid, in which coding sequence of SgNCED1 (Zhang et al., 2008) driven by CaMV 35S promoter with a NOS terminator was inserted, while β‐glucuronidase gene (uidA) was replaced by coding sequence of ALO (Chen et al., 2014). Transgenic tobacco plants were generated as previously described (Zhang et al., 2008), but using Agrobacterium tumefaciens strain EHA105 harbouring the construct pZG103‐SgNCED1‐ALO and 0.6 mg/L basta instead of kanamycin for selection. For transformation of stylo, seeds of a chilling tolerant mutant line 4‐1‐3‐8 (Lu et al., 2013) were incubated in heat water (80 °C) for 3 min and then were sterilized for 30 min in 3.5% (v/v) aqueous solution of sodium hypochlorite, followed by five rinses with sterile, distilled water. After germinated for 7–10 days on 1/2 strength MS medium without phytohormones, cotyledons were cut into two parts and were incubated in suspension cells of A. tumefaciens strain EHA105 harbouring the construct pZG103‐SgNCED1‐ALO for 10 min with gentle shaking. Excess bacteria were removed with sterilized paper towel after the incubation; the explants were transferred onto solid cocultivation medium containing MS salts, sucrose (30 g/L), α‐naphthylacetic acid (NAA, 0.5 mg/L) and 6‐benzylaminopurine (BAP, 2 mg/L) and placed in the dark at 25 °C for 3 days. The infected explants were then transferred onto the callus induction medium containing MS salts, sucrose (30 g/L), agar (6.5 g/L), NAA (0.5 mg/L), BAP (2 mg/L), cefazolin sodium (200 mg/L), carbenicillin (200 mg/L) and agar (6.5 g/L), pH 5.8, for 1 week of recovery. The explants were transferred onto selection medium containing MS salts, sucrose (30 g/L), agar (6.5 g/L), NAA (0.5 mg/L), BAP (2 mg/L), cefazolin sodium (200 mg/L), carbenicillin (200 mg/L), basta (0.6 mg/L) and agar (6.5 g/L), pH 5.8, for 5 weeks of selection. Basta‐resistant calli were transferred onto regeneration medium containing MS salts, sucrose (30 g/L), agar (6.5 g/L), BAP (2 mg/L), cefazolin sodium (200 mg/L), carbenicillin (200 mg/L), basta (0.6 mg/L) and agar (6.5 g/L), pH 5.8, for regeneration at 25 °C under light of 80 μmol/m2/s with 16/8‐h (day/night) photoperiod for 8–10 weeks. The regenerated plantlets were transferred onto rooting medium (phytohormone‐free MS basal medium) for rooting. The rooted plants were subsequently transplanted to soil in plastic pots and grown in greenhouse. The positive transgenic plants (T0) were selected from the regenerated basta‐resistant plants using PCR, with primers ZG1409 (CAGCTGCCAGAAACCCACGT) and ZG1410 (CTGCACCATCGTCAACCACT), and DNA blot hybridization and allowed to harvest seeds. By selection with resistance to basta (60 mg/L) at seedlings stage of T1 and T2 plants, homozygous transgenic lines were harvested for investigation.

Real‐time quantitative RT‐PCR

Total RNA was isolated from 0.1 g leaves using HiPure Plant RNA Mini Kit (Magen, Guangzhou, China) according to the manufacturer's protocol. First‐strand cDNA was synthesized from 1 μg of total RNA, using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio Inc., Dalian, China). PCR solutions (10 μL) contained 15 ng of cDNA, 200 nm each for forward and reverse primers and 5 μL SYBR Premix Ex Taq (Takara). Real‐time quantitative RT‐PCR (qRT‐PCR) was conducted in Mini Option real‐time PCR System (Bio‐Rad, Hercules, CA, USA) according to the manufacturer's instructions. A negative control without cDNA template was always included. Three technical and two biological replicates were performed in each experiment. Parallel reactions to amplify actin1 were used to normalize the amount of template. Primers used for qRT‐PCR were listed in Table S1. All primers were designed using the software tool Beacon Designer (Premier Biosoft International, Palo Alto, CA, USA). The primer specificity was validated by melting profiles, showing a single product‐specific melting temperature.

DNA blot hybridization

Genomic DNA was extracted from 1 g of leaves using the hexadecyltrimethylammonium bromide method. After digested with EcoRI overnight, DNA samples (10 μg) were separated by electrophoresis on 0.8% agarose gel, followed by transferring to Hybond XL nylon membrane (Amersham; GE Healthcare Limited, Buckinghamshire, UK). DNA probe specific to bar gene was labelled using a PCR digoxigenin probe synthesis kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. After hybridization, the DNA filter was washed sequentially with 2× SSC, 0.1% SDS; 1× SSC, 0.1% SDS for 10 min at room temperature; and 0.5× SSC, 0.1% SDS for 15 min at 65 °C. Detection of the signals was carried out using a Lumivision PRO (TAITEC, Saitama, Japan).

Measurements of ABA and AsA

Abscisic acid was determined using enzyme‐linked immunosorbent assay kit (made by the China Agricultural University), following the manufacturer's instruction as described previously (Yang and Guo, 2007). Ascorbic acid was determined by HPLC system (Model HP1100; Alltech Associates, Inc., Deerfield, Illinois) as described previously (Chen et al., 2014). Leaves (0.2 g) were extracted in 2 mL of 10% trichloroacetic acid. The homogenates were centrifuged at 15 000  g for 15 min. The supernatants (20 μL) were passed through TSK‐Gel C18 column (4.5 × 250 mm) and eluted with 0.1% H2SO4 at a rate of 0.8 mL min−1 at room temperature. Detection was performed at 240 nm. One dominant peak at the same retention as the standard AsA was calculated.

Assessment of abiotic stress tolerance

Seeds of the homozygous transgenic tobacco (T3) and stylo (T2) in comparison with the wild‐type plants were sown in 50 pot containing a mixture of peat and perlite (3:1, v/v) in a greenhouse at temperatures of 30/25 °C (day/night) under light of 800 μmol/m2/s. One tobacco plant was kept in one pot and grown for 2 months, while two stylo plants were kept in each pot and allowed to grow for 1 month. For drought treatment, plants were continuously withheld irrigation until the wild‐type plants showed serious wilting. For chilling treatment, plants were moved to a growth chamber under 800 μmol/m2/s at 3 °C for 3 days (for tobacco) or 6 °C for 5 days (for stylo). The third leaf from the top was sampled and used to measure relative water content (RWC), ion leakage, MDA and F v/F m as described previously (Guo et al., 2006; Lu et al., 2013). Photography was taken 5 days after resuming irrigation or recovery at room temperature.

Determination of antioxidant enzyme activity

The third leaf (0.2 g) from the top was sampled from 2‐month tobacco seedlings which were ground in 5 mL of 50 mm phosphate buffer solution (pH 7.8) for extraction of SOD and CAT, or in 5 mL of 50 mm phosphate buffer (pH 7.0, containing 1 mm AsA and 1 mm EDTA) for extraction of APX (Guo et al., 2006). After centrifugation at 13 000  g for 15 min, the supernatants were recovered for determinations of SOD, CAT and APX as previously described (Guo et al., 2006). One unit of SOD activity was defined as the amount of enzyme required for the inhibition of photochemical reduction of p‐nitro blue tetrazolium chloride (NBT) by 50%. One unit of CAT and APX was defined as the amount of enzyme required for catalyszing the conversion of one μmol H2O2 (extinction coefficient 0.0394 mm ‐1/cm) or AsA (extinction coefficient 2.8 mm ‐1/cm) within 1 min. Protein contents in the enzyme extracts were determined using Coomassie brilliant blue G‐250 (Bradford, 1976).

Statistical analysis

All the measurements were repeated three times from different individual plants. All data were subjected to analysis of variances according to the model for completely randomized design using an spss programme (SPSS Inc, Chicago, IL, USA). Differences among means of treatments or plant lines were evaluated by Duncan's test at 0.05 probability level.

Supporting information

Table S1 Primer sequences used for quantitative RT‐PCR and the accession numbers of the analysed genes.

PBI-14-206-s001.doc (47.5KB, doc)

Acknowledgements

This work was funded by grants from Research Fund for the Doctoral Program of Higher Education of China (20134404110008) and Guangdong Provincial Science and Technology Project (2011B020304005).

References

  1. Agius, F. , González‐Lamothe, R. , Caballero, J.L. , Muñosz‐Blanco, J. , Botella, M.A. and Valpuesta, V. (2003) Engineering increased vitamin C levels in plants by overexpression of a D‐galacturonic acid reductase. Nat. Biotechnol. 21, 177–181. [DOI] [PubMed] [Google Scholar]
  2. Bradford, M.M. (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein‐dye binding. Anal. Biochem. 72, 248–254. [DOI] [PubMed] [Google Scholar]
  3. Bulley, S.M. , Rassam, M. , Hoser, D. , Otto, W. , Schünemann, N. , Wright, M. , MacRae, E. , Gleave, A. and Laing, W. (2009) Gene expression studies in kiwifruit and gene over‐expression in Arabidopsis indicates that GDP‐L‐galactose guanyltransferase is a major control point of vitamin C biosynthesis. J. Exp. Bot. 60, 765–778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bulley, S. , Wright, M. , Rommens, C. , Yan, H. , Rassam, M. , Lin‐Wang, K. , Andre, C. , Brewster, D. , Karunairetnam, S. , Allan, A.C. and Laing, W.A. (2011) Enhancing ascorbate in fruits and tubers through over‐expression of the L‐galactose pathway gene GDP‐L‐galactose phosphorylase. Plant Biotechnol. J. 10, 390–397. [DOI] [PubMed] [Google Scholar]
  5. Chen, Z. and Gallie, D.R. (2005) Increasing tolerance to ozone by elevating foliar ascorbic acid confers greater protection against ozone than increasing avoidance. Plant Physiol. 138, 1673–1689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen, Z. , Qing, C. , Li, L. , Zeng, X. , Zhao, Y. , He, S. , Lu, S. and Guo, Z. (2014) Overexpression of yeast arabinono‐1,4‐lactone oxidase gene (ALO) increases tolerance to oxidative stress and Al toxicity in transgenic tobacco plants. Plant Mol. Biol. Rep. doi: 10.1007/s11105-014-0794-1. [DOI] [Google Scholar]
  7. Conklin, P.L. and Barth, C. (2004) Ascorbic acid, a familiar small molecule intertwined in the response of plants to ozone, pathogens, and the onset of senescence. Plant Cell Environ. 27, 959–970. [Google Scholar]
  8. De La Rue, S.J. , Hopkinson, R. , Foster, S. and Gibb, K.S. (2003) Phytoplasma host range and symptom expression in the pasture legume Stylosanthes . Field Crops Res. 84, 327–334. [Google Scholar]
  9. Foyer, C.H. and Noctor, G. (2009) Redox regulation in photosynthetic organisms: signaling, acclimation, and practical implications. Antioxid. Redox Signal. 11, 861–905. [DOI] [PubMed] [Google Scholar]
  10. Fujita, Y. , Fujita, M. , Shinozaki, K. and Yamaguchi‐Shinozaki, K. (2011) ABA‐mediated transcriptional regulation in response to osmotic stress in plants. J. Plant. Res. 124, 509–525. [DOI] [PubMed] [Google Scholar]
  11. Gallie, D.R. (2013) L‐Ascorbic acid: a multifunctional molecule supporting plant growth and development. Scientifica, 2013, 1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gill, S.S. and Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48, 909–930. [DOI] [PubMed] [Google Scholar]
  13. Guo, Z. , Tan, H. , Zhu, Z. , Lu, S. and Zhou, B. (2005) Effect of intermediates on ascorbic acid and oxalate biosynthesis of rice and in relation to its stress resistance. Plant Physiol. Biochem. 43, 955–962. [DOI] [PubMed] [Google Scholar]
  14. Guo, Z. , Ou, W. , Lu, S. and Zhong, Q. (2006) Differential responses of antioxidative system to chilling and drought in four rice cultivars differing in sensitivity. Plant Physiol. Biochem. 44, 828–836. [DOI] [PubMed] [Google Scholar]
  15. He, X , Sambe, M.A.N. , Zhuo, C , Tu, Q and Guo, Z. (2015) A temperature induced lipocalin gene from Medicago falcata (MfTIL1) confers tolerance to cold and oxidative stress. Plant Mol. Biol. doi: 10.1007/s11103-015-0304-3. [DOI] [PubMed] [Google Scholar]
  16. Hemavathi, U. , Upadhyaya, C.P. , Akula, N. , Young, K.E. , Chun, S.C. , Kim, D.H. and Park, S.W. (2010) Enhanced ascorbic acid accumulation in transgenic potato confers tolerance to various abiotic stresses. Biotechnol. Lett. 32, 321–330. [DOI] [PubMed] [Google Scholar]
  17. Huh, W.‐K. , Kim, S.‐T. , Yang, K.‐S. , Seok, Y.‐J. , Hah, Y.C. and Kang, S.‐O. (1994) Characterization of D‐arabinono‐1,4‐lactone oxidase from Candida albicans ATCC 10231. Eur. J. Biochem. 225, 1073–1079. [DOI] [PubMed] [Google Scholar]
  18. Iuchi, S. , Kobayashi, M. , Yamaguchi‐Shinozaki, K. and Shinozaki, K. (2000) A stress‐inducible gene for 9‐cis‐epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought‐tolerant cowpea. Plant Physiol. 123, 553–562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Iuchi, S. , Kobayashi, M. , Taji, T. , Naramoto, M. , Seki, M. , Kato, T. , Tabata, S. , Kakubari, Y. , Yamaguchi‐Shinozaki, K. and Shinozaki, K. (2001) Regulation of drought tolerance by gene manipulation of 9‐cis‐epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis . Plant J. 27, 325–333. [DOI] [PubMed] [Google Scholar]
  20. Jiang, C.‐S. , Ma, X.‐R. , Zhou, D.‐M. and Zhang, Y.‐Z. (2005) AFLP analysis of genetic variability among Stylosanthes guianensis accessions resistant and susceptible to the stylo anthracnose. Plant Breed. 124, 595–598. [Google Scholar]
  21. Lee, B.‐H. , Hu, W.‐K. , Kim, S.‐T. , Lee, J.‐S. and Kang, S.‐O. (1999) Bacterial production of D‐erythroascorbic acid and L‐ascorbic acid through functional expression of Saccharomyces cerevisiae D‐arabinono‐1,4‐lactone oxidase in Escherichia coli . Appl. Environ. Microbiol. 65, 4685–4687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liu, W. , An, H.‐M. and Yang, M. (2013) Overexpression of Rosa roxburghii L‐galactono‐1,4‐lactone dehydrogenase in tobacco plant enhances ascorbate accumulation and abiotic stress tolerance. Acta Physiol. Plant. 35, 1617–1624. [Google Scholar]
  23. Lu, S. , Wang, X. and Guo, Z. (2013) Differential responses to chilling in Stylosanthes guianensis (Aublet) Sw. and its mutants. Agron. J. 105, 377–382. [Google Scholar]
  24. MacLeod, D. , Ozimeck, L. and Kennelly, J.J. (2003) Supplemental vitamin C may enhance immune function in dairy cows. In: Proceedings of Western Canadian Dairy Seminar, URL, http://www.wcds.ca/proc/1996/wcd96227.htm.
  25. Mahajan, S. and Tuteja, N. (2005) Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444, 139–158. [DOI] [PubMed] [Google Scholar]
  26. Matsui, T. (2012) Vitamin C nutrition in cattle. Asian‐Australas. J. Anim. Sci. 25, 597–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nambara, E. and Marion‐Poll, A. (2005) Abscisic acid biosynthesis and catabolism. Annu. Rev. Plant Biol. 56, 165–185. [DOI] [PubMed] [Google Scholar]
  28. Pastori, G.M. , Kiddle G. Antoniw, J. , Bernard, S. , Veljovic‐Jovanovic, S. , Verrier, P.J. , Noctor, G. and Foyer, C.H. (2003) Leaf vitamin C contents modulate plant defense transcripts and regulate genes that control development through hormone signaling. Plant Cell, 15, 939–951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Qin, X. and Zeevaart, J.A.D. (1999) The 9‐cis‐epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water‐stressed bean. Proc. Natl Acad. Sci. USA, 96, 15354–15361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Qin, X. and Zeevaart, J.A.D. (2002) Overexpression of a 9‐cis‐epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance. Plant Physiol. 128, 544–551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Quecini, V.M. , Alves, A.C. , Oliveira, C.A. , Aragão, F.J.L. , Rech, E.L. , Almeida, E.R.P. , Gander, E.S. and Vieira, M.L.C. (2006) Microparticle bombardment of Stylosanthes guianensis: transformation parameters and expression of a methionine‐rich 2S albumin gene. Plant Cell Tissue Organ Cult. 87, 167–179. [Google Scholar]
  32. Roychoudhury, A. , Paul, S. and Basu, S. (2013) Cross‐talk between abscisic acid‐dependent and abscisic acid‐independent pathways during abiotic stress. Plant Cell Rep. 32, 985–1006. [DOI] [PubMed] [Google Scholar]
  33. Sambe, M.A.N. , He, X. , Tu, Q. and Guo, Z. (2015) A cold‐induced myo‐inositol transporter‐like gene (MfINT‐like) confers tolerance to multiple abiotic stresses in transgenic tobacco plants. Physiol. Plant. 153, 355–364. [DOI] [PubMed] [Google Scholar]
  34. Sarra, R. , Calderon, A. , Thro, A.M. , Torres, E. , Mayer, J.E. and Roca, W.M. (1994) Agrobacterium‐mediated transformation of Stylosanthes guianensis and production of transgenic plants. Plant Sci. 96, 119–127. [Google Scholar]
  35. Shatlata, A. and Neumann, P.M. (2001) Exogenous ascorbic acid (vitamin C) increases resistance to salt stress and reduces lipid peroxidation. J. Exp. Bot. 52, 2207–2211. [DOI] [PubMed] [Google Scholar]
  36. Smirnoff, N. and Wheeler, G.L. (2000) Ascorbic acid: metabolism and functions of a multifacetted molecule. Curr. Opin. Plant Biol. 3, 229–235. [PubMed] [Google Scholar]
  37. Tokuna, T. , Miyahara, K. , Tabata, K. and Esaka, M. (2005) Generation and properties of ascorbic acid‐over‐producing transgenic tobacco cells expressing sense RNA for L‐galactono‐1,4‐lactone dehydrogenase. Planta, 220, 854–863. [DOI] [PubMed] [Google Scholar]
  38. Wheeler, G.L. , Hibes, M.A. and Smirnoff, N. (1998) The biosynthetic pathway of vitamin C in higher plants. Nature, 393, 365–369. [DOI] [PubMed] [Google Scholar]
  39. Xiong, L. and Zhu, J.K. (2003) Regulation of abscisic acid biosynthesis. Plant Physiol. 133, 29–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yamaguchi‐Shinozaki, K. and Shinozaki, K. (2006) Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 57, 781–803. [DOI] [PubMed] [Google Scholar]
  41. Yang, J. and Guo, Z. (2007) Cloning of a 9‐cis‐epoxycarotenoid dioxygenase gene (SgNCED1) from Stylosanthes guianensis and its expression in response to abiotic stresses. Plant Cell Rep. 26, 1383–1390. [DOI] [PubMed] [Google Scholar]
  42. Yin, M.C. , Faustman, C. , Riesen, J.W. and Williams, S.N. (1993) α‐Tocopherol and ascorbate delay oxymyoglobin and phospholipid oxidation in vitro. Food Sci. 6, 1273–1276. [Google Scholar]
  43. Zhang, Y. , Yang, J. , Lu, S. , Cai, J. and Guo, Z. (2008) Over‐expressing SgNCED1 in tobacco increases ABA level, antioxidant enzyme activities and stress tolerance. J. Plant Growth Reg. 27, 151–158. [Google Scholar]
  44. Zhang, Y. , Tan, J. , Guo, Z. , Lu, S. , Shu, W. and Zhou, B. (2009) Increased ABA levels in 9‐cis‐epoxycartenoid dioxygenase over‐expressing transgenic tobacco influences H2O2 and NO production and antioxidant defences. Plant Cell Environ. 32, 509–519. [DOI] [PubMed] [Google Scholar]
  45. Zhou, B. and Guo, Z. (2009) Calcium is involved in the abscisic acid‐induced chilling resistance, ascorbate peroxidase and superoxide dismutase in Stylosanthes guianensis . Biol. Plant. 53, 63–68. [Google Scholar]
  46. Zhou, B. , Guo, Z. and Lin, L. (2005a) Effects of abscisic acid on antioxidant systems of Stylosanthes guianensis (Aublet) Sw. under chilling stress. Crop Sci. 45, 599–605. [Google Scholar]
  47. Zhou, B. , Guo, Z. , Xing, J. and Huang, B. (2005b) Nitric oxide is involved in abscisic acid‐induced antioxidant activities in Stylosanthes guianensis . J. Exp. Bot. 56, 3223–3228. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 Primer sequences used for quantitative RT‐PCR and the accession numbers of the analysed genes.

PBI-14-206-s001.doc (47.5KB, doc)

Articles from Plant Biotechnology Journal are provided here courtesy of Society for Experimental Biology (SEB) and the Association of Applied Biologists (AAB) and John Wiley and Sons, Ltd

RESOURCES